TMOL Ch13 Qas Evens

The MOLECULES of LIFE Physical and Chemical Principles

Selected Solutions for Students Prepared by James Fraser and Samuel Leachman

Chapter 13 Specificity of Macromolecular Recognition

Problems True/False and Multiple Choice 2. Which of the following is an attribute of the FGF–FGFR family of interactions? a. Each FGF ligand has high specificity for an FGF receptor. b. Because there are 18 FGF and 4 FGFR genes, there are 72 potential interactions. c. Signaling specificity is enhanced through selective expression of only a few receptors per tissue type. d. FGFRs are soluble serine/threonine kinases. e. FGF proteins have highly diverse folds. 4. Most of the binding energy for SH2 domain–peptide interactions is contributed by: a. b. c. d.

Amino–aromatic interactions. The phosphorylation of the peptide tyrosine. The amino acid in the peptide + 1 position. The amino acid in the peptide + 3 position.

6. Interface residues that do not contribute greatly to binding affinity are also generally unimportant for specificity. True/False

Fill in the Blank 8.

_____________ residues, identified by mutating residues to alanine, contribute a larger than expected energy to the interaction affinity of human growth hormone with human growth hormone receptor. Answer: Hot spot

10. Proteins distinguish double-helical RNA and DNA by differences in _______ shape. Answer: groove

12. Examining complexes of nucleic acids and their binding proteins reveals a high _____________ in both shape and charge. Answer: complementarity

Quantitative/Essay (Assume T = 300 K and RT = 2.5 kJ•mol–1 for all questions.) 14. A scientist wants to engineer an antibody to distinguish between two proteins (Cyclophilin A and Cyclophilin B) with a specificity of 500 at 1 nM concentration for each protein. Her starting material is an antibody that binds with 10 nM KD to both proteins. She finds that she can easily make mutations that decrease the affinity for Cyclophilin B without affecting the affinity for Cyclophilin A. When she achieves the desired specificity, what is the KD for Cyclophilin B? Answer:

α = (1/(1 + KD,CypA/[L]))/(1/(1 + KD,CypB/[L])) KD,CypB = α × ([L] + KD,CypA) – [L] KD,CypB = 5.5 μM 16. A zinc finger protein is isolated from a yeast cell. The value of KD for its binding site is 3 µM. In the presence of glucose, the protein dimerizes and recognizes an inverted repeat binding site. a. What is the expected value of KD if the binding is additive? b. The dimeric KD is measured at 5 nM. Why does this value deviate from the expected KD? Answer: a. KD,dimer = (KD,monomer)2 = (3 × 10–6) = 9 × 10–12 = 9 pM

The Molecules of Life by John Kuriyan, Boyana Konforti, and David Wemmer © Garland Science

2

Chapter 13: Specificity of Macromolecular Recognition b. The simple additivity of free energy is probably reduced because energy is used to induce conformational changes in the DNA and protein to stabilize the dimer.

18. A protein–protein interface has a 10 nM affinity at 300 K. A series of mutants are made in which each residue at the interface is replaced by alanine. A lysine residue at the center of the interface is mutated, and found to contribute 4 kJ•mol–1 to the binding free energy. a. What is the new KD? b. Explain whether or not the lysine residue is a hot spot residue. Answer: a. ∆∆G = –4 kJ•mol–1 = ∆GLys – ∆GAla = RT ln(KD,Lys) – RT ln(KD,Ala) RT ln(KD,Ala) = RT ln(KD,Lys) – 4 kJ•mol–1 = RT ln(10–8) + 4 kJ•mol–1 = –42 kJ•mol–1 KD,Ala = e(–16.8) = 5.0 × 10–8 = 50 nM b. Since the Lysine residue contributes only 4 kJ•mol–1 of binding energy, it is likely not a hotspot residue. 20. A protein–protein interface comprises 22 residues at the contact surface. From structures of the isolated proteins, it is expected that completely burying these residues would cause a surface area reduction of ~2000 Å2. However, a structure of the interface reveals that only 1200 Å2 of surface area is buried. Why is there a discrepancy between the expected and measured surface area reductions? Answer: Because the shape complementarity is not perfect, many residues are not completely buried in the bound complex. Additionally, residues that interfacial waters, which are important for providing hydrogen bonding networks at interfaces, are not normally counted as part of the buried surface area.

22. A DNA-binding domain binds the sequence GATCGCAATATCGATCGATC with a 25 nM affinity. A mutation of an Arg to Ala in the protein or a mutation of the underlined “T” to “G” in the DNA sequence both result in a 9 kJ•mol–1 loss of binding free energy. Simultaneous mutation of both the protein and the DNA also results in a 9 kJ•mol–1 loss of binding free energy. a. What is the effect on the KD of any of these mutations? b. What does the double mutant result suggest about the structural basis for the protein–DNA interaction? Answer: a. ∆∆G = –9 kJ•mol–1 = ∆GArg/G/Arg+G – ∆GAla = RT ln(KD,Arg/G/Arg+G) – RT ln(KD,Ala) –9/2.5 = ln(2.5 × 10–8) – ln(KD,Ala) –3.6 = –17.5 – ln(KD,Ala) KD,Ala = 9.1 × 10–7 b. The lack of additivity suggests that the Arg and T might interact directly, as removing either side of the interaction has the same effect as removing both sides. Given that the T occurs in an AT-rich stretch of DNA and that Arg residues can recognize such stretches through a narrowed minor groove, it is likely that this mechanism contributes to the specific recognition of this stretch of DNA. 24. A complex of seven transcription factors binds a DNA enhancer element. The binding is cooperative. What are two molecular mechanisms that the transcription factors might use to achieve this cooperativity? Answer: The transcription factors may make contact with each other facilitating the assembly of the context. These protein–protein interactions would increase the apparent cooperativity of the protein–DNA interactions. Second, some of the transcription factors may recognize a distorted DNA structure. If one transcription factor stabilizes this distorted structure (and in essence pays the energetic penalty for distorting it away from ideal geometry) then subsequent binding events can rely on the distorted DNA for specific interactions without contributing energy to induce a conformational change in the DNA.

The Molecules of Life by John Kuriyan, Boyana Konforti, and David Wemmer © Garland Science