Steve Talbott Getting Over the Code Delusion

Getting Over the Code Delusion Stephen L. Talbott When it emerged a few years ago that humans and chimpanzees shared, by some measures, 98 or 99 percent of their DNA, a good deal of verbal hand-wringing and chestbeating ensued. How could we hold our heads up with high-browed, post-simian dignity when, as the New Scientist reported in 2003, “chimps are human”? If the DNA of the two species is nearly the same, and if, as most everyone seemed to believe, DNA is destiny, what remained to make us special? Such was the fretting on the human side, anyway. To be truthful, the chimps didn’t seem much interested. And their disinterest, it turns out, was far more fitting than our angst. In 1992, Nobel prize-winning geneticist Walter Gilbert wrote that you and I will one day hold up a CD containing our DNA sequence and say, “Here is a human being; it’s me!” His essay was entitled “A Vision of the Grail.” Today one can only wonder how we became so invested in the almost sacred importance of an abstract and one-dimensional genetic code — a code so thinly connected to the full-fleshed reality of our selves that its entire import could be captured in a skeletal string of four repeating letters, like so: ATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGCAATG It’s true that the code, as it was understood at the height of the genomic era, had some grounding in material reality. Each of the four different letters stands for one of the four nucleotide bases constituting the DNA sequence. And each group of three successive letters (referred to as a “codon”) potentially represents an amino acid, a constituent of protein. The idea was that the bases in a protein-coding DNA sequence, or gene, led to the synthesis of the corresponding sequence of amino acids in a protein. And proteins, folded into innumerable shapes, play a decisive role in virtually all living processes. By specifying the production of proteins, genes were presumed to be bearers of the blueprint, or master program, or molecular instruction book of our lives. As Richard Dawkins summed up in his 1986 book The Blind Watchmaker: There is a sense, therefore, in which the three-dimensional coiled shape of a protein is determined by the one-dimensional sequence of code symbols in the DNA.... The whole translation, from strictly sequential DNA ROM [read-only memory] to precisely invariant three-dimensional protein shape, is a remarkable feat of digital information technology. Certainly the idea of a master program seemed powerful to those who were enamored of it. In their enthusiasm they heralded one revolutionary gene discovery after another — a gene for cystic fibrosis (from which the string of letters above is excerpted), a gene for cancer, a gene for obesity, a gene for depression, a gene for alcoholism, a gene for sexual preference. Building block by building block, genetics was going to show how a living organism could be constructed from mindless, indifferent matter. And yet the most striking thing about the genomic revolution is that the revolution never happened. Yes, it’s been an era of the most amazing technical achievement, marked by an overwhelming flood of new data. It’s true that we are gaining, even if largely by trial and error, certain manipulative powers. But our understanding of the integrity and unified functioning of the living cell has, if anything, been more obscured than illumined by the torrent of data. “Many of us in the genetics community,” write Linda and Edward McCabe in DNA: Promise and Peril (2008), “sincerely believed that DNA analysis would provide us with a molecular crystal ball that would allow us to know quite accurately the clinical futures of our individual patients.” Unfortunately, as they and many others now acknowledge, the reality did not prove so straightforward. As minor tokens of the changing consciousness among biologists, one could cite recent articles in the world’s two premier scientific journals, each reflecting upon the 1989 discovery of the “gene for cystic fibrosis.” “The Promise of a Cure: 20 Years and Counting” — so ran the headline in Science, followed by this slightly sarcastic gloss: “The discovery of the cystic fibrosis gene brought big hopes for gene-based medicine; although a lot has been achieved over two decades, the payoff remains just around the corner.” An echo quickly came from Nature, without the sarcasm: “One Gene, Twenty Years: When the cystic fibrosis gene was found in 1989, therapy seemed around the corner. Two decades on, biologists still have a long way to go.” The story has been repeated for one gene after another, which may be why molecular biologist Tom Misteli offered such a startling postscript to the unbounded optimism of the Human Genome Project. “Comparative genome analysis and large-scale mapping of

genome features,” he wrote in the journal Cell, “shed little light onto the Holy Grail of genome biology, namely the question of how genomes actually work in vivo” (that is, in living organisms). But is this surprising? The human body is not a mere implication of clean logical code in abstract conceptual space, but rather a play of complexly shaped and intricately interacting physical substances and forces. Yet the four genetic letters, in the researcher’s mind, became curiously detached from their material matrix. In many scientific discussions it hardly would have mattered whether the letters of the “Book of Life” represented nucleotide bases or completely different molecular combinations. All that counted were certain logical correspondences between code and protein together with a few bits of regulatory logic, all buttressed by the massive weight of an unsupported assumption: somehow, by neatly executing an immaculate, computer-like DNA logic, the organism would fulfill its destiny as a living creature. The details could be worked out later. The misdirection in all this badly needs elaborating — a task I hope to advance here. As for the differences between humans and chimpanzees, the only wonder is that so many were so exercised by it. If we had wanted to compare ourselves to chimps, we could have done the obvious and direct and scientifically respectable thing: we could have observed ourselves and chimps, noting the similarities and differences. Not such a strange notion, really — unless one is so transfixed by a code abstracted from human and chimp that one comes to prefer it to the organisms themselves. I’m not aware of any pundit who, brought back to reality from the realm of code-fixated cerebration, would have been so confused about the genetic comparison as to invite a chimp home for dinner to discuss world politics. If we had been looking to ground our levitated theory in scientific observation, we would have known that the proper response to the code similarity in humans and chimps was: “Well, so much for the central, determining role we’ve been assigning to our genes.” The central truth arising from genetic research today is that the hope of finding an adequate explanation of life in terms of inanimate, molecular-level machinery was misconceived. Just as we witness the distinctive character of life when we observe the organism as a whole, so, too, we encounter that same living character when we analyze the organism down to the level of molecules and genes. One by one every seemingly reliable and predictable “molecular mechanism” has been caught deviating from its “program” and submitting instead to the fluid life of its larger context. And chief among the deviants is that supposed First Cause, the gene itself. We are progressing into a postgenomic era — the new era of epigenetics. Genomic Perplexities The term “epigenetics” most commonly refers to heritable changes in gene activity not accounted for by alterations or mutations in the DNA sequence. But in order to understand the important developments now underway in biology, it’s more useful to take “epigenetics” in its broadest sense as “putting the gene in its living context.” The genetic code was supposed to reassure us that something like a computational machine lay beneath the life of the organism. The fixity, precision, and unambiguous logical relations of the code seemed to guarantee its strictly mechanistic performance in the cell. Yet it is this fixity, this notion of a precisely characterizable march from cause to effect — and, more broadly, from gene to trait — that has lately been dissolving more and more into the fluid, dynamic exchange of living processes. Organisms, it appears, must be understood and explained at least in part from above downward, from context to subcontext, from the general laws or character of their being to the never-fullyindependent details. To realize the full significance of the truth so often remarked in the technical literature today — namely, that context matters — is indeed to embark upon a revolutionary adventure. It means reversing one of the most deeply engrained habits within science — the habit of explaining the whole as the result of its parts. If an organic context really does rule its parts in the way molecular biologists are beginning to recognize, then we have to learn to speak about that peculiar form of governance, turning our usual causal explanations upside down. A number of conundrums have helped to nudge molecular biology toward a more contextualized understanding of the gene. To begin with, the Human Genome Project revised the human gene count downward from 100,000 to 20,000–25,000. What made the figure startling was the fact that much simpler creatures — for example, a tiny, transparent roundworm — were found to have roughly the same number of genes. More

recently, researchers have turned up a pea aphid with 34,600 genes and a water flea with 39,000 genes. Not even the “chimps are human” boosters were ready to set themselves on the same scale with a water flea. The difference in gene counts required some sort of shift in understanding. A second oddity centered on the fact that, upon “deciphering” the genetic Book of Life, we found that our coding scheme made the vast bulk of it read like nonsense. That is, some 95 or 98 percent of human DNA was useless for making proteins. Most of this “noncoding DNA” was at first dismissed as “junk” — meaningless evolutionary detritus accumulated over the ages. At best, it was viewed as a kind of bag of spare parts, borne by cells from one generation to another for possible employment in future genomic innovations. But that’s an awful lot of junk for a cell to have to lug around, duplicate at every cell division, and otherwise manage on a continuing basis. Another conundrum — perhaps the most decisive one — has been recognized and wrestled with (or more often just ignored) since the early twentieth century. With few exceptions, every different type of cell in the human body contains the same chromosomes and the same DNA sequence as the original, single-celled zygote. Yet somehow this zygote manages to differentiate into every manner of tissue — liver, skin, muscle, brain, blood, bone, retina, and so on. If genes determine the form and substance of the organism, how is it that such radically different cellular architectures result from the same genes? What directs genes to produce the intricately sculpted and differentiated form of a complex organism, and how can this directing agency be governed by the very genes that it directs? The developmental biologist F.R. Lillie, remarking in 1927 on the contrast between “genes which remain the same throughout the life history” and a developmental process that “never stands still from germ to old age,” asserted that “Those who desire to make genetics the basis of physiology of development will have to explain how an unchanging complex can direct the course of an ordered developmental stream.” Think for a moment about this ordered developmental stream. When a cell of the body divides, the daughter cells can be thought of as “inheriting” traits from the parent cell. The puzzle about this cellular-level inheritance is that, especially during the main period of an organism’s development, it leads to a dramatic, highly directed differentiation of tissues. For example, embryonic cells on a path leading to heart muscle tissue become progressively more specialized. The changes each step of the way are “remembered” (that is, inherited) — but what is remembered is caught up within a process of continuous change. During development you cannot say that every cell reproduces “after its own likeness.” Over successive generations, cells destined to become a particular type lose their ability to be transformed into any other tissue type. And so the path of differentiation leads from totipotency (the single-celled zygote is capable of developing into every cell of the body), to pluripotency (embryonic stem cells can transform themselves into many, but not all, tissue types during fetal development), to multipotency (blood stem cells can yield red cells, white cells, and platelets), to the final, fully differentiated cell of a particular tissue. In tissues where cell division continues further, the inheritance thereafter may take on a much greater constancy, with like giving rise (at least approximately) to like. Cells of the mature heart and brain, then, have inherited entirely different destinies, but the difference in those destinies was not written in their DNA sequences, which remain identical in both organs. If we were stuck in the “chimp equals human” mindset, we would have to say that the brain is the same as the heart. From Junk to Living Organism So what’s going on? These puzzles turn out to be intimately related. As organisms rise on the evolutionary scale, they tend to have more “junk DNA.” Noncoding DNA accounts for some 10 percent of the genome in many one-celled organisms, 75 percent in roundworms, and 98 percent in humans. The ironic suspicion became too obvious to ignore: maybe it’s precisely our “junk” that differentiates us from water fleas. Maybe what counts most is not so much the genes themselves as the way they are regulated and expressed. Noncoding DNA could provide the complex regulatory functions that direct genes toward service of the organism’s needs, including its developmental needs. That suspicion has now become standard doctrine — though a still much-too-simplistic doctrine if one stops there. For noncoding as well as coding DNA sequences continue unchanged throughout the organism’s entire trajectory of differentiation, from single cell to maturity. Lillie’s point therefore remains: it is hardly possible for an unchanging

complex to explain an ordered developmental stream. Constant things cannot by themselves explain dynamic processes. We need a more living understanding. It is not only that noncoding DNA is by itself inadequate to regulate genes. What we are finding is that at the molecular level the organism is so dynamic, so densely woven and multidirectional in its causes and effects, that it cannot be explicated as living process through strictly local investigations. When it begins to appear that, as one European research team puts it, “everything does everything to everything,”[1] the search for “regulatory control” necessarily leads to the unified and irreducible functioning of the cell and organism as a whole — a living, metamorphosing form within which each more or less distinct partial activity finds its proper place. The Dynamic Chromosome The usual formula has it that DNA makes RNA and RNA makes protein. The DNA double helix forms a kind of spiraling ladder, with pairs of nucleotide bases constituting the rungs of the ladder: a nucleotide base attached to one siderail (strand) of the ladder bonds with a base attached to the other strand. These two bases are normally complementary, so that an A on one strand pairs only with a T on the other (and vice versa), just as C and G are paired. Because the chemical subunits making up the double helix are asymmetrical and oriented oppositely on the two strands, the strands can be said to “point” in opposite directions. The enzyme that transcribes DNA into RNA must move along the length of a gene in the proper direction, separating the two strands and using one of them as a template for synthesizing an RNA transcript — a transcript that complements the DNA template in much the same way that one DNA strand complements the other. It is by virtue of this complementation that the code for a protein is passed from DNA to RNA. RNA, however, is commonly single-stranded, unlike DNA. Once formed, much of it passes through the nuclear envelope to the cytoplasm, where it is translated into protein. Or so the usual story runs — which is more or less correct as far as it goes. But let’s look at some of what else must go on in order to make the story happen. If you arranged the DNA in a human cell linearly, it would extend for nearly two meters. How do you pack all that DNA into a cell nucleus just five or ten millionths of a meter in diameter? According to the usual comparison, it’s as if you had to pack 24 miles of extremely thin thread into a tennis ball. Moreover, this thread is divided into 46 pieces (individual chromosomes) averaging, in our tennis-ball analogy, over half a mile long. Can it be at all possible not only to pack the chromosomes into the nucleus, but also to keep them from becoming hopelessly entangled? Obviously it must be possible, however difficult to conceive — and in fact an endlessly varied packing and unpacking is going on all the time. The first thing to realize is that chromosomes do not consist of DNA only. Their actual substance, an intricately woven structure of DNA, RNA, and protein, is referred to as “chromatin.” “Histone proteins,” several of which can bind together in the form of an extremely complex “spool,” are the single most prominent constituent of this chromatin. Every cell contains numerous such spools — there are some 30 million in a typical human cell — and the DNA double helix, after wrapping a couple of times around one of them, extends for a very short stretch and then wraps around another one. The spool with its DNA is referred to as a “nucleosome,” and between 75 and 90 percent of our DNA is wrapped up in nucleosomes. But that’s just the first level of packing; it accounts for relatively little of the overall condensation of the chromosomes. If you twist a long, double-stranded rope, you will find the rope beginning to coil upon itself, and if you continue to twist, the coils will coil upon themselves, and so on without particular limit, depending on the fineness and length of the rope. Something like this “supercoiling” happens with the chromosome, mediated in part by the nucleosome spools. As a result, the spools, and the DNA along with them, become tightly packed almost beyond comprehension, in a dense, three-dimensional geometry that researchers have yet to visualize in any detail. This highly condensed state, characterizing great stretches of every chromosome, contrasts with other, relatively uncondensed stretches known as “open chromatin.” At any one time — and with the details depending on the tissue type and stage of the organism’s development, among other things — some parts of every chromosome are heavily condensed while others are open. Every overall configuration represents a unique balance between constrained and liberated expression of our total complement of 25,000

genes. This is because the transcription of genes generally requires an open state; genes in condensed chromatin are largely silenced. The supercoiling has another direct, more localized role in gene expression. Think again of twisting a rope: depending on the direction of your twist, the two strands of the helix will either become more tightly wound around each other or will be loosened and unwound. (This tightening or loosening of the two strands is independent of the overall supercoiling of the rope, which occurs in either case.) And if, taking a double-stranded rope in hand, you insert a pencil between the strands and force it in one direction along the rope, you will find the strands winding ever more tightly ahead of the pencil’s motion and unwinding behind. In a similar way, RNA polymerase, the enzyme that transcribes DNA into RNA, must separate the strands of the double helix as it moves along a gene sequence. This is much easier if the supercoiling of the chromatin has already loosened the strands, and harder if the strands are tightened. In this way, the variations in supercoiling along the length of a chromosome either encourage or discourage the transcription of particular genes. Moreover, by virtue of its own activity in moving along the DNA and separating the two strands, RNA polymerase (like the pencil) tends to unwind the strands in the chromosomal region behind it, rendering that region, too, more susceptible to gene expression. There are proteins that detect such changes in the torsion (a sort of twisting tension) propagating along chromatin, and they read the changes as “suggestions” about helping to activate nearby genes. Picture the situation concretely. Every bodily activity or condition presents its own requirements for gene expression. Whether you are running or sleeping, starving or feasting, getting aroused or calming down, suffering a flesh wound or recovering from pneumonia — in all cases the body and its different cells have specific, almost incomprehensibly complex and changing requirements for differentiated expression of thousands of genes. And one thing necessary for achieving this expression in all its fine detail is the properly choreographed performance of the chromosomes. This performance cannot be captured with an abstract code. Interacting with its surroundings, the chromosome is as much a living actor as any other part of its living environment. Maybe instead of summoning the image of a rope, I should have invoked a snake, coiling, curling, and sliding over a landscape that is itself in continual movement. The Dynamic Space of the Cell Nucleus There are many levels at which we discover significant form and organization in chromatin, which one scientist has dubbed “a plastic polymorphic dynamic elastic resilient flexible nucleoprotein complex.”[2] Each chromosome, for example, is structured by various means and in ever-changing ways into functionally significant chromosome “domains.” We’ve already seen that chromosomes have both condensed and more open regions. The boundaries between these regions are not always well-defined or digitally precise. Simply by residing close to a more compact region, a gene that otherwise would be very actively transcribed might be only intermittently expressed, or even silenced altogether. Chromosome domains are also established by the torsion communicated more or less freely along bounded segments of the chromosome. A region characterized by a particular torsion may attract its own distinctive regulatory proteins. The torsion also tends to correlate with the level of compaction of the chromatin fiber, which in turn correlates with many other aspects of gene regulation. And even on an extremely small scale, the twisting or untwisting of the short stretches of DNA between nucleosomes by various proteins is presumed to help drive the folding or unfolding of the local chromatin. Genes expressed in the same cell type or at the same time, genes sharing common regulatory factors, and genes actively expressed (or mostly inactive) tend to be grouped together. One way such domains could be established is through the binding of the same protein complexes along a region of the chromosome, thereby establishing a common molecular and regulatory environment for the encompassed genes. But such regions are more a matter of fluid tendency than of absolute rule. All this reminds us that gene regulation is defined less by static elements of logic than by the quality and force of various movements and transformations. So far we’ve been looking only at the structure of the chromosome itself. But organization at one level of an organism does not make sense except insofar as it reflects organization at other levels. The structured chromosome can fulfill its tasks only by participating in —

mirroring and being mirrored by — a structured nucleus sharing the same dynamic character. Every chromosome occupies a characteristic region of the nucleus — a “chromosome territory” that varies with the tissue type, the stage of the organism’s development, and the life cycle of the individual cell. Chromosomes or parts of chromosomes near the center of the nucleus are marked by more intense gene expression, while those near the outer periphery tend to be repressed. For local regions of a chromosome, this effect of location can be finely tuned to a degree and in ways that currently baffle all attempts at understanding. Spurred by as yet unknown signals and forces, a particular segment of a chromosome will loop out as an open-chromatin “thread” from its primary territory and come together with other looping segments of the same chromosome. This well-aimed movement brings certain genes and regulatory elements together while keeping others apart, and in this way properly coordinated gene expression is brought about. Sometimes the fraternizing genes are separated on their chromosome by tens of millions of nucleotide bases. Such chromosome movements are now known to bring together genes and regulatory sites on different chromosomes as well (“kissing chromosomes,” as some researchers have called them). This is a considerable feat of precision targeting, considering not only the chromosome-packing problem discussed above, but also the fact that there are billions of nucleotide bases in human chromosomes. Yet such synchronization of position can be decisive for the expression of particular genes. Looking at all the coordinated looping and dynamic reorganization of chromosomes, a Dutch research team concluded: Not only active, but also inactive, genomic regions can transiently interact over large distances with many loci in the nuclear space. The data strongly suggest that each DNA segment has its own preferred set of interactions. This implies that it is impossible to predict the long-range interaction partners of a given DNA locus without knowing the characteristics of its neighboring segments and, by extrapolation, the whole chromosome.[3] So context indeed matters. Moreover, the relevant organization of the cell nucleus involves much more than the chromosomes themselves. There are so-called “transcription factories” within the nucleus where looping chromosome segments, regulatory proteins, transcribing enzymes (RNA polymerases), and other substances gather together, presumably making for highly efficient and coordinated gene expression. Other nuclear functions besides transcription also seem to be localized in this way. But all these specialized locales lack rigid or permanent structure, and are typically marked by rapid turnover of molecules. The lack of well-defined structure in these functional locations contrasts with the cell cytoplasm, which is elaborately subdivided by membranes and populated by numerous organelles. The extraordinary “lightness” and fluidity of the nucleus provide an interesting counterbalance to the relative fixity of the DNA sequence. With so much concerted movement going on — not to mention the coiling and packing and unpacking of chromosomes mentioned earlier — how does the cell keep all those “miles of string in the tennis ball” from getting hopelessly tangled? All we can say currently is that we know some of the players addressing the problem. For example, there are enzymes called “topoisomerases” whose task is to help manage the spatial organization of chromosomes. Demonstrating a spatial insight and dexterity that might amaze those of us who have struggled to sort out tangled masses of thread, these enzymes manage to make just the right local cuts to the strands in order to relieve strain, allow necessary movement of genes or regions of the chromosome, and prevent a hopeless mass of knots. Some topoisomerases cut just one strand of the double helix, allow it to wind or unwind around the other strand, and then reconnect the severed ends. This alters the supercoiling of the DNA. Other topoisomerases cut both strands, pass a loop of the chromosome through the gap thus created, and then seal the gap again. (Imagine trying this with miles of string crammed into a tennis ball!) I don’t think anyone would claim to have the faintest idea how this is actually managed in a meaningful, overall, contextual sense, although great and fruitful efforts are being made to analyze isolated local forces and “mechanisms.” In sum: the chromosome is engaged in a highly effective spatial performance. It is a living, writhing, gesturing expression of its cellular environment, and the significance of

its gesturing goes far beyond the negative requirement that it be condensed and kept free of tangles. If the organism is to survive, chromosome movements must be wellshaped responses to sensitively discerned needs; every gene must be expressed or not according to the needs of the larger context. The chromosome, like everything else in the cell, is itself a manifestation of life, not a logic or mechanism explaining life. Metamorphosis of the Code Not only is DNA “managed” by the spatial dynamism of the nucleus and the complex structural folding and unfolding of the chromatin matrix, but the DNA sequence itself is subject to continual transformation. It happens, for example, that certain nucleotide bases are subject to “DNA methylation” — the attachment of methyl groups. These small chemical entities are said to “tag” or “mark” the affected bases, a highly significant process that occurs selectively and dynamically throughout the entire genome. Words such as “attach,” “tag,” and “mark,” however, are grossly inadequate, suggesting as they do little more than a kind of binary coding function whereby we can classify every nucleotide base simply according to the presence or absence of a methyl group. What this leaves out is the actual qualitative change resulting from the chemical transaction. Part of the problem lies in the mechanistic mindset that looks for the mere aggregation of parts, as if the methyl group and nucleotide base were discrete Lego blocks added together. But wherever chemical bonds are formed or broken, there is a transformation of matter. The result is not just an aggregation or mixture of the substances that came together, but something new, with different qualities and a different constellation of forces. To think of a methylated cytosine (the nucleotide base most commonly affected) as still the same letter “C” that it was before its methylation, but merely tagged with a methyl group, is to miss the full reality of the situation. What we are really looking at is a metamorphosis of millions of letters of the genetic code under the influence of pervasive and poorly understood cellular processes. And the altered balance of forces represented by all those transformed letters plays with countless possible nuances into the surrounding chromatin, reshaping its sculptural qualities and therefore its expressive potentials. We are now learning about the consequences of these metamorphoses. In the first place, the transformations of structure brought about by methylation can render DNA locations no longer accessible to the protein transcription factors that would otherwise bind to them and activate the associated genes. Secondly, and perhaps more fundamentally, there are many proteins that do recognize methylated sites and bind specifically to them, recruiting in turn other proteins that restructure the chromatin — typically condensing it and resulting in gene repression. It would be difficult to overstate the profound role of DNA methylation in the organism. In humans, distinctive patterns of DNA methylation are associated with Rett syndrome (a form of autism) and various kinds of mental retardation. Stephen Baylin, a geneticist at Johns Hopkins School of Medicine, says that the silencing, via DNA methylation, of tumor suppressor genes is “probably playing a fundamental role in the onset and progression of cancer. Every cancer that’s been examined so far, that I’m aware of, has this (pattern of) methylation.”[4] In an altogether different vein, researchers have reported that “DNA methylation is dynamically regulated in the adult nervous system” and is a “crucial step” in memory formation.[5] It also seems to play a key role in tissue differentiation. Some patterns of DNA methylation are heritable, leading (against all conventional expectation) to a kind of Lamarckian transmission of acquired characteristics. According to geneticist Joseph Nadeau at the Case Western Reserve University School of Medicine, “a remarkable variety of factors including environmental agents, parental behaviors, maternal physiology, xenobiotics, nutritional supplements and others lead to epigenetic changes that can be transmitted to subsequent generations without continued exposure.”[6] But by no means are all methylation patterns inherited. For the most part they are not, and for good reason. It would hardly do if tissue-specific patterns of methylation — for example, those in the heart, kidney, or brain — were passed along to the zygote, whose undifferentiated condition is so crucial to its future development. In general, the slate upon which the developmental processes of the adult have been written needs to be wiped clean in order to clear a space for the independent life of the next generation. As part of this slate-cleaning, a restructuring wave of demethylation passes along each chromosome shortly after fertilization of an egg, and is completed by the time of

embryonic implantation in the uterus. Immediately following this, a new methylation occurs, shaped by the embryo itself and giving it a fresh epigenetic start. When, in mammals, the stage of embryonic methylation is blocked artificially, the organism quickly dies. This structuring and restructuring of DNA by the surrounding life processes is fully as central to a developing organism as the code-conforming DNA sequence. DNA’s Many Languages We have seen that chromosomes are more than the coded sequence of their DNA. But even when we restrict our gaze to the DNA sequence itself, what we find is much more than a presumed logic — much more than a one-dimensional array of codons that map to the amino acids of protein. As one group of researchers summarize the matter: There is a “growing body of evidence that the topology and the physical features of the DNA itself is an important factor in the regulation of transcription.” [7] I will try to illustrate this briefly. Each nucleosome spool is enwrapped by a couple of turns of the DNA double helix. This takes some doing, since the double helix has a certain “stiffness,” or resistance to bending. Some combinations of nucleotide bases lend themselves more easily to bending than others. These combinations influence where nucleosomes will be positioned along the double-stranded DNA. And the positioning of nucleosomes matters at a highly refined level: a shift in position of as little as two or three base pairs can make the difference between an expressed or a silenced gene. Further, not only the exact position of a nucleosome on the double helix but also the precise rotation of the helix on the nucleosome is important. “Rotation” refers to which part of the DNA faces toward the surface of the spool and which part faces outward. Depending on this orientation, the nucleotide bases will be more or less accessible to the various activating and repressing factors that recognize and bind to specific sequences. The orientation in turn depends considerably on the configuration of the local sequence of bases. All of which is to say that among the important meanings of the language spoken by the genetic sequence are those relating to the distribution of forces in the double helix, which must appropriately complement the forces in nucleosome spools (which latter, as we will see below, can also express themselves with endless variation). The shape of a stretch of DNA matters in a different way as well. There are two grooves (the major and minor grooves) running the length of a DNA strand, and proteins that recognize an exact sequence of nucleotide bases typically do so in the major groove. However, many proteins bind to DNA in highly selective ways that are not determined by an exact sequence. Recent work has shown that the minor groove may be compressed so as to enhance the local negative electrostatic potential. Regulatory proteins “read” the compression and the electrostatic potential as cues for binding to the DNA. The “complex minor-groove landscape,” as one research team explained in Nature,[8] is indeed affected by the DNA sequence, as well as by associated proteins; however, regulatory factors “reading” the landscape can hardly do so according to a strict digital code. By musical analogy: it’s less a matter of identifying a precise series of notes than of recognizing a melodic motif. This discovery of the role of the minor groove also helps to solve a puzzle. “The ability to sense the variation in electrostatic potential in DNA,” according to bioinformatics researcher Tom Tullius, “may reveal how a protein could home in on its binding site in the genome without touching every nucleotide” — of which there are billions in every set of human chromosomes. The lesson in all this, Tullius suggests, has to do with what we lose when we simplify DNA to “a one-dimensional string of letters.” After all, “DNA is a molecule with a three-dimensional shape that is not perfectly uniform.” [9] It is remarkable how readily the historical shift from direct observation of organisms to instrumental readouts of molecular-level processes encouraged a forgetfulness of material form and substance in favor of abstract codes fit for computers. Meaningful Form Distinct combinations of nucleotide bases not only assume different conformations themselves; by virtue of their structure, or pattern of forces, they can also impart different conformations to the proteins that bind to them — and these differences can matter a great deal. A group of California molecular biologists recently investigated the glucocorticoid receptor, one of many transcription factors that respond to hormones. Noting the general fact that “genes are not simply turned on or off, but instead their expression is fine-tuned to meet the needs of a cell,” the researchers went on to report that the various DNA binding sequences for the glucocorticoid receptor may differ by as

little as a single base pair. The receptor alters its conformation in response to such differences, and in this way its regulatory activity is modulated. [10] Meanwhile, a Berlin research team looked at several different hormone-responding transcription factors. They concluded that not only did the DNA sequences to which these proteins were bound impart conformational changes to the proteins, but also that these changes led to selective recruitment of different co-regulators and perhaps even to distinct restructurings of the local chromatin architecture. The researchers refer to the “subtle information” conveyed by “unique differences” in the DNA sequence, and the consequent “fine-tuning” of the interplay among regulatory factors. “Small variations in DNA sites,” they write, “can thereby provide for high regulatory diversity, thus adding another level of complexity to gene-specific control.” [11] The influence of form works in the other direction as well: the bound protein can transform the shape of DNA in a decisive way, making it easier for a second protein to bind nearby, even without any direct protein-protein interactions. In the case of one gene relating to the production of interferon (an important constituent of the immune system), “eight proteins modulate [DNA] binding site conformation and thereby stabilize cooperative assembly without significant contribution from interprotein interactions.” [12] As a result of this intricate cooperation of proteins and DNA, mediated by the shifting structure of the double helix, the cell achieves proper expression of the interferon gene according to its needs. On yet another front: the genetic code consists of sixty-four distinct codons, representing all the unique ways four different letters can be arranged in three-letter sequences. Because there are only twenty amino acid constituents of human protein, the code is redundant: several different codons can signify the same amino acid. Such codons have been considered “synonymous,” since the meaning of the code was thought to be exhausted in the specification of amino acids. However, biologists are now in the process of discovering how non-equivalent these synonymous codons really are. “Synonymous mutations [that is, changes of codons into different, yet synonymous, forms] do not alter the encoded protein, but they can influence gene expression,” Joshua Plotkin and his colleagues write in Science magazine. To demonstrate the situation, these scientists engineered 154 versions of a gene — versions that differed randomly from each other, but only in synonymous ways, so that all 154 genes still coded for the same protein. They found that, in the bacterium Escherichia coli, these genes differed in the extent of their expression, with the highest-expressing form producing 250 times as much protein as the lowest-expressing form. Bacterial growth rates also varied. The researchers determined that the choice of synonymous codons affected the folding structure of the resulting RNA transcripts, and this structure then affected the rate of RNA translation into protein.[13] In short, “synonymous” in the narrow terms of code does not mean “synonymous” as far as the molecular sinews of life are concerned. Finally and most generally: scientists using computers to scan the several billion nucleotide bases of the human genome in the search for significant features have more and more been using sequence variations as indicators of sculptural and dynamic form at different scales — scales ranging from a few to millions of base pairs. Scans focusing on the DNA sequence alone, abstracted from physical form, have failed to find many of the regulatory elements that now appear so crucial to our understanding of genomic functioning. This search is leading to rapid discovery of new functional aspects of the formerly one-dimensional genome. The search is also producing a growing awareness that what we inherit (and what makes a difference in evolutionary terms) is as much a matter of three-dimensional structure as it is of nucleotide sequence. Researchers have wondered why the sequences of many functional elements in DNA are not kept more or less constant by natural selection. The standard doctrine has it that functionally important sequences, precisely because they are important to the organism, will generally be conserved across considerable evolutionary distances. But the emerging point of view holds that architecture can matter as much as sequence. As bioinformatics researcher Elliott Margulies and his team at the National Human Genome Research Institute put it, “the molecular shape of DNA is under selection” — a shape that can be maintained in its decisive aspects despite changes in the underlying sequence. It’s not enough, they write, to analyze “the order of A’s, C’s, G’s, and T’s,”

because “DNA is a molecule with a three-dimensional structure.” [14] Elementary as the point may seem, it’s leading to a considerable reallocation of investigative resources. Of course, researchers knew all along that DNA and chromatin were spatial structures. But that didn’t prevent them from ignoring that fact as far as possible. Opportunities to pursue the abstract and determinate lawfulness of a code or mathematical rule have always shown great potential for derailing the scientist’s attention from the world’s fullbodied presentation of itself. Achieving logical and mathematical certainty within a limited sphere can seem more rigorously scientific than giving attention to the metamorphoses of form and rhythms of movement so intimately associated with life. These latter require a more aesthetically informed approach, and they put us at greater risk of having to acknowledge the evident expressive and highly concerted organization of living processes. When you encounter the meaningful, directed, and well-shaped movements of a dance, it’s hard to ignore the active principle — some would say the agency or being — coordinating the movements. And nowhere do we find the dance more evident than in the focal performance of the nucleosome. The Sensitive Nucleosome We have spoken of nucleosomes as spools around which DNA is wrapped, but they are not at all like the smooth cylinders that sewing thread is wound on; the image of an irregularly shaped pine cone might be more appropriate (see illustration). Hundreds of distinct points of contact, with countless possible variations, define the relationship

between the A nucleosome spool with DNA wrapped around it. [Karolin Luger, Colorado State University]histone proteins of the spool and the approximately two turns of DNA wrapped around them. As previously noted, this relationship affects access to the enwrapped DNA by the transcription factors that bind to it and promote or repress gene expression. One aspect of the dynamic has to do with the electrical forces that come into play between the (for the most part) positively charged histone surfaces and the negatively charged outer regions of the double helix. Here it is well to remember one of the primary lessons of twentieth-century physics: we are led disastrously astray when we try to imagine atomic- and molecular-level entities as if they were tiny bits of the stuff of our common experience. The histone spool of nucleosomes, for example, is not some rigid thing. It would be far better to think of its “substance,” “surface,” “contact points,” and “physical interactions” as forms assumed by mutually interpenetrating forces in intricate and varied play. In any case, the impressive enactments of form and force about the nucleosome are surely central to any understanding of genes. The nucleosome is rather like a maestro directing the genetic orchestra, except that the direction is itself orchestrated by the surrounding cellular audience in conversation with the instrumentalists. The canonical nucleosome spool is a complex of histone proteins, each of which has a flexible, filamentary “tail” (not shown in the illustration). This tail can be modified through the addition of several different chemical groups — acetyl, methyl, phosphate, ubiquitin, and so on — at any of many different locations along its length. A great variety of enzymes can apply and remove these chemical groups, and the groups themselves play a role in attracting a stunning array of gene regulatory proteins that restructure chromatin or otherwise help choreograph gene expression.

After a few histone tail modifications were found to be rather distinctly associated with active or repressed genes, the forlorn hope arose that we would discover a precise, combinatorial “histone code.” It would provide a kind of fixed, digital key enabling us to predict the consequences of any arrangement of modifications. But this was to ignore the nearly infinite variety of all those other factors that blend their voices in concert with the histone modifications. In the plastic organism, what goes on at the local level is shaped and guided by a larger, coherent context. As Shelley Berger of Philadelphia’s Wistar Institute observes: Although [histone] modifications were initially thought to be a simple code, a more likely model is of a sophisticated, nuanced chromatin “language” in which different combinations of basic building blocks yield dynamic functional outcomes. [15] And (leaving aside the jarring reference to building blocks) how could it be otherwise? Each histone tail modification reshapes the physical and electrical structure of the local chromatin, shifting the pattern of interactions among nucleosome, DNA, and associated protein factors. To picture this situation concretely is immediately to realize that it cannot be captured in purely digital terms. A sculptor does not try to assess the results of a stroke of the hammer as a choice among the possibilities of a digital logic. Berger envisions histone modifications as participating in “an intricate ‘dance’ of associations.” There is much more. The histones making up a nucleosome spool can themselves be exchanged for noncanonical, or variant, histones, which also have recognizable — but not strictly encoded — effects upon the expression of genes. Histones can even be removed from a spool altogether, leaving it “incomplete.” And certain proteins can slide spools along the DNA, changing their position. As we have seen already, a shift of position by as little as two or three base pairs can make the difference between gene activation or repression, as can changes in the rotational orientation of the DNA on the face of the histone spool. And the tails — no doubt depending at least in part on the various modifications and protein associations mentioned earlier — can thread themselves through the encircling double helix, perhaps either loosening it from the spool or holding it more firmly in place. But those same tails are also thought to establish nucleosome-tonucleosome contacts, helping to compact a stretch of chromatin and repress gene expression. Everything depends on contextual configurations that we can reasonably assume are as nuanced and expressively manifold as the gestural configurations available to a stage actor. Further, the nucleosome positioning pattern and other dynamics vary throughout a genome depending on tissue type, stage of the cell life cycle, and the wider physiological environment. They vary between genes that are more or less continuously expressed and those whose expression level changes with environmental conditions. They vary between open chromatin and gene-repressive condensed chromatin. And they vary for any one gene as the actual process of transcription takes place — this because appropriate DNA regulatory sequences must become nucleosome-free before transcription can start, and also because DNA in the body of the gene must be disengaged from nucleosome spools as the transcribing enzyme passes along, only to be (often) re-engaged behind the enzyme. The Nucleosome as Mediator Seemingly in the grip of the encircling DNA with its relatively fixed and stable structure, yet responsive to the varying flow of life around it, the nucleosome holds the balance between gene and context — a task requiring flexibility, a “sense” of appropriate rhythm, and perhaps we could even say “grace.” Nucleosomes will sometimes move — or be moved (the distinction between actor and acted upon is obscured in the living cell) — rhythmically back and forth between alternative positions in order to enable multiple transcription passes over a gene. In stem cells, a process some have called “histone modification pulsing” results in the continual application and removal of both gene-repressive and gene-activating modifications of nucleosomes. In this way, a delicate balance is maintained around genes involved in development and cell differentiation. The genes are kept, so to speak, in a finely calculated state of “suspended readiness,” so that when the decision to specialize is finally taken, the repressive modifications can be quickly lifted, leading to rapid gene expression. But quite apart from their role in stem cells, it is increasingly appreciated that nucleosomes play a key role in holding a balance between the active and repressed states of many genes. As the focus of a highly dynamic conversation involving histone

variants, histone tail modifications, and innumerable chromatin-associating proteins, decisively placed nucleosomes can (as biologist Bradley Cairns writes) maintain genes “poised in the repressed state,” and “it is the precise nature of the poised state that sets the requirements for the transition to the active state.” Among other aspects of the dynamism, there is continual turnover of the nucleosomes themselves — a turnover that allows transcription factors to gain access to DNA sequences “at a tuned rate.” [16] With another sort of rhythm the DNA around a nucleosome spool “breathes,” alternately pulling away from the spool and then reuniting with it, especially near the points of entry and exit. This provides what are presumably well-gauged, fractional-second opportunities for gene-regulating proteins to bind to their target DNA sequences during the periods of relaxation. During the actual process of transcription, RNA polymerase appears to take advantage of this “breathing” in order to move, step by step and with significant pauses, along the gene it is transcribing. The characteristics of nucleosomes — whether firmly anchored to the DNA or easily dislodged — affect the timing and frequency of these pauses. And the rhythm of pauses and movements in turn affects the folding of the RNA being synthesized: a proper music is required for correct folding, which finally in its turn affects the structure and function of the protein produced from the RNA molecule. Such, then, is the sort of intimate, intricate, well-timed choreography through which our genes come to their proper expression. And the plastic, shape-shifting nucleosome in the middle of it all — with its exquisite sensitivity to the DNA sequence on the one hand, and, on the other hand, its mobile tails responding fluidly to the ever-varying signals coming from the surrounding life context — provides an excellent vantage point from which to view the overall drama of form and movement. Facing Up to Life The topics covered in this essay represent just a small sample of the findings of genetic and epigenetic research, and we can be sure that, as the field develops, more discoveries will be made that will continue to undermine the doctrine that a genetic code defines the “program of life.” But this is enough, I hope, to suggest why researchers are so energized and excited today. A sense of profound change seems to be widespread. Meanwhile, the epigenetic revolution is slowly but surely making its way into the popular media — witness the recent Time magazine cover story, “Why DNA Isn’t Your Destiny.” The shame of it is that most of the significance of the current research is still being missed. Judging from much that is being written, one might think the main thing is simply that we’re gaining new, more complex insights into how to treat the living organism as a manipulable machine. The one decisive lesson I think we can draw from the work in molecular genetics over the past couple of decades is that life does not progressively contract into a code or any kind of reduced “building block” as we probe its more minute dimensions. Trying to define the chromatin complex, according to geneticists Shiv Grewal and Sarah Elgin, “is like trying to define life itself.” Having plunged headlong toward the micro and molecular in their drive to reduce the living to the inanimate, biologists now find unapologetic life staring back at them from every chromatogram, every electron micrograph, every gene expression profile. Things do not become simpler, less organic, less animate. The explanatory task at the bottom is essentially the same as the one higher up. It’s rather our understanding that all too easily becomes constricted as we move downward, because the contextual scope and qualitative richness of our survey is so extremely narrowed. The search for precise explanatory mechanisms and codes leads us along a path of least resistance toward the reduction of understanding. A capacity for imagination (not something many scientists are trained for today) is always required for grasping a context in meaningful terms, because at the contextual level the basic data are not things, but rather relations, movement, and transformation. To see the context is to see a dance, not merely the bodies of the individual dancers. The hopeful thing is that molecular biologists today — slowly but surely, and perhaps despite themselves — are increasingly being driven to enlarge their understanding through a reckoning with genetic contexts. As a result, they are writing “finis” to the misbegotten hope for a non-lifelike foundation of life, even if the fact hasn’t yet been widely announced. It is, I think, time for the announcement.

There is a frequently retold story about a little old lady who claims, after hearing a scientific lecture, that the world is a flat plate resting on the back of a giant tortoise. When asked what the turtle is standing on, she invokes a second turtle. And when the inevitable follow-up question comes, she replies, “You’re very clever, young man, but you can’t fool me. It’s turtles all the way down.” As a metaphor for the scientific understanding of biology, the story is marvelously truthful. In the study of organisms, “It’s life all the way down.” Notes [1]  Jacques E. Dumont, Fréderic Pécasse, and Carine Maenhaut, “Crosstalk and Specificity in Signalling: Are We Crosstalking Ourselves into General Confusion?,” Cellular Signalling 13 (2001): 457-63. [2]Christophe Lavelle, “Forces and Torques in the Nucleus: Chromatin under Mechanical Constraints,”  Biochemistry and Cell Biology 87 (2009): 307-22. [3]Marieke Simonis, Petra Klous, Erik Splinter,  et al., “Nuclear Organization of Active and Inactive Chromatin Domains Uncovered by Chromosome Conformation Capture-on-chip (4C),” Nature Genetics 38, no. 11 (Nov. 2006): 1348-54. [4]Valerie Brown, “Environment Becomes Heredity,”  Miller-McCune, July 14, 2008, 50-9. [5]Courtney A. Miller and J. David Sweatt, “Covalent Modification of DNA Regulates Memory Formation,”  Neuron 53, no. 6 (March 15, 2007): 857-69. [6]Joseph H. Nadeau, “Transgenerational Genetic Effects on Phenotypic Variation and Disease Risk,”  Human Molecular Genetics 18, no. 2 (2009): R202-10. [7]  David G. Dineen, Andreas Wilm, Pádraig Cunningham, and Desmond G. Higgins, “High DNA Melting Temperature Predicts Transcription Start Site Location in Human and Mouse,” Nucleic Acids Research 37, no. 22 (2009): 7360-7. [8]Remo Rohs, Sean M. West, Alona Sosinsky,  et al., “The Role of DNA Shape in ProteinDNA Recognition,” Nature 461 (Oct. 29, 2009): 1248-53. [9]Tom Tullius, “DNA Binding Shapes Up,”  Nature 461 (Oct. 29, 2009): 1225-6. [10]Sebastiaan H. Meijsing, Miles A. Pufall, Alex Y. So,  et al., “DNA Binding Site Sequence Directs Glucocorticoid Receptor Structure and Activity,” Science 324 (April 17, 2009): 407-10. [11]  Christoph Geserick, Hellmuth-Alexander Meyer, and Bernard Haendler, “The Role of DNA Response Elements as Allosteric Modulators of Steroid Receptor Function,” Molecular and Cellular Endocrinology 236, no. 1-2 (May 31, 2005): 1-7. [12]Rocco Moretti, Leslie J. Donato, Mary L. Brezinski,  et al., “Targeted Chemical Wedges Reveal the Role of Allosteric DNA Modulation in Protein-DNA Assembly,” ACS Chemical Biology 3, no. 4 (2008): 220-9. [13]Grzegorz Kudla, Andrew W. Murray, David Tollervey, and Joshua B. Plotkin, “Codingsequence Determinants of Gene Expression in  Escherichia coli,” Science 324 (April 10, 2009): 255-8. [14]Stephen C. J. Parker, Loren Hansen, Hatice Ozel Abaan  et al., “Local DNA Topography Correlates with Functional Noncoding Regions of the Human Genome,” Science 324 (April 17, 2009): 389-92. [15]Shelley L. Berger, “The Complex Language of Chromatin Regulation During Transcription,”  Nature 447 (May 24, 2007): 407-12. [16]Bradley R. Cairns, “The Logic of Chromatin Architecture and Remodelling at Promoters,”  Nature 461 (Sep. 10, 2009): 193-8. Glossary amino acid. Amino acids are, among other things, constituent elements of protein. There are twenty different amino acids in protein, and any number of amino acid molecules — up to many thousands — are arranged in sequence to form the main body of a particular protein. base pairs. See “nucleotide base,” below. bind. To attach chemically; form a chemical bond with. The term binding site refers to the particular sequence of nucleotide bases on a DNA or RNA molecule that a protein or RNA molecule can “target” and attach to. In the case of RNA, its affinity for another RNA or DNA is a matter of sequence (base pair) complementarity. But in the case of a protein, its affinity for a binding site is given by its own molecular folded shape, distribution of electrical charges, and perhaps other characteristics.

chromatin. The complex of DNA, proteins, and RNA that constitutes chromosomes. The histones that form nucleosome “spools” are the most abundant proteins in chromatin, but many other proteins also play a role. The chromatin is highly dynamic in form and structure. codon. The “words” of the genetic code consisting of three successive nucleotide bases, or “letters.” DNA. Deoxyribonucleic acid, a molecule that figures centrally in inheritance. Constituting part of the material of chromosomes, it is commonly double-stranded in the famous double helix form. Connecting the two strands are base pairs consisting of nucleotide bases. DNA methylation. The attachment of a methyl chemical group to particular nucleotide bases (usually cytosine) of the DNA molecule. Methylation plays a major role in gene regulation; it tends to repress gene expression. epigenetics. Literally, that which is “added to” genetics. The term is most commonly taken to refer to heritable changes in gene expression that do not result from changes in actual gene sequences. (“Heritable” here can refer not only to inheritance between parents and offspring, but also between parent and daughter cells in a single organism.) The changes result from the way the larger cellular context interacts with the genes. gene expression. A gene is generally said to have been “expressed” when it results in a protein or RNA. The term gene regulation refers to the cell’s overall management of gene expression — activating genes, silencing them, and so on. genome. All the DNA in an organism or cell, especially with reference to the total sequence of bases or “letters” of the genetic code. histone. A family of simple proteins, abundant in the cell nucleus and constituting a substantial part of the chromatin. A group of histones makes up the “spool” of a nucleosome, each with a thin, filamentary histone tail extending out. nucleosome. The “spool,” made up of histones, around which DNA is commonly wrapped about two turns. (The length of DNA wrapped around a “standard” nucleosome is commonly given as 147 base pairs. But many variations upon this standard length are currently being investigated.) There are millions of nucleosomes in the human genome; they are a focus of many different aspects of gene regulation. nucleotide base. Chemical groups that are constituents of DNA and RNA. The four main bases in DNA are adenine, guanine, cytosine, and thymine (A, G, C, and T, respectively — the “letters” of the genetic code). In RNA, uracil (U) stands in the place of thymine. These bases combine in restricted ways to form complementary base pairs, a fact that is central to DNA replication and gene expression. protein. Also known as polypeptides, proteins are folded chains of amino acids. They play myriad structural, regulatory, and enzymatic roles in every cell. RNA. Ribonucleic acid, like DNA, contains a series of nucleotide bases (the “letters” of the genetic code). Although RNA was classically thought of as existing in three primary forms (mRNA, rRNA, and tRNA), more recently, a great variety of RNA types have been discovered. They play a major role in many epigenetic processes. RNA polymerase. The enzyme (protein) that transcribes DNA into RNA; see “transcription” below. transcription. The process by which an RNA polymerase (in cooperation with many other cellular elements) uses a DNA gene template to form an RNA molecule. The gene is said to have been “transcribed,” and the RNA is a “transcript.” Transcription factors are proteins that play a part in gene expression, activating it or repressing it, by binding directly to DNA. The Unbearable Wholeness of Beings If you try to describe the living processes of the cell in a rather more living language than is typically found in the literature of molecular biology — if you resort to a language reflecting the artfulness and grace, the well-coordinated rhythms, and the striking choreography of phenomena such as gene expression, signaling cascades, and mitotic cell division — you will almost certainly hear mutterings about your flirtation with “spooky, mysterious, nonphysical forces.” You can expect to hear yourself labeled a “mystic” or — there is hardly any viler epithet within biology today — a “vitalist.” This charge reflects a certain longstanding sensitivity among biologists — one that deserves to be taken seriously. It was recently given very thoughtful and respectful

expression by a first-rank molecular biologist in response to a draft book chapter I had sent him. After describing my views as “very interesting, provocative, and necessary,” and before offering his support for much of what I had to say, he voiced this concern: “You very explicitly dispense with vitalism. Nevertheless, your piece is permeated by an atmosphere that says ‘There is something special about living things.’” So I believe there is. Animals and plants are a long way from rocks and clouds, and also from automobiles and computers. The need to point this out today is one of the startling aspects of the current scientific landscape. It is true that the concept of “vitalism” has been problematic in the history of biology, but no less so than “mechanism.” The two problems are in fact devilishly intertwined. We will never get straight about vitalism if we do not also get straight about mechanism. And until we sort through the associated confusions, we have little hope of meaningful conversation about many of the perplexities vexing biologists today. We will see, however, that the shoe is really on the other foot: it is the conventional literature of biology — and above all the literature of molecular biology — that is steeped in a kind of mysticism now blocking progress. What is required is a much greater rigor in the use of scientific terminology. And let me add that, in the interest of such rigor, I will avoid as far as possible the use of devil-terms such as “vitalism” and “reductionism” — words that philosophers of biology today generally reject as too ideologically burdened to be of much use. Better to say what one means directly than to lob undiscriminating verbal explosives onto the field of conversation. Here, then, is my question: Are you and I machines? Are we analyzable without remainder into a collection of mechanisms whose operation can be fully explained by the causal operation of physical and chemical laws, starting from the parts and proceeding to the whole? It might seem so, judging from the insistent testimony of those whose work is to understand life. There is little doubt about the biologist’s declared obsession with mechanisms of every sort — “genetic mechanisms,” “epigenetic mechanisms,” “regulatory mechanisms,” “signaling mechanisms,” “oncogenic mechanisms,” “immune mechanisms,” “circadian clock mechanisms,” “DNA repair mechanisms,” “RNA splicing mechanisms,” and even “molecular mechanisms of plasticity.” The single phrase “genetic mechanism” now yields over 25,000 hits in Google Scholar and the count seems to be rising by hundreds per month. But no cellular entity or process is exempt; everything has been or will be baptized a “mechanism.” In an informal analysis of technical papers I’ve collected, I found an average of 7.5 uses of mechanism per article, with the number in a single article varying from 1 to 32. This is not even counting cognate forms such as mechanistic and machine. The odd thing is that I have yet to find a single technical paper in molecular biology whose author thought it necessary to define mechanism or any of the related terms. If the meaning is supposed to be obvious, then presumably we should read the words in a straightforward and concrete way — as indeed seems to be required in the case of molecular machines, which unashamedly projects the human machine shop onto the molecular level. Other usages, however — such as causal mechanism and mechanistic explanation — evidently convey little more than an idea of physical lawfulness or causation, as when one research team refers to “mechanistic insights into maintenance of cell phenotype through successive cell divisions.” [1] Whatever the implicit definitions may turn out to be, it is plain that the intertwined notions of mechanism and physical law intimately coinhabit the minds of biologists today and are held to be keys for understanding organisms. But here is the greater curiosity: the same biologists describe the organism in an utterly different manner — so different and yet so seemingly inescapable as to demand, from any thoughtful researcher, some sort of reconciliation with the mechanistic picture. The first thing we will note about this alternative view is its dependence upon a language reaching far beyond that of physics and chemistry. What Changes at Death? Anyone whose pet dog has died knows the difference between a living animal and a dead one. Biologists surely know this, too, although (strangely enough!) the difference between life and death does not often figure explicitly in the technical literature presuming to characterize living creatures. You might even think there is something slightly embarrassing about the subject. But, looked at in the right way, the biological literature

nevertheless tells us what the biologist knows about the matter. And it is a great deal, even if he would prefer not to acknowledge it. Think first of a living dog, then of a decomposing corpse. At the moment of death, all the living processes normally studied by the biologist rapidly disintegrate. The corpse remains subject to the same laws of physics and chemistry as the live dog, but now, with the cessation of life, we see those laws strictly in their own terms, without anything the life scientist is distinctively concerned about. The dramatic change in his descriptive language as he moves between the living and the dead tells us just about everything we need to know. No biologist who had been speaking of the behavior of the living dog will now speak in the same way of the corpse’s “behavior.” Nor will he refer to certain physical changes in the corpse as reflexes, just as he will never mention the corpse’s responses to stimuli, or the functions of its organs, or the processes of development being undergone by the decomposing tissues. Virtually the same collection of molecules exists in the canine cells during the moments immediately before and after death. But after the fateful transition no one will any longer think of genes as being regulated, nor will anyone refer to normal or proper chromosome functioning. No molecules will be said to guide other molecules to specific targets, and no molecules will be carrying signals, which is just as well because there will be no structures recognizing signals. Code, information, and communication, in their biological sense, will have disappeared from the scientist’s vocabulary. The corpse will not produce errors in chromosome replication or in any other processes, and neither will it attempt error correction or the repair of damaged parts. More generally, the ideas of injury and healing will be absent. Molecules will not recruit other molecules in order to achieve particular tasks. No structures will inherit features from parent structures in the way that daughter cells inherit traits or tendencies from their parents, and no one will cite the plasticity or context-dependence of the corpse’s adaptation to its environment. It is a worthwhile exercise: try to think in all these ways about the corpse. You will immediately come up against your experience of the distinction between the dog and its remains, between a strictly physical process and a living performance. Nor need you be ashamed of your experience; the most disciplined biologist, whatever his theoretical inclinations, is leaning very much on the same meanings and distinctions you apprehend. Words such as those cited above, after all, are woven into the decisive explanatory matrix of virtually every contemporary paper in molecular biology — but not in papers dealing with the physical sciences. Sometimes, in fact, the biologist’s language may reach beyond your own intuitions, as when two researchers say that we might gain “insights into the ‘thought’ processes of a cell” (emphases added here and in the following). The same two researchers describe signaling networks as the “perceptual components of a cell,” responsible for “observing current conditions and making decisions about the appropriate use of resources — ultimately by regulating cellular behavior.”[2] Another excellent case in point is the geneticist Barbara McClintock’s 1983 Nobel Prize address, in which she surmised that “some sensing mechanism must be present ... to alert the cell to imminent danger.” In the future we should try to “determine the extent of knowledge the cell has of itself and how it utilizes this knowledge in a ‘thoughtful’ manner when challenged.”[3] But even without references to thought and perception, biologists cannot open their mouths without employing a language of recognition and response, of intention and directed activity, of meaningful information and timely communication, of aberrant actions and corrective reactions, of healthy development leading to self-realization or ill health leading to death. Yes, all this language sits side by side with the familiar appeals to causal mechanisms. But does it sit comfortably? We must explore the use of this special language of life — this decidedly non-corpselike language — much further before we can answer that question. Some Views of the Living Organism On its face, the language noted above — recognize, respond, function, adapt, regulate, and so on — suggests that something is going on over and above a physically lawful performance. In employing the conventional terminology, we describe a kind of directed choreography — a performance whose nature and intent is sufficiently clear for us to judge when errors occur or injury supervenes. (Rocks and clouds do not commit errors or suffer injury.) This implies that we are comfortable making qualitative and aesthetic

judgments about health, and can distinguish between coherent and errant meaning in the various informative exchanges continually taking place throughout cell and organism. We speak, in other words, as though the performer (whatever subject we intend for verbs such as “regulate” and “adapt”) were a real entity or being, capable of signaling or otherwise communicating its own needs and designs, able to make sense of the signals coming from its environment, and, through it all, striving to maintain its own distinct, healthy identity. But it’s not just isolated words and phrases that point to the organism as something more than a collection of physically lawful mechanisms. The larger narratives to which these words lend their meanings are narratives of life, not of carcasses — and much less (as we will see) of machines. Is there any subdiscipline of biology today where research has been reducing cellular processes to a more clearly defined set of causal mechanisms instead of rendering them more ambiguous, more intentional, more plastic and context-dependent, and less mechanical? We saw in the previous essay in this series that the chromosome, far from being a kind of fixed, crystalline structure, “is a plastic polymorphic dynamic elastic resilient flexible nucleoprotein complex,”[4] and its living expression is fully as central to its meaning as the “coded” genetic sequence. But the chromosome is only one element of the cell. Here are a few of the countless other developing stories in molecular biology that speak of organic activity fully as dramatic as the dance of chromosomes. Signaling Pathways. Signaling pathways are vital means of communication within and between cells. Such pathways are coherent sequences of molecular interactions by which an initial encounter — say, the binding of a hormone to a cell membrane receptor — leads to a more or less defined result, or group of results, “downstream.” One result, for example, might be the activation of a set of genes.

Graph courtesy of Jacques E. Dumont. From “Crosstalk and Specificity in Signalling,” Cellular Signalling 13 (2001): 458. [Click to enlarge.]In the conventional machine model of the organism, signaling pathways were straightforward, with a clear-cut input at the start of the pathway leading to an equally clear-cut output at the end. Not so today, as a team of molecular biologists at the Free University of Brussels found out when they looked at how these pathways interact or “crosstalk” with each other. Tabulating the cross-signalings between just four such pathways yielded what they called a “horror graph” (right), and quickly it began to look as though “everything does everything to everything.” [5] Alternatively, as another research group has put it, we see a “collaborative” process that can be “pictured as a table around which decision-makers debate a question and respond collectively to information put to them.”[6] Even considering a single membrane receptor bound by a hormonal or other signal, you can find yourself looking, conservatively, at some two billion possible states, depending on how that receptor is modified by its interactions with other molecules. There is no simple binary rule distinguishing activated from deactivated receptors, as once was believed. In reality, as a team from the University of Connecticut Health Center recently explained in the Journal of Biology, “the activated receptor looks less like a machine and more like a ... probability cloud of an almost infinite number of possible states, each of which may differ in its biological activity.” [7]

Our problem lies in adequately imagining the reality. When a single protein can combine with several hundred different modifier molecules, leading to practically infinite combinatorial possibilities, and when that protein itself is an infinitesimal point in the vast heaving and churning molecular sea of continual exchange that is the cell, and when the cell is one instance of maybe 100 trillion cells of hundreds of different types in the human body, from muscle to bone, from liver to brain, from blood to retina — well, it’s understandable that many researchers prefer not to stare too long at the larger picture. Nevertheless, we should keep in mind that the collaborative process mentioned above involves not just one table with “negotiators” gathered around it, but countless tables with countless participants, and with messages flying back and forth in countless patterns as countless “decisions” are made in a manner somehow subordinated to the unity and multidimensioned interests of the organism as a whole. In other words, not only are the elements of an individual signaling pathway extremely flexible and adaptive; the individual pathway itself, once thought of as discrete and welldefined, does not really exist — certainly not as a separate “mechanism.” Researchers now speak of the “multi-functionality” of signaling nodes, pointing out that signaling networks have “ways of passing physiologically relevant stimulus information through shared channels.”[8] More generally, “We tend to talk about pathways and processes as if they are discrete compartments of biology,” write geneticists Emmanouil Dermitzakis and Andrew Clark. “But genes and their products contribute to a network of interactions” — and these interactive networks “differ radically among tissues.”[9] Whenever we imagine a biological process aimed at achieving some particular result, we need to keep in mind that every element in that process is likely playing a role in an indeterminate number of other significant, and seemingly goal-directed, activities. The mystery in all this does not lie primarily in isolated “mechanisms” of interaction; the question, rather, is why things don’t fall completely apart — as they do, in fact, at the moment of death. What power holds off that moment — precisely for a lifetime, and not a moment longer? Demise of Lock-and-Key Proteins. Quite apart from its wider context of exchange and interaction, the protein molecule itself is an entire universe of plastic form and possibility. It reminds us that messages do not fly back and forth as disembodied abstractions; they move as dynamically sculptured bodies of force and energy. Their meanings are mimed or gestured — not translated into or reduced to a kind of expressionless Morse code. According to the old story of the machine-organism, a protein-coding DNA sequence, or gene, not only specifies an exact messenger RNA (mRNA) sequence, but the mRNA in turn specifies an exact amino acid sequence in the resulting protein, which finally folds into a fixed and predestined shape. These proteins then carry out their functions by neatly engaging with each other, snapping into place like perfectly matched puzzle pieces or keys in locks. “There is a sense,” wrote Richard Dawkins in his 1986 book The Blind Watchmaker, “in which the three-dimensional coiled shape of a protein is determined by the one-dimensional sequence of code symbols in the DNA.” Further, “the whole translation, from strictly sequential DNA ROM [read-only memory] to precisely invariant three-dimensional protein shape, is a remarkable feat of digital information technology.”[10] This is as forthright a statement as ever there was of the “code delusion,” and we now know how great a misconception it was (a misconception upon which, in Dawkins’s case, his entire metaphysical-religious-scientific scheme of the “selfish gene” was erected). But the truth of the gene and protein looks quite different from this computerized ideal. Through alternative splicing, one gene can produce up to thousands of protein variants, while unlimited additional possibilities arise from RNA editing, RNA cleavage, translational regulation, and post-translational modifications. (“Translation” refers to the process by which an mRNA molecule, along with a large supporting cast, yields a protein.) As for the finally achieved protein, it need not be anything like the rigid, inflexible mechanism with a single, well-defined structure imagined by Dawkins. Proteins are the true shapechangers of the cell, responding and adapting to an ever-varying context — so much so that the “same” proteins with the same amino acid sequences can, in different environments, “be viewed as totally different molecules,” with distinct physical and chemical properties.[11] Nor is it the case that proteins must choose in a neatly digital fashion between discrete conformations. In contrast to the old “rigid-body” view, researchers now refer to “fluidlike”[12] and “surface-molten”[13] protein structures. Even more radical has been the

discovery that many proteins never do fold into a particular shape, but rather remain unstructured or “disordered.” In mammals, about 75 percent of signaling proteins and half of all proteins are thought to contain long, disordered regions, while about 25 percent of all proteins are predicted to be “fully disordered.” [14] Many of these intrinsically unstructured proteins are involved in regulatory processes, and are often at the center of large protein interaction networks.[15] Fluid, “living” molecules do not lend themselves to the analogy with mechanisms, which may explain why the mistaken idea of precisely articulated, folded parts was so persistent, and why the recognition of unstructured proteins has been so late coming. Indeed, this recognition has hardly yet dawned on the biological community as a whole, leading to this lament at a conference on “bioinformatics and bioengineering” at Harvard Medical School: Experimentalists have been providing evidence over many decades that some proteins lack fixed structure or are disordered (or unfolded) under physiological conditions. In addition, experimentalists are also showing that, for many proteins, their functions depend on the unstructured rather than structured state; such results are in marked contrast to the greater than hundred-year-old views such as the lock-and-key hypothesis. Despite extensive data on many important examples, including disease-associated proteins, the importance of disorder for protein function has been largely ignored. Indeed, to our knowledge, current biochemistry books don’t present even one acknowledged example of a disorder-dependent function, even though some reports of disorderdependent functions are more than fifty years old.[16] A continuing mechanistic bias is evident even in the negative terms “disordered” and “unstructured.” The loose, shifting structure of a protein need be no more disordered than the graceful, swirling currents of a river or the movements of a ballet dancer. Given what these proteins harmoniously participate in (among other things, the movements of a ballet dancer), it seems strange to assume that their performance is anything less than graceful and artistic. The Organism Reveals Itself Through Many Complementary Viewpoints. The living, non-mechanical qualities of the organism are evidenced not only in flexible, collaborative signaling and the plastic dynamism of proteins, but also in the organic unity of the whole, whereby every aspect of the organization is qualified by all the other aspects. There is a mutual interpenetration of processes making it impossible to offer simple chains of causal explanation. The result is that in order to understand the whole we have to take up many different and partial viewpoints — something that was hardly necessary so long as the one-dimensional, machine-like DNA code provided the single and undisputed basis for understanding. There is, for example, the “ribonome” — the entire collection of RNA molecules along with the diverse proteins that associate with them. Australian researcher John Mattick argues that RNA is the true “computational engine of the cell.” [17] This “engine” includes numerous large and small RNAs whose functions are the result, not simply of their transcription from DNA, but of their elaborate processing and restructuring within nucleus and cytoplasm. RNA in general is known or strongly implicated to be involved in the regulation of gene expression (both protein-coding and noncoding) at all levels in animals, creating extraordinarily complex hierarchies of interacting controls. This includes chromatin modification and associated epigenetic memory, transcription, alternative splicing, RNA modification, RNA editing, mRNA translation, RNA stability, and cellular signal transduction and trafficking pathways. [18]

It is true that RNA seems to have its hand in just about everything. And yet, others think of signaling pathways as the decisive, overall integrators: “It is becoming increasingly obvious that cellular signaling pathways control gene expression programs at multiple levels, from transcription through RNA processing and finally protein production.” [19] For still others, chromatin in general and the nucleosome in particular provide the clearest vantage point. As structured by nucleosomes, chromatin “[tells] the story of the genome in a more compact way without skipping the important features. Well defined, predictive chromatin signatures offer an elegant framework to comprehensively map all the functional elements in the human genome.”[20] There are further possibilities as well, such as the complex regulation of protein translation.[21] Even the elaborately articulated, information-rich, and too often overlooked

membrane architecture of the cell can be seen as playing a vital role in organizing and structuring the activity of the cell: Cellular organization in general and membrane-mediated compartmentalization in particular are constitutive of the biological “meaning” of any newly synthesized protein (and thus gene), which is either properly targeted within the context of cellular compartmentalization or quickly condemned to rapid destruction (or cellular “mischief”). At the level of the empirical materiality of real cells, genes “show up” as indeterminate resources.... If cellular membrane organization is ever lost, neither “all the king’s horses and all the king’s men” nor any amount of DNA could put it back together again. [22] Perhaps it is the case that, regardless of the vantage from which we look at the organism, deep inspection will yield a view onto the whole, just as any sentence of a profound and unified text, or any scene of a Greek tragedy, when penetrated deeply enough, opens out onto the meaning of the whole. At the same time, no single view yields a complete or fully adequate description of the whole. There is no one “correct” focus for the biologist; we discover instead numerous complementary perspectives. The Organism Is Not a Machine We can now return to biologists’ preoccupation with mechanistic terminology. Given the contrast between the ubiquitous appeal to mechanisms in the technical literature on the one hand, and the actual qualities of organisms revealed by the language of biological description on the other, the lack of forthrightness by researchers regarding what they mean by “mechanism” is remarkable. After all, there is no obvious similarity between a sewing machine or clock or any other machine and, say, a twisting, gesturing chromosome — or, for that matter, a cat stalking a mouse. Here is another way to think of the impropriety of the language of mechanism to describe life. The typical living cell is 75-80 percent water. Its primary activities are flows. Even the parts we have been taught (by photographs and textbook drawings) to take as fixed structures are in fact caught up in flows. They themselves are in one degree or another flows. For example, the filamentous cytoskeleton that helps give the cell a degree of rigidity and maintain its form “is not a fixed structure whose function can be understood in isolation. Rather, it is a dynamic and adaptive structure whose component polymers and regulatory proteins are in constant flux.”[23] Moreover, the organism’s relatively fixed structures are themselves the result of flow, not the ultimate cause of it. My favorite example of this comes from my Nature Institute colleague, Craig Holdrege: Before the heart [in the human fetus] has developed walls (septa) separating the four chambers from each other, the blood already flows in two distinct “currents” through the heart. The blood flowing through the right and left sides of the heart do not mix, but stream and loop by each other, just as two currents in a body of water. In the “still water zone” between the two currents, the septum dividing the two chambers forms. Thus the movement of the blood gives the parameters for the inner differentiation of the heart, just as the looping heart redirects the flow of blood. [24] The body, you might say, is a formed stream. And structures, once stably formed, do not necessarily stay that way. Many of the cell’s membranes are continually yielded up to dissolution and replacement, or they are pinched off to form separate little compartments (called vesicles) containing special contents to be delivered somewhere else in the cell before they are dissolved. And the cell as a whole — even an undividing cell such as a neuron — may experience a complete replacement of its contents a thousand times or more over the course of its life. Many of the body’s structures are more like standing waves than once-and-for-all constructed objects. When examined closely, all parts of the organism reveal a dynamism integrated with their context. Consider mitochondria, the energy-supplying organelles found in cells. The individual mitochondrion is “highly mobile, squirming worm-like back and forth across the cell space to places where energy is needed for special work.” But it often dissolves into fragments, which then fuse with other fragments. “In fact, by placing a cell into a slightly acid medium, all its mitochondria can be made to break up into small spherical beads which, upon return of the cell to normal medium, merge again into strings eventually resuming the appearance and internal structure of a normal mitochondrion.” [25] Against the backdrop of context-dependent phenomena such as this, it is hardly possible to contend that we consist, from the bottom up, of machine-like devices. The idea reflects a dogma crystallized from a rarefied mesh of abstractions rather than an engagement with actual organisms. You might just as well find “machines” in the currents of a river.

When scientists write that “Clock genes are components of the circadian clock comparable to the cogwheels of a mechanical watch,” [26] it ought to be scandalous. Yet such machine language is universal, is heavily relied on by otherwise rigorous scientists in their attempts to explain the organism, has no evident, serviceable meaning, and working biologists rarely if ever make a serious attempt to justify or even define it. Nor are the points at issue even particularly subtle. Here is the heart of the matter: The parts of a clock are put together in a certain way; the parts of an organism grow within an integral unity from the very start. They do not add themselves together to form a whole, but rather progressively differentiate themselves out of the prior wholeness of seed or germ. They are growing even as they begin functioning, and their functioning is a contribution toward their growing. The parts never were and never are completely separate, never are assembled. A specific bit of food taken in from outside never becomes some new, recognizable part, added to the rest; rather, it is metabolically transformed and assimilated by the ruling unity that is already there. The structures performing this work, such as they are, are themselves being formed out of the work. Does any of this sound remotely like a machine? When, on the other hand, we do build machines, we impose our designs upon them from without, articulating the parts together so that by means of their external relations they can perform the functions or achieve the purposes we intended for them. Those same relations give us our explanation of the machine’s physical performance. If the behavior of one of the parts depends on internal workings, and if we cannot yet analyze those workings in terms of subparts and their external relations, then we regard the part as a temporarily unexplained “black box.” One reason we cannot explain the organism through the relations between parts is that those parts tend not to remain the same parts from moment to moment. For example, as most molecular biologists now acknowledge, there is no fixed, easily definable thing we can call a gene. Whatever we do designate a gene is so thoroughly bound up with cellular processes as a whole that its identity and function depend on whatever else is happening. The larger context determines what constitutes a significant part, and in what sense, at any particular moment. Where, then, is any sort of definable mechanism? And the DNA sequence is just about the most rigidly fixed element the organism has to offer at the macromolecular level. Certainly there are reasonable analogies between, say, our bones and joints on the one hand and mechanisms such as levers and ball joints on the other. Such analogies can be multiplied many times over throughout the human body. But to avoid falsehood it is necessary to add that these are only approximations. Bones and joints are not in fact mechanisms. Bones, for example, are continually undergoing an exchange of substances with their environment, and even after the main period of our development is past, they are still being shaped and reshaped by their use or disuse and by the boundless range of other bodily processes with which they are interwoven. Astronauts on long missions in space lose significant bone mass, density, and strength;[27] lions raised in zoos have a bone structure differing from that of lions raised in the wild.[28] It’s certainly true that mechanisms such as ball joints, levers, and cogwheels also suffer change — for example, through wear and tear. But, unlike bones, such mechanisms are not continually reshaped through the integration of their internal processes with those acting from without. Gears and levers are not maintaining themselves and being maintained in anything like the way an internal organ is. The pervasive use of the machine metaphor, whether carelessly or by design, imports into biology ideas that have no place there. We have every right to ask the biologist who ceaselessly appeals to mechanisms, machines, and mechanistic explanations, “Please tell us what you mean by these terms.” This doesn’t seem unfair. Trying to Grasp the Whole Organism The special nature of biological understanding has been debated for as long as there has been a science of biology, with the debate taking form above all in the long-running dispute, on ever-shifting ground, between mechanists and vitalists. “Mechanism” has meant everything from “the physical organism is a machine, pure and simple” to “the organism is strictly material and is governed by nothing other than physical and chemical processes.” By contrast, vitalists have struggled to glimpse the “special something” that distinguishes living creatures from the non-living, whether it be some physical or quasiphysical “vital force” or simply principles of explanation that cannot be captured in the language of physics and chemistry even if those principles do not violate physical law.

That these are real issues, rooted both in the apparent distinctiveness of organisms compared to inanimate objects and in our direct awareness of our own life, and that the issues require some kind of resolution that has long escaped the discipline of biology, has been recognized throughout much of the past two centuries. Most biologists in recent decades have vested their hope in what seemed a near-certainty to them: their understanding of the organism would someday be reduced without remainder to the conventional terms of physics and chemistry. The case for that certainty having now become much shakier, any resolution of the longstanding debate seems as remote as ever. The aspects of the organism triggering the whole dispute have commonly been associated with one or more of the following themes: • The peculiar unity of whole and part: The form, existence, and activities of the parts depend upon, and arise from — are in some sense caused by — the whole, which is therefore expressed in one way or another through every part. This is much like the relation between individual words and their context — which is not surprising, since language is itself an expression of organic life. • Means-end (“purposive” or “final”) relations: Biological activities are carried out as if “with a view toward” or “for the sake of” some end. The organism “aims” to develop and sustain itself as a being with its own particular character. (I use quotation marks here because it is agreed on all sides that the directed aspect of biological performance should be distinguished from conscious human purpose, even if such purpose is viewed as a coming to intentional self-awareness of whatever expresses itself unreflectively in the wisdom of the body.) • The mutual (reciprocal) play of cause and effect: Effects are not merely effects, but can simultaneously react back upon their causes. Or, as Kant puts it, the parts “should so combine in the unity of a whole that they are reciprocally cause and effect of each other’s form.”[29] To give an archetypal example, as the embryo polarizes into anterior and posterior, each pole is not only “opposite” to the other, but necessarily implied in the other. Each pole is properly formed only by virtue of the other’s being formed. Neither is a unilateral cause of the other. All three of these features are at least suggested by the rather simpler statement that we find in every organism a meaningful coordination of its activities, whereby it becomes a functioning and self-sustaining unity engaged in a flexible response to the infinitely varying stimuli of its environment. By virtue of this coordination, every local or partial activity expresses its share in the distinctive character of the whole. The ability of the organism to pursue its own ends amid an ever-shifting context means that causal relations become fluid and diffuse, losing all fixity. They are continually subordinated to, or lifted into service of, the agency of the organism as a whole. There are no doubt many challenges to our understanding in all this, many issues to be clarified, perhaps even a new language to be worked out. But the starting point for this effort is clear: governance of the context over its separate elements, so frequently noted in the literature today, can be observed at every level, whether we speak of the organism, the cell, or the chromosome. The kind of wholeness we need to reflect upon was well illustrated by the pathologist A.E. Boycott in his presidential address to the Royal Society of Medicine’s pathology section some eighty years ago: We generally think of the blood as something which goes round the body and in so doing brings food to the tissues, takes away their excreta and helps to keep them in communication with one another. But we may also think of it, and sometimes more profitably, as a tissue or organ whose chief business it is to be itself and maintain its own individuality. The blood certainly has a specific structure and a chemical composition, organic and inorganic, which is peculiar to itself. And it shows exquisitely that restorative response to injury which is the chief subject-matter of pathology. Within comparatively narrow limits of natural variations, the volume of blood, the concentration of red cells, the reaction, and so on are maintained at steady levels. Though almost every substance which goes into or comes out of the body passes at one time or another through the blood, its composition remains almost constant, and it is this individual characteristic which entitles us to have “normal” standards of hemoglobin, red cells, and the rest. All experience shows, too, that it is very difficult experimentally to produce deviations from these normal values of more than a fleeting character, and under a great variety of circumstances the blood persists in remaining itself.[30]

“Persists in remaining itself.” The phrase may not quite rest comfortably with modern scientific sensibilities. Nor is it the only such phrase. But reasonable interpretations have long been on offer, as we will now see. More Than the Sum of Its Parts Variation of the parts amid relative constancy of a well-ordered whole that strives to remain itself: this was a central theme of one of the most prominent and now most unjustly neglected scientists of the past century. By all accounts a distinguished cell biologist, Paul Weiss pursued active research from the 1920s on into the 1970s, when he was awarded the National Medal of Science. He pioneered many techniques of tissue culture while pursuing important work in neurobiology, morphogenesis, limb and nerve regeneration, and cell differentiation. His awards and recognitions were many. Before coming to America, Weiss received an “old-school” education in Austria, which may account for the fact that he was aware of certain broader issues in biology from the very outset of his career. A scientist’s scientist in terms of his mathematical, experimental, and observational rigor, he couldn’t help noticing organismal behavior that didn’t fit the prevailing mechanistic models. For example, his powerful arguments against the gene-centered understanding of the organism, which we will touch on below, were founded on the most basic facts of observation and the most straightforward, unassailable reasoning — and they were arguments that would today be widely accepted. But at the time his was a voice in the wilderness; the almost arrogant confidence of molecular biologists, founded on deep philosophical commitment to the explanatory hegemony of the gene, prevented them from taking in his arguments. But now, if I’m not mistaken, there is a reawakening interest in what this rather low-key and incisive prophet had to say.

An electron micrograph showing a cross section through the ciliary field of a protozoan, appearing in Paul Weiss, “From Cell to Molecule,” The Molecular Control of Cellular Activity, 1962. [Click to enlarge.]Picking up the theme of Boycott about the constancy of the blood amid change, Weiss provided numerous examples of global unity and harmony superimposed upon lower-level variation.[31] Consider the electron micrograph at right, which shows a tangential section grazing the surface of a single-celled ciliate protozoan. Because the angle of the section is slightly oblique, the circular structures — each one a single cilium with eleven parallel fibers (nine in a circle and two in the middle) — are shown cut at varying depth, revealing different aspects of the structures. The placement and form of all the details shows no constancy. And yet that unevenness, which might be expected to lead to ever less order in the overall composition, is nevertheless disciplined toward a larger, patterned harmony. Weiss shows repeatedly in his various analyses that the mechanical forces or physical dimensions or one-to-one interactions at the level of the parts of an organism are inadequate to determine the coherence of the scheme into which the parts are fitted. We

cannot compare the arrangement of cilia shown above to the way rigid, precisely shaped bricks can be laid out in a pattern determined by their shapes. Instead, as Weiss puts it, we see “certain definite rules of order” that “apply to the dynamics of the whole system ... reflected in the orderliness of the overall architectural design, which cannot be explained in terms of any underlying orderliness of the constituents.” [32] Much the same applies to the pluripotent cells of the very young embryo. A given cell can be moved from one place to another, resulting in a completely different fate for that cell within the developing organism. What might have been part of a hand becomes instead part of a leg. This indicates that the cell’s fate is determined “on the fly”: a governing dynamic disposes of each part according to the needs of the overall pattern. The developing relations between the individual cells are more a result of than a cause of the order of the whole. Besides its full complement of “genetic information,” each cell needs still additional “topical information” derived from the structure of the collective mass, Weiss notes. How otherwise could any unit know just what scrap of information to put to work at its particular station in order to conform to the total harmonious program design? Left solely to their own devices, individual cells and their entrapped genomes would be as incapable of producing a harmonious pattern of development as a piano with a full keyboard would be of rendering a tune without a player.[33] It is crucial to realize what Weiss is not saying. He is not saying that the laws of physics are violated in the formation of organic patterns. He himself spent many years elucidating the play of physical forces in such situations. What is being coordinated is nothing other than this play of forces. His point is that, whatever the level we analyze, from macromolecular complexes, to organelles, to cells, to tissues, to individual organs, to the organism as a whole, we find the same principle: we cannot reconstruct the pattern at any level of activity by starting from the parts and interactions at that level. There are always organizing principles that must be seen working from a larger whole into the parts. Despite the countless processes going on in the cell, and despite the fact that each process might be expected to “go its own way” according to the myriad factors impinging on it from all directions, the actual result is quite different. Rather than becoming progressively disordered in their mutual relations (as indeed happens after death, when the whole dissolves into separate fragments), the processes hold together in a larger unity. The behavior of the whole “is infinitely less variant from moment to moment than are the momentary activities of its parts”: Small molecules go in and out, macromolecules break down and are replaced, particles lose and gain macromolecular constituents, divide and merge, and all parts move at one time or another, unpredictably, so that it is safe to state that at no time in the history of a given cell, much less in comparable stages of different cells, will precisely the same constellation of parts ever recur.... Although the individual members of the molecular and particulate population have a large number of degrees of freedom of behavior in random directions, the population as a whole is a system which restrains those degrees of freedom in such a manner that their joint behavior converges upon a nonrandom resultant, keeping the state of the population as a whole relatively invariant. [34] We might say that a given type of cell (or tissue, or organ, or organism) insists upon maintaining its own recognizable identity with “unreasonable” tenacity. It turns out, then, that less change is what shows the whole cell or organism to be more than the sum of its parts. It is as if there were an active, coordinating agency subsuming all the part-processes and disciplining them so that they remain informed by the greater unity. The coordination, the ordering, the continual overcoming of otherwise disordering impacts from the environment so as to retain for the whole a particular character or organized way of being, expressively unique and different from other creatures — this is the “more” of the organism that cannot be had from the mere summing of discrete parts. The center holds, and this ordering center — this whole that is more than the sum of its parts — cannot itself be just one or some of those parts it is holding together. When the organism dies, the parts are all still there, but the whole is not. Animistic Impulses in Biology Consider also DNA and the vast array of proteins and other molecules that must cooperate with it in all its functions. A DNA molecule by itself is without meaning for the organism; it cannot do anything. As Harvard biologist Richard Lewontin once wrote, it is “a dead molecule, among the most nonreactive, chemically inert molecules in the living

world.”[35] Its meaning is as much a function of the molecules with which it interacts as it is a property of its own structure. Or, in Weiss’s words: “Life is a dynamic process. Logically, the elements of a process can be only elementary processes, and not elementary particles or any other static units.”[36] But, we may ask, aren’t all the molecules involved in these processes made by DNA? Actually, no. First, as just noted, DNA by itself cannot make anything. Second, many crucial molecules that shape the functioning of the cell, including all lipids and carbohydrates, do not derive from DNA. This reminds us that the central functioning of metabolism — the transformation of nutrients in the cell — is not in any realistic sense controlled by DNA. The reverse is just as true; metabolic processes send signals to DNA when its services are wanted. Third, the proteins and noncoding RNAs that do derive from DNA are extensively and significantly modified by processes in the cytoplasm, with their functions depending heavily on these modifications. Fourth, the enzymes and other proteins essential for transcribing DNA certainly cannot be described as mere “products” of DNA because they are never produced without already existing to help carry out the production. And fifth, DNA, far from being responsible for everything in the cell, is itself in an important sense the responsibility of the cell, which goes through a balletic drama of scarcely conceivable complexity in order to replicate and preserve this vitally important molecule. In sum: all cellular constituents, including DNA, originate from the cell and organism as a whole. To say, as Nobel laureate Max Delbrück once did, that DNA could be conceived in the manner of Aristotle’s First Cause and Unmoved Mover, since it “acts, creates form and development, and is not changed in the process” [37] — well, that’s a stupefying blind spot, a blind spot that to one degree or another dominated the entire era of molecular biology through the turn of the current century. It was already recognized and warned against by the German botanist Fritz Noll in 1903, who pointed out how (in E.S. Russell’s paraphrase) “the chief theorists have tried to solve the problem of development by assuming a material and particulate basis [today’s ‘gene’], without however attempting to explain how the mere presence of material elements could exert a controlling influence on development. They have been forced to ascribe to such abstract material units properties and powers with which they would hesitate to credit the cell as a whole.” [38] Weiss emphasizes very much the same point: because there is no possible way to make global sense of genes and their myriad companion molecules by remaining at their level, researchers have “simply bestowed upon the gene the faculty of spontaneity, the power of ‘dictating,’ ‘informing,’ ‘regulating,’ ‘controlling,’ etc.” [39] And today, one could add, there is at least an equal emphasis on how other molecules “regulate” and “control” the genes! Clearly something isn’t working in this picture of mechanistic control. And the proof lies in the covert, inconsistent, and perhaps unconscious invocation of higher coordinating powers through the use of these loaded words — words that owe their meaning ultimately to the mind, with its power to understand information, to contextualize it, to regulate on the basis of it, and to act in service of an overall goal. Weiss considers terms such as “regulate,” “organize,” and “control” an “obvious reversion in modern guise to animistic biology, which let animated particles under whatever name impart the property of organization to inanimate matter.” [40] Weiss refuses to ascribe the power of regulating and organizing to specific material parts of the organism, which would grant them a kind of magical quality. Whatever regulates a set of interacting parts cannot be found in one of the parts being regulated. To see the principles of regulation governing any set of parts, we have to step back, or up, until we can recognize a unity and harmony that operates, so to speak, between the parts, becoming visible only from a more comprehensive, relational vantage point. This unity and harmony may represent a genuine difficulty for our understanding, if only because few in recent decades have bothered to address it. But until we see the problem where it actually lies, instead of concealing it in molecules with mystical qualities, we can hardly begin the work of trying to understand. To be sure, serious researchers long recognized the “problem” of biological explanation — but the issues were largely set aside in the era of molecular biology due to the expectation that they were well on their way to routine solution. Biology would soon be rid of its troublesome language of life in favor of well-behaved molecular mechanisms. And yet today, after several decades of stunning progress in molecular research, it is no more possible than it was two hundred years ago to construct a single paragraph of properly biological description that does not

draw on a meaningful language of living agency considered improper in chemistry or physics. If we want to reckon with the holism, the coordination and organization, the means-end relationships that are continually appealed to in biological explanation, one way forward might be to take the biologist’s special language of life — minus its mystical tendencies — seriously and at face value. Perhaps the biologist describes what he actually sees, and perhaps the living qualities of the organism are not really as spooky as they are sometimes made out to be. Perhaps it never did make sense to try to understand the world from the bottom up, never made sense to dismiss the richest, most multifaceted phenomenal displays — the most organically unified realizations of the world’s creative potential, such as we find in the performance of whole living creatures — as if they were, by very reason of the fullness of their revelation, the most unreal and misleading guides to the true nature of things. Mechanisms of Control or a Living Unity? Before concluding, it remains only to show ever so briefly what happens when you mix the language of organic coordination with that of mechanistic control. It’s not a pretty sight. A paper that recently landed in my e-mail inbox, otherwise very worthy, serves as well as any to illustrate the situation. It concerns the p53 protein: The tumor suppressor p53 is a master sensor of stress that controls many biological functions, including [embryo] implantation, cell-fate decisions, metabolism, and aging.... Like a complex barcode, the ability of p53 to function as a central hub that integrates defined stress signals into decisive cellular responses, in a time- and cell-type dependent manner, is facilitated by the extraordinary complexity of its regulation. Key components of this barcode are the autoregulation loops, which positively or negatively regulate p53’s activities. We have, then, a master sensor that controls various fundamental cellular processes, and yet is dependent on the signals it receives and is subject to “extraordinarily complex” regulation by certain autoregulation loops. While all these loops regulate p53 (some positively and some negatively), one of them, designated “p53/mdm2,” is the master autoregulation loop, and it dictates the fate of an organism by controlling the expression level and activity of p53. It is therefore not surprising that this autoregulation loop is itself subject to different types of regulation, which can be divided into two subgroups.[41] So the master controlling sensor is itself subject to a master controlling process (one of several regulatory loops) that dictates the fate of the organism. But this master loop, it happens, is in turn regulated in various manners (the author goes on to say) by a whole series of “multi-layered” processes, including some that are themselves “subject to direct regulation by mdm2” — that is, they are regulated by an element of the regulatory loop they are supposed to be regulating. I can hardly begin to describe the stunning complexity surrounding and supporting the diverse performances of the p53 protein. But it is now clear that such “regulatory” processes extend outward without limit, connecting in one way or another with virtually every aspect of the cell. The article on p53 makes an admirable effort to acknowledge and summarize the almost endless intricacy and contextuality of p53 functioning and, with its language of mechanism and control, it does not differ from thousands of other papers. But that only underscores the undisciplined terminological confusion continuing to corrupt molecular biological description today. When regulators are in turn regulated, what do we mean by “regulate” — and where within the web of regulation can we single out a master controller capable of dictating cellular fates? And if we can’t, what are reputable scientists doing when they claim to have identified such a controller, or, rather, various such controllers? If they really mean something like “influencers,” then that’s fine. But influence is not about mechanism and control; the things at issue just don’t have controlling powers. What we see, rather, is a continual mutual adaptation, interaction, and coordination that occurs from above. That is, we see not some mechanism dictating the fate or controlling an activity of the organism, but simply an organism-wide coherence — a living, metamorphosing form of activity — within which the more or less distinct partial activities find their proper place. The misrepresentation of this organic coherence in favor of supposed controlling mechanisms is not an innocent inattention to language; it is a fundamental misrepresentation of reality at the central point where we are challenged to understand the character of living things.

How the organism holds together and makes sense is surely what the employers of such language are really trying to capture. One sympathizes with them. The problem is that their science gives them a respectable (and extremely valuable) language of analysis, while it is still stumbling around looking for a language able to comprehend unities or wholes — a “systems” language, some would say. The difficulty is owing to the stubborn proviso that this language must not come too uncomfortably close to infringing the taboo against recognizing mind and meaning, direction and intention, lest the world become unsafe for objects and mechanisms. So the researcher is left with a curious problem: to make sense of the organism without finding any real meaning in it — least of all the meaning traditionally associated with living beings. Systems may perhaps be tolerated; at least they are reassuringly vague and anonymous, and invite casual manipulation. But who knows what disagreeable entanglements might follow once we find ourselves staring into the face of other beings? Notes [1]Sayyed K. Zaidi, Daniel W. Young, Amjad Javed,  et al., “Nuclear Microenvironments in Biological Control and Cancer,” Nature Reviews Cancer 7, no. 6 (June 2007): 454-63. [2]Daniel R. Hyduke and Bernhard Ø. Palsson, “Towards Genome-Scale SignallingNetwork Reconstructions,”  Nature Reviews Genetics 11, no. 4 (April 2010): 297-307. [3]Barbara McClintock, “The Significance of Responses of the Genome to Challenge,” Nobel lecture, Dec. 8, 1983.  [4]Christophe Lavelle, “Forces and Torques in the Nucleus: Chromatin under Mechanical Constraints,”  Biochemistry and Cell Biology 87 (2009): 307-22. [5]  Jacques E. Dumont, Frédéric Pécasse, and Carine Maenhaut, “Crosstalk and Specificity in Signalling: Are We Crosstalking Ourselves into General Confusion?,” Cellular Signalling 13 (2001): 457-63. [6]Emmanuel D. Levy, Christian R. Landry, and Stephen W. Michnick, “Signaling Through Cooperation,”  Science 328 (May 21, 2010): 983-4. [7]  Bruce J. Mayer, Michael L. Blinov, and Leslie M. Loew, “Molecular Machines or Pleiomorphic Ensembles: Signaling Complexes Revisited,” Journal of Biology 8, no. 9 (2009): 81.1-8. [8]Marcelo Behar and Alexander Hoffmann, “Understanding the Temporal Codes of Intracellular Signals,”  Current Opinion in Genetics and Development 20 (2010): 684-93. [9]Emmanouil T. Dermitzakis and Andrew G. Clark, “Life After GWA Studies,”  Science 326, no. 5950 (Oct. 9, 2009): 239-40. [10]Richard Dawkins,  The Blind Watchmaker: Why the Evidence of Evolution Reveals a Universe without Design (New York: W. W. Norton, 1996), 120. [11]Stephen Rothman,  Lessons from the Living Cell: The Limits of Reductionism (New York: McGraw Hill, 2002): 265. [12]  Barry J. Grant, Alemayehu A. Gorfe, and J. Andrew McCammon, “Large Conformational Changes in Proteins: Signaling and Other Functions,” Current Opinion in Structural Biology 20 (2010): 142-7. [13]  Yaoqi Zhou, Dennis Vitkup, and Martin Karplus, “Native Proteins Are Surface-molten Solids: Application of the Lindemann Criterion for the Solid versus Liquid State,” Journal of Molecular Biology 285, no. 4 (Jan. 29, 1999): 1371-5. [14]Vladimir N. Uversky, “The Mysterious Unfoldome: Structureless, Underappreciated, Yet Vital Part of Any Given Proteome,”  Journal of Biomedicine and Biotechnology 2010, article ID 568068. doi:10.1155/2010/568068 [15]Jörg Gsponer and M. Madan Babu, “The Rules of Disorder or Why Disorder Rules,”  Progress in Biophysics and Molecular Biology 99 (2009): 94-103. doi:10.1016/j.pbiomolbio.2009.03.001 [16]A. Keith Dunker, Christopher J. Oldfield, Jingwei Meng,  et al., (2008). “The Unfoldomics Decade: An Update on Intrinsically Disordered Proteins,” BMC Genomics 9, suppl. 2 (2008): S1. doi:10.1186/1471-2164-9-S2-S1 [17]John S. Mattick, “Has Evolution Learnt How to Learn?”  EMBO Reports 10, no. 7 (2009): 665. doi:10.1038/embor.2009.135 John S. Mattick, Ryan J. Taft, and Geoffrey J. Faulkner “A Global View of Genomic Information — Moving Beyond the Gene and the Master Regulator,” Trends in Genetics 26, no. 1 (2009): 21-8. [18]John S. Mattick, “A New Paradigm for Developmental Biology,”  Journal of Experimental Biology 210 (2007): 1526-47.

[19]Robert J. White and Andrew D. Sharrocks, “Coordinated Control of the Gene Expression Machinery,”  Trends in Genetics 26, no. 5 (2010): 214-20. [20]Gary C. Hon, R. David Hawkins, and Bing Ren, “Predictive Chromatin Signatures in the Mammalian Genome,”  Human Molecular Genetics 18, no. 2 (2009): R195-R201. [21]Kyle D. Mansfield and Jack D. Keene, “The Ribonome: A Dominant Force in Coordinating Gene Expression,”  Biology of the Cell 101, no. 3 (2009): 169-81. [22]Lenny Moss,  What Genes Can’t Do (Cambridge, MA: MIT Press, 2003), 95. [23]Daniel A. Fletcher and R. Dyche Mullins, “Cell Mechanics and the Cytoskeleton,”  Nature 463 (Jan. 28, 2010): 485-92. [24]Craig Holdrege, ed.,  The Dynamic Heart and Circulation, trans. Katherine Creeger (Fair Oaks CA: AWSNA, 2002), 12. [25]Paul Weiss, “The Living System: Determinism Stratified,” in  Beyond Reductionism: New Perspectives in the Life Sciences, ed. Arthur Koestler and John R. Smythies (New York: Macmillan, 1970), 361-400. [26]Urs Albrecht and Jürgen A. Ripperger, “Clock Genes,” in  Encyclopedia of Neuroscience part 3 (2009): 759-62. [27]J.H. Keyak, “Reduction in Proximal Femoral Strength Due to Long-Duration Spaceflight,”  Bone 44, no. 3 (2009): 449-453. [28]Craig Holdrege, “Seeing the Animal Whole: The Example of the Horse and Lion,” in  Goethe’s Way of Science, ed. David Seamon and Arthur Zajonc (Albany: SUNY Press, 1998), 213-32. [29]Immanuel Kant,  The Critique of Judgment, trans. J. H. Bernard (Amherst NY: Prometheus Books, 2000), II.1.65. [30]A.E. Boycott, “The Blood as a Tissue: Hypertrophy and Atrophy of the Red Corpuscles,”  Proceedings of the Royal Society of Medicine 23, no. 1 (Nov. 1929): 15-25. [31]Paul Weiss, “Cellular Dynamics,”  Reviews of Modern Physics 31, no. 1 (Jan. 1959): 11-20. Paul Weiss, “From Cell to Molecule,” in The Molecular Control of Cellular Activity, ed. John M. Allen (New York: McGraw-Hill, 1962), 1-72. Paul Weiss, “One Plus One Does Not Equal Two” and “The Living System: Determinism Stratified,” in Within the Gates of Science and Beyond: Science in Its Cultural Commitments (New York: Hafner, 1971), 213-311. [32]Weiss, “The Living System: Determinism Stratified.”  [33]Paul A. Weiss,  The Science of Life: The Living System — A System for Living (Mount Kisco NY: Futura Publishing, 1973). [34]Weiss, “From Cell to Molecule.”  [35]Richard C. Lewontin, “The Dream of the Human Genome,”  New York Review of Books 39, no. 10 (May 28, 1992), 31-40. [36]Weiss, “From Cell to Molecule.”  [37]Max Delbrück “Aristotle-totle-totle,” in  Of Microbes and Life, ed. Jacques Monod and Ernest Borek (New York: Columbia University Press, 1971), 50-5. [38]Edward Stuart Russell,  The Interpretation of Development and Heredity: A Study in Biological Method (Oxford: Clarendon Press, 1930), 287. [39]Weiss, “The Living System: Determinism Stratified.”  [40]Weiss, “From Cell to Molecule.”  [41]Xin Lu, “Tied Up in Loops: Positive and Negative Autoregulation of p53,”  Cold Spring Harbor Perspectives in Biology 2, no. 5 (May 2010): a000984. What Do Organisms Mean? If a single problem has vexed biologists for the past couple of hundred years, surely it concerns the relation between biology and physics. Many have struggled to show that biology is, in one sense or another, no more than an elaboration of physics, while others have yearned to identify a “something more” that, as a matter of fundamental principle, differentiates a tiger — or an amoeba — from a stone. The former, reductionist aim can easily seem to ignore what is special about living creatures — and above all to ignore the way meaningful human experience seems to transcend the kind of lawfulness we observe in inanimate physical objects. But, on the other hand, scientists who attempt to articulate a principle differentiating the living from the non-living have all too often posited some kind of special matter or vital force that no one ever seems able to identify. We discussed in previous articles how, whatever their belief in these matters, biologists today — and molecular biologists in particular — routinely and unavoidably describe the

organism in terms that go far beyond the language of physics and chemistry. Words like “stimulus,” “response,” “signal,” “adapt,” “inherit,” and “communicate,” in their biological sense, would never be applied to the strictly physical and chemical processes in a corpse or other inanimate object. But they are always employed in attempts to understand the living organism. The prevalent descriptions portray the whole organism as an active unity, with powers of regulation and coordination intelligently directed toward the achievement of the organism’s own ends. Further, we noted that such descriptions, rooted as they are in the observable character of the organism, show no sign of being reducible to less living terms or to the language of mechanism. But this immediately raises a suspicion of vitalism in the minds of many scientists. Who, after all, is this organism? And by what special powers does it “regulate,” “integrate,” “respond,” and “communicate”? Bear in mind, however, that these questions press just as urgently upon the conventional molecular biologist as on the suspected vitalist. After all, the loaded terminology comes straight from the laboratory, where researchers are trying to make sense of what they see. A subject possessing a power of agency adequate to regulate or coordinate at the level of the whole organism looks for all the world like what has traditionally been called a being. But you will not find biologists speaking of beings. It’s simply not allowed, presumably because it smells too explicitly of vitalism, spiritualism, the soul, or some other appeal to an immaterial reality. We will see later what extraordinary confusion bedevils this attitude, but for now let us simply yield to the biologist’s language of choice, provisionally defining a “being” as “whatever makes sense as the subject of all those terms of agency found in every biological research paper.” What, or who, is capable of all the highly directed activity of cell and organism? We will leave aside for now any features of that agency other than ones for which the life scientist has vouched. To think of it positively: We are looking for a way to justify the standard language of biological theory and description. After all, a lot of experiment and observation has led to this language; if we start with it, we will surely gain valuable clues about the being of the organism. For example, the language tells us that every organism discriminates in many circumstances between health on the one hand and disease or injury on the other, and acts flexibly and intelligently — within its own limits and based on the particulars of its disorder (which may involve conditions it has never encountered before) — to restore health. More generally, it pursues a coherent path of development and self-maintenance, and manages to produce new life from existing life via intricate processes at the molecular, cellular, and behavioral levels. The biologist’s “being” — the subject of those verbs of agency — is also at home with meaning, or information, continually transmitting and receiving it, extracting it from or imposing it upon the environment, interpreting it in light of its own needs, acting on it, distinguishing the relevant from the irrelevant. If the biological literature is to be believed, the organic being in some sense perceives, knows, and responds appropriately to the meanings of diverse stimuli. This being is also said to be a self — whatever the self is that engages wholesale in “selforganization.” It does so in part by sponsoring many partial and subordinate “selves,” as when one speaks of self-organizing neural networks, self-organizing chromosome territories, self-organizing tissues, self-organizing protein structures, and so on. And it may even participate in a superordinate self: ants are sometimes said to be part of a “self-organizing ant colony.” Such, at least, is the being we are handed by biologists. Not unanimously in all details, to be sure, and in need of critical assessment without a doubt. But it’s a place to start. Our aim is to locate this being of the organism a little more comfortably within the landscape of an acceptable science — locate it in a way that remains faithful to observation while sparing biologists any embarrassment at their own language. It will require a considerable journey. Two Ways of Explaining We commonly explain occurrences by saying one thing happened because of — due to the cause of — something else. But we can invoke very different sorts of causes in this way. For example, there is the because of physical law (the ball rolled down the hill because of gravity) and the because of reason (he laughed at me because I made a mistake). The former hinges upon the kind of necessity we commonly associate with physical causation; the latter has to do with what makes sense within a context of meaning.

Any nuance of meaning coming from any part of the larger context can ground the because of reason. “I blushed because I saw a hint of suspicion in his eyes.” But I might not have blushed if his left hand had slightly shifted in its characteristic, reassuring way, or if a rebellious line from a novel I read in college had flashed through my mind, or if a certain painful experience in my childhood had been different. In a meaningful context, there are infinite possible ways for any detail, however remote, to be connected to, colored by, or transformed by any other detail. There is no sure way to wall off any part of the context from all the rest. The Canadian cognitive scientist and philosopher, Zenon Pylyshyn, once neatly captured the distinctiveness of the because of reason this way: Clearly, the objects of our fears and desires do not cause behavior in the same way that forces and energy cause behavior in the physical realm. When my desire for the pot of gold at the end of the rainbow causes me to go on a search, the (nonexistent) pot of gold is not a causal property of the sort that is involved in natural laws.[1] The because of reason does not refer to mere “logic” or “rational intellectuality.” Nor need it imply conscious ratiocination. It is constellated from the entire realm of possible meaning, including such things as our desire for pots of gold or our subconscious urges toward violence. I will therefore refer interchangeably to the because of reason and the because of meaning, by both of which I refer to all the semantic relations and connotations, all the significances, that weave together and produce the coherent tapestry of a life, or of any other expression of meaning, such as a profound text — say, Aeschylus’ Agamemnon or Lincoln’s Gettysburg Address, or, for that matter, the text of a biological description. Meaning is notoriously difficult to define — and, in fact, meaning lies at the opposite pole from precise definition. Words gain fullness of meaning only when they are removed from the dictionary and placed in a concrete context, where an interplay of qualities, connotations, suggestions, and metaphorical juxtapositions enables the words to interpenetrate and pulsate with many-dimensioned significance. To “nail something down” in a definition is rather like removing all the overtones from what had once been the richly resonant song of a violin string in order to get a precise, definable rate of vibration. Qualities are reduced to number. As semantic historian Owen Barfield has pointed out, every effort at definition, to the degree it achieves the desired endpoint of abstract, decontextualized precision, becomes mere counting. [2] Water, for example, might be defined in terms of boiling point, melting point, density, transparency (percent transmission of light), and so on. But despite the loss of meaning in the very attempt to define it, we all have a certain sense for what meaning is, because we all know what we mean when we speak. By contrast, the because of physical law applies to things that do have more or less precisely defined and delimited relationships, which therefore lack a meaning-driven character. We need not appeal to “what makes sense” in a larger, more richly expressive context, because a proposed physical law is either “obeyed” or not, despite any look of the eyes or gesture of the hand. A thrown ball respects the law of gravity even if a strong wind is blowing it this way or that. Whereas each detail of a meaningful text gains its significance from the way many contextual elements color and modify each other, we observe the lawfulness of a physical event by isolating (as far as we can) a precisely defined and invariant relationship. The physicist’s strong preference is for strict mathematical laws. Meaning is inseparable from language. But it will prove important to understand that, in distinguishing the because of reason from that of physical law, we are not distinguishing the language-like from the non-language-like. Rather, the relation between the two becauses is more like the relation between a full-bodied language, on the one hand, and a syntax or reduction of that language, on the other. Mathematics, logic, grammar, algorithmic formalisms — these are examples of such reductions. They give us a kind of generalized skeleton abstracted away from all the concrete expressive potentials of the language. And while these reductions are severely restricted in their ability to describe or characterize the fullness of the phenomenal world, they serve very well to capture the lawfulness we associate with what are often called the “mechanistic” aspects of the world. Here, then, is the point. What distinguishes the language of biology from that of physics is its free and full use of the because of reason. Where the inanimate world lends itself in some regards to application of a “deadened,” skeletal language — a language that

perhaps too easily invites us to think in terms of mechanisms — the organism requires us to recognize a full and rich drama of meaning. And so when we ask whether a protein has folded correctly, we’re not suggesting it may have rashly disregarded the laws of physics. Its respect for the syntax of a physical law is not the issue we’re addressing. We want to know something much more plastic — more plastic in the way that meaning is more plastic than a rigid grammar or mathematical formula. That is, we want to know whether the folding is consistent with — serves the needs of and is harmonious with — the coherence and the active, self-expressing identity we recognize in the surrounding context. It’s a context and an identity whose qualities and intents differ greatly from a snake to a lion, from a German shepherd to a golden retriever, or from a lung to a kidney. Likewise, when we inquire into the communication between cells, we are not merely curious about the physical impact of molecular projectiles fired from one cell to another; we are trying to clarify a context of meaning. The one cell is saying something to the other, not just pushing against it. Harvard biologist Richard Lewontin once described how you can excise the developing limb bud from an amphibian embryo, shake the cells loose from each other, allow them to reaggregate into a random lump, and then replace the lump in the embryo. A normal leg develops. Somehow the form of the limb as a whole is the ruling factor, redefining the parts according to the larger pattern. Lewontin went on to remark: Unlike a machine whose totality is created by the juxtaposition of bits and pieces with different functions and properties, the bits and pieces of a developing organism seem to come into existence as a consequence of their spatial position at critical moments in the embryo’s development. Such an object is less like a machine than it is like a language whose elements ... take unique meaning from their context. [3] A context of meaning can be thought of in various terms. We can take it, for example, to be the organism’s unified form in the fullest sense — not only its bodily form (as a flexible, dynamic trajectory of development), but also the “shape” of its pattern of activity, its recognizable and irreducibly qualitative way of being, distinct for every species.[4] Every organic form is a gesturing, which is also to say, a kind of speaking or an expression of meaning. And we could just as well say that the organism’s gesturing manifests the character we recognize in the organism as a whole. Gesture, character, significant form, a tapestry of meaning — these terms all point to the “something more” that, as we found earlier, makes the language of physics and chemistry inadequate to describe the organism. They also typify our way of thinking about beings, as opposed to things. That is, they require a language of directed intention (respond, develop, adapt, regulate, and so on); an aesthetically colored language (everything relating to health and disease, order and disorder, rhythm and dysrhythmia, harmony and disharmony); and a language of wholeness (unity, coordination, integration, organization). In fact, just about all the kinds of meaning we express in our words, thought, and activity find their analogue in our descriptions of organisms. Not surprisingly, then, the biologist directly invokes meaning itself in terms such as message, information, communication, and signal. The biologist’s reliance upon the because of reason — a because that resonates so intimately with the meaning of our own lives — is no small thing. It is no small thing, that is, to find ourselves living together with all our fellow creatures in a community of meaning. For in the realm of meaning, there can be, finally, only one community; a hermetically sealed compartment of meaning wholly disconnected from all other meaning is an impossibility. If this truth of community hasn’t been loudly proclaimed from the research laboratories to the wider public, it is only because biologists have gone on for decades using the language of meaning while remaining content never to reckon with it — and even effectively denying it with a contradictory language of mechanism and control. It is past time for the reckoning. The Inwardness of Beings Meaning — at least when we are not trying to camouflage it in some narrow mechanical or mathematical notion of information — derives from and expresses a qualitative inwardness. It testifies to mind, feeling, volition, consciousness. And because, in our biological descriptions, we refer meaning to organisms, it appears we are ascribing inwardness to these organisms. And so we are. But there are important distinctions to be made. Meaning need not be thought of solely in terms of our own human consciousness. Everyone accepts that neither the bird building a nest nor the embryo “constructing” a

heart is self-consciously realizing its own purposes and meanings. Likewise, the directed nature of cellular processes does not imply conscious, human-like purpose, and, more generally, the meaning I have been referring to need not involve anything like our own conscious awareness. This is not to suggest, however, that meaning is no longer meaning. Our knowledge of ourselves informs us that the because of reason can play out in less than full consciousness. We know that it weaves throughout the psyche, conscious or otherwise, all the way down through subconscious urge and habit to biologically rooted instinct and even to physical reflex.[5] It is not so unexpected, then, to discover meaning-governed activities also at the molecular level, where they manifest as regulation, organization, signaling, responsiveness, and all the rest. Organisms, so far as the biologist has been able to determine, are alive and whole and engaged in activity shaped by relations of meaning — a meaning whose signature is recognizable all the way down. What is it, after all, that becomes conscious in the human being? All our growing knowledge of our own complex psychosomatic unity suggests that the inwardness at work in the formation and activity of the body, from the molecular level on up, is akin to — not radically other than — what comes to awareness of itself as psyche. The fact that our physical organism so directly and intimately reflects not only our explicit volitional commands but also our inner, meaningful states (“I blushed because I saw a hint of suspicion in his eyes”) — while, conversely, our inner life is directly affected by our bodily state, as when we are sick or in pain — leaves little room for a radical separation of psychic meaning from the bodily (molecular) meaning we traced earlier. You will recall that we have been trying to identify the being assumed (whether explicitly or otherwise) by biologists when they describe the organism. This being pursues its life within a context of meaning, and possesses a kind of inwardness that is not sharply separable from human consciousness. Beginning with a molecular-level analysis of the simplest, single-celled organism extant today and proceeding through all the ever more complex creaturely orders, we see no sudden discontinuity in the play of meaning and inwardness — a play that progressively comes to a focus in the individuated centers of consciousness we know as our selves. If there is an uncomfortable element in all this for many biologists, it arises from the perceived difficulty of reconciling the inwardness of beings with a faith in all the materialist metaphysical baggage that has accumulated around the sciences. This presumably accounts for biologists’ shyness in owning up to their own language. But, leaving aside the oddity that biologists seem much more concerned than physicists to preserve a materialist faith, we will now see that the problem posed by living beings in relation to physical science results solely from misunderstanding. Laws and Causes The physicist wants laws that are as universal as possible, true of all situations and therefore unable to tell us much about any particular situation — laws, in other words, that are true regardless of meaning and context. So far as a physical law is concerned, once we know it, every subsequent observation merely demonstrates something we already knew: the law will yet again be obeyed. This requires a severe abstraction from the presentational richness of the phenomenal world, which presents us at every moment with something new. Such abstraction shows up in the strong urge toward the mathematization of physical laws. While the laws usually considered most fundamental remain (at least ideally) valid regardless of context, we can put them most conveniently on view by establishing carefully contrived closed systems — systems as immune as possible to outside (contextual) interference. That’s because contextual changes tend to obscure the particular law we are after. An apple released from a tree may fall straight toward the center of the earth with more or less constant acceleration — but not if I stretch out my hand and grab it, or a sudden gust of wind arises, or it strikes a bird or insect, or there is a meteoric explosion nearby, and so on. Gravity, of course, will be respected in any case, but sometimes we want to see its role displayed without ambiguity or interference — see it as a matter of demonstrable cause and effect and easy measurement. And so, perhaps, we may contrive to drop the apple within a vacuum chamber, a relatively closed system that eliminates air resistance and insects, and demonstrates the mathematical lawfulness of gravity as directly as possible. This allows us to talk more convincingly about how one thing “makes” another happen: depressing a button on the outside of the chamber releases a lever, which makes the

platform drop suddenly, whereupon the apple, under the effect of the earth’s gravitational field, accelerates downward. There is a predictable sequence of events here, so that we commonly say one thing or event causes the next — or, at least, does so if the release mechanism isn’t corroded, an earthquake doesn’t upset the apparatus at a crucial moment, air hasn’t leaked into the system, there’s been no sublimation of gases from the materials inside the chamber, and so on. Clearly, the “causes” in our demonstration are not laws; they never make things happen with the kind of unvarying certainty we associate with physical law. In fact, a “cause” is nothing anyone has ever managed to define with any adequacy. It’s a rather vague, approximate, and anthropomorphic idea, derived from our own experience in “making things happen.” Statistician David Salsburg, author of the 2001 book The Lady Tasting Tea, states bluntly that “There is, in fact, no such thing as cause and effect. It is a popular chimera, a vague notion that will not withstand the batterings of pure reason.” [6] I can now clear up a certain ambiguity in my earlier discussion of the because of physical law, where I might have been taken to imply that gravity “causes” a ball to roll downhill. There are, in fact, various occasions when balls roll uphill, whether due to wind or ocean waves on the beach or some other factor. Gravity doesn’t make balls roll downhill, but rather accounts for certain invariant and lawful aspects of their motion, whatever that motion may be. If we want the because of physical law to retain the strict, syntactic precision I spoke of, then it should refer only to these invariant, lawful features. As for what Salsburg calls the “chimera” of causes, popularly conceived, there is no reason we cannot speak of them, if only roughly, in contexts that are more or less stable and closed. They are the basis for what we might refer to as the “cause-and-effect because,” or the “machine-like because,” for we try to make our machines (in their standard working contexts) into just such closed, causal systems. And we typically succeed well enough, until rust or a power glitch or the fist of a disaffected user or normal wear and tear brings an end to the desired causal regularity of the system. Presumably nothing ever goes wrong with the physical laws that were operative in the system, but any given causal relations can always be sabotaged by a contextual change. We can see, then, why physicists are more interested in lawfulness than in identifying causes. They know it is impossible to construct an absolutely closed system with absolutely reliable causes. Any local causal arrangement can be invalidated by a different context (the meteoric explosion), and therefore the arrangement doesn’t have the kind of perfectly predictable character that physical laws are often thought to have. The observed “causal” character is neither unqualified nor intrinsic to the given objects and processes in the way that physical laws seem intrinsic to material phenomena. It will be important to keep in mind these distinct aspects of the physical sciences: on the one hand, precise, invariant relationships — the fundamental laws — implicit in whatever happens; and, on the other hand, the much less precise, never absolute, never infallible notion of a cause, which is supposed to tell how one thing makes another happen, that is, how one event, or set of conditions, brings about another event or set of conditions. Many people, when they speak of the world’s “causal regularity,” are actually referring to its lawfulness. This conflation of law and cause — this illegitimate bestowal upon physical causes of the regularity, predictability, and certainty associated with physical laws, as if the causes had the same necessity as the laws — yields a great deal of mistaken thought. Among other things, it lends to any science guilty of it the illusion of vastly greater explanatory power than it in fact possesses. This helps us to understand why so many biologists see a determinate machine where there is in fact a living being; the physical lawfulness discoverable in the organism is unthinkingly equated in their minds with a collection of causal mechanisms. In sum: laws do not determine any event at all, but only tell us something about how it will happen: certain invariant relations will be respected. Causes, on the other hand, approximate and ill-defined though they be, can give us a contingent sense for what may reasonably be expected within a temporarily limited and more or less closed system. Curiously, physicists are much less likely to confuse law and cause than are biologists. I say “curiously” because at least the physicist can achieve, with machines, an approximation of reliable causes. The biologist, as we will now see, is denied even a reasonable approximation. Beings in Context All this gives us a further perspective on the animate-inanimate distinction. We have already seen that biology is distinguished from the physical sciences by the free use of

the because of reason. Now, looking from a slightly different angle, we can consider the issue in terms of law and cause. No biologist today will deny that fundamental physical laws continue to apply without exception to organisms. But what about causes? We have just now noted that, by means of carefully designed closed systems more or less immune to contextual interference, it is possible to say one thing “causes” another, with due caveats. Machines are such systems. But what happens when the biologist attempts to see the organism in the same mechanistic light, making a closed system of it? The effort fails miserably. For in biology a changing context does not interfere with some causal truth we are trying to see; contextual transformation is itself the truth we are after. Or, you could say: in the organism as a maker of meaning, interfering is the whole point. The ongoing construction and evolution of a context, with its continually modulated causal relationships, is what the biologist is trying to recognize and do justice to. Every creature lives by virtue of the dynamic, pattern-shifting play of a governing context, which extends into an open-ended environment. The organism gives expression, at every level of its being, to the unbounded because of reason, the tapestry of meaning, the form and character I referred to earlier. It can change its proximal goal from moment to moment, thereby also changing the contextual significance of the details of its life. Remember that, in a play of meaning, every new element, every new encounter, every new “word” that is expressed may shift the connotation or significance of every other element. The whole purpose of meaningful expression is to add something to what has already been said — to reshape an existing context in light of a further meaning; otherwise, no speaking, no gesturing, would be necessary. A coherently changing context is the very substance of meaning. When a deer is grazing in a meadow, its glimpse of a vaguely canine form in the distance changes the meaning of everything from the flowers and grass the deer was eating to its own internal digestive processes to the expression of its genes. This happens not because the distant form is exerting some strange physical force upon the deer, but because that form becomes part of a now suddenly shifted pattern of meaning. Or (to focus on the cellular level): when a cell enters into mitosis, just about every detail of its physiology and chemistry takes on an altered meaning in light of the changing context — and similarly when a cell experiences heat shock, oxygen deprivation, or other stress; when it comes into contact with new neighbors; or when it proceeds along a path of embryonic differentiation. The cellular environment, as an evolving context, is continually being reinterpreted and responded to — is itself a reinterpreting and responding. Because every local activity of the organism must find its meaningful place within the encompassing activity of a striving, developing, self-transforming whole, there can be no fixed syntax, no mechanical constancy of relations among the parts. Certainly you still can, without self-deception, consider yourself to be identifying causes in the organism. What you are doing is recognizing physical lawfulness in the current context. But it is a context that remains what it was only for a moment. The organism, regarded as a closed system relative to the causes under investigation — the only kind of system in which stable causes can even be defined — is forever abandoning its old state and entering a new one. Therefore no cause can reliably be assumed to remain the same cause over a period of time. When a larger, dynamic intention is reflected in the changing significance of each part, the organism as a whole governs the activities of its parts rather in the way the meaning of an unfolding text or play governs its parts. Against this backdrop, it’s worth taking a moment to listen to biologists puzzling over questions of cause and effect. To keep the following survey brief, we will focus narrowly on certain issues of gene regulation, especially in relation to the organization of the cell nucleus. All of these examples are from the last decade. (There is no need to worry about the technical details; the general sense of the remarks is all that matters here. One note, however: chromatin is the complex of DNA, protein, RNA, and other molecules that constitute chromosomes.) • Technological advances are ... revealing an unexpectedly extensive network of communication within and between chromosomes. A crucial unresolved issue is the extent to which this organization affects gene function, rather than just reflecting it. [7] • Together, these results further emphasize the role for RNA polymerase in shaping the chromatin landscape of the genome and point toward the difficulty in disentangling cause and effect in the relationship between chromatin and transcription. [8]

• A longstanding question is whether [cell] replication timing dictates the structure of chromatin or vice versa. Mounting evidence supports a model in which replication timing is both cause and consequence of chromatin structure by providing a means to inherit chromatin states that, in turn, regulate replication timing in the subsequent cell cycle. [9] • Despite the difficulties in proving cause and effect, these examples convincingly illustrate how chromatin crosstalk can functionally increase the adaptive plasticity of the cell exposed to the changing microenvironment. [10] • A related unresolved question is whether chromatin loops are the cause or the effect of transcriptional regulation.[11] • Which genes are the “cause” and which are the “consequence” of plastic development?[12] • Despite abundant evidence that most kinds of tumor cells carry so-called epigenetic changes, scientists haven’t yet worked out exactly whether such glitches are a cause or a consequence of disease.[13] • The clarification of the cause-and-effect relationship of nuclear organization and the function of the genome represents one of the most important future challenges. Further experiments are needed to determine whether the spatial organization of the nucleus is a consequence of genome organization, chromatin modifications, and DNA-based processes, or whether nuclear architecture is an important determinant of the function of the genome.[14] One would think that biologists might pause and consider the possibility that the kind of stable causal relationship they’ve been looking for simply isn’t there — the possibility that they’ve defined their task in misleading terms. Yet when researchers find, for example, that patterns of nuclear organization are implicated in cancer, an almost automatic exhortation follows: “However, it is crucial to determine the extent to which cancerassociated changes in nuclear organization are cause or effect.” [15] But is it crucial? Are the actual goings-on in the cell in fact proving so clear-cut? Why do we need causes as an addition to lawfulness and meaning? After all, we have no difficulty understanding all the relationships in a meaningful text, even though we cannot say that one part of the meaning causes another part. To Explain or Portray? The pursuit of causes in biology is something fierce. There is evidently a visceral feeling that without causal mechanisms we have no explanation, and without explanation, no understanding. It is a prejudice so deeply engrained, so resistant to removal, that it has badly distorted the entire field of biology. The billions of dollars poured into molecular research during these past several decades bespeak more than anything else a singleminded quest for causes — a quest that has, by many accounts, been severely frustrated. It may seem a mere curiosity that over two centuries ago Johann Wolfgang von Goethe, aware that precisely this single-minded desire for causes had already possessed many of his scientific contemporaries, took a stand against it. He declared of his own pioneering morphological research that “its intention is to portray rather than explain.” [16] A science whose central task is not to explain, but rather to fill out portraits? At a time when naturalists have become a nearly extinct species and geneticists have found an ideal habitat in front of instrument display panels, not many will be prepared to accept such a prescription for the researcher. And yet, Goethe’s stance was extraordinarily prescient. How, in fact, do we come to understand any context of meaning — a dance, a painting, a novel, a human life, the choreography of a developing embryo? Goethe noted the impossibility of capturing an “inner nature” — say, a person’s character — in any kind of direct causal or explanatory way. “But when we draw together his actions, his deeds, a picture of his character will emerge.” That is certainly how we try to understand each other — and we, too, are organisms. I daresay that, insofar as several decades of expensive cancer research have brought progress, it is not so much because this or that causal mechanism has been discovered (such mechanisms are announced by the dozens every month in scientific journals) as because all the false starts, dead ends, and mutually contradictory “mechanisms” have bit by bit been revealing (to those looking for it) a qualitative picture — a personality, so to speak — of the disease. Such knowledge is not impotent. If I familiarize myself with the distinctive way of being of a blue jay, I may not be able to predict exactly what it will do or project its flight as a Newtonian trajectory. But my knowledge is nevertheless real. I will, in appropriate circumstances, be able to say, “Yes, that is just like a blue jay,” or “No, that is not at all what one would expect of a blue jay in this situation. There is something wrong, or

something missing from the picture.” With such knowledge I can learn to interact meaningfully with the bird even though I cannot mechanistically predict its behavior. In developing a qualitative portrait, we aim less at exact prediction and control than at understanding and the potentials for working with nature.[17] The main question about a portrait is how full, how detailed, how multifaceted a picture we gain. The supposed causes, of course — when properly contextualized and shorn of their strict causal aura — help us to build this picture. There is neither any end to our picture-building, nor an inherent limit to how far we can carry it. And biologists surely are carrying it further, even when they think they are fingering explanatory causes. In other words, these remarks point more toward what is the (partly unrecognized) reality of biological research than toward some utterly new strategy. All the meanings we have seen in biological language are, after all, pervasive, testifying eloquently to the efforts to portray health and sickness within an overall organismal context of coordination, regulation, globally directed communication, and so on — this despite the simultaneous and contradictory appeal to causes neatly isolated from the whole. The Ultimate Cause, of course, was supposed to be the genomic sequence, or DNA. But Florida State University biologist David Houle and his colleagues remind us that, for the most part, phenotypes (observable traits — partial portraits, if you will) “continue to be the most powerful predictors of important biological outcomes, such as fitness, disease and mortality. Although analyses of genomic data have been successful at uncovering biological phenomena, they are — in most cases — supplementing rather than supplanting phenotypic information.”[18] And what is true of prediction applies just as well to causal analyses and treatment — a fact that’s easy to lose sight of amid all the wonders of modern molecular technologies and all the talk of treatable “causes.” The International HapMap Consortium (a successor to the Human Genome Project) summarizes the situation neatly in the lead sentence of a report in Nature: “Despite the ever-accelerating pace of biomedical research, the root causes of common human diseases remain largely unknown, preventative measures are generally inadequate, and available treatments are seldom curative.”[19] And William Bains, chief scientific officer at Amedis Pharmaceuticals in the United Kingdom, wrote upon the completion of the Human Genome Project: The chances that genome properties can be used to predict organismal ones is remote. Genomics and its daughter technologies are valuable instruments in the analysis of cells and tissues. They provide means of exploring biological processes and phenomena. However ... they will not often address most human needs.[20] Low-level analyses versus portrayal of the whole: it’s not an either-or matter. Because we’re dealing with meaning, the similarity to the understanding of texts is not accidental: analyses of individual words and their possibilities of meaning can be essential; without a knowledge of the words, we can hardly grasp the whole. But at the same time, it is only the meaning of the whole that gives the individual words their full and proper significance. This is the truth that has for so long been ignored within biology. Can We Explain the Form of Organisms? The challenge and opportunity of portrayal deserves concrete illustration. Consider the effort, common nowadays, to explain an organism’s form by referring to genetic switching networks. Developmental biologist Sean Carroll presents beautiful pictures of patterns in the early fly embryo — patterns that prefigure and map directly to the later arrangement of larval segments. Each element in a pattern corresponds to the distribution of certain molecules (made visible and colorful with special dyes), which in turn can be at least roughly correlated with the activity of a particular collection of genes. He suggests that a complex arrangement of genetic switches explains the molecular patterns and therefore also explains the eventual form of the organisms. [21] But we now know from the vast literature on gene regulation (oddly, Carroll does not even mention epigenetics in his book) that those supposed switching networks are in fact penetrated and influenced by virtually everything going on in the cell. By the time we get very far in tracing the relevant interactions through the organism, we realize that we’re witnessing, at the molecular level, the playing out of the very form, the patterns, that we hoped to explain, but at another level of description. [22] If we really did need explanatory mechanisms, then we’d still be left with a version of our original task: to explain what governs, controls, or regulates the complex, interacting molecular patterns that we find as such vivid, directed, perfectly shaped presentiments of the developing morphology.

Carroll repeatedly talks about how various genes “sculpt” a fly’s wings and various anatomical structures of other animals, adding that the action of these genes “in organizing, subdividing, and specifying and sculpting parts of the embryo becomes clear when visualized.” But it’s obvious enough that a section of a DNA molecule does not “sculpt” anything. In fact, the research emphasis today is in the reverse direction: how proteins and the overall activity of the cell sculpt the genes and chromosomes. Biologists speak of “DNA-sculpting proteins,” of histone modifications that “sculpt” chromatin (the substance of chromosomes), and of the sculpting of DNA into functional domains and loops. In general, studies on the three-dimensional organization of chromosomes in the nucleus are all the rage, and it is widely recognized that this organization reflects how the organism is making use of its genes. In trying to understand gene expression, biologists “are looking for answers” by studying how the chromosome “folds, moves, and communicates.”[23] As this last remark indicates, we’re not talking about a static sculpture. In a 2003 article in Nature entitled “Beyond the Double Helix,” Helen Pearson interviewed many geneticists in order to assemble the emerging picture of DNA. One research group, she reported, has shown the molecule “to gyrate like a demonic dancer.” Others point out how chromosomes “form fleeting liaisons with proteins, jiggle around impatiently, and shoot out exploratory arms.” Phrases such as “endless acrobatics,” “subcellular waltz,” and “twirls in time and space” are strewn through the article. “The word ‘static’ is disappearing from our vocabulary,” remarks Tom Misteli of the National Cancer Institute. [24] Countless extra-chromosomal factors contribute to this dynamic performance. The activity of individual genes reflects the choreography of chromosomes, which reflects the larger choreography of the nucleus, which reflects the choreography of the cell and organism as a whole. Who, then, is sculpting whom? It’s not that identifying a so-called gene “switch” — or calculating kinetic energies or measuring mechanical stresses on macromolecules — gives us no understanding. Of course such insights are important. But they become biological insights, as opposed to physical and chemical ones, only insofar as they find their place within the living, metamorphosing form of the organism. They do not explain the form. If anything, we should say that the form explains the physical interactions — in the sense that it gives us an understanding of their pattern, their shape, their direction and place within a functional whole, none of which can be deduced from physical transactions as such. We can observe the patterns by tracing the physical interactions, but what those patterns will turn out to be can never be arrived at merely by working out the implications of the physical laws and substances. This same scenario is playing out in other biological investigations. One of the most dramatic examples centers on the circadian rhythms that figure so prominently in human life. Biologists, of course, set out to identify the “clock mechanism” that was presumed to “control” these rhythms, and, yes, they found a rhythmical feedback loop involving genes and transcription factors in a certain area of the brain that seemed the perfect candidate. However, ongoing research has revealed distinct “clocks” in different mammalian organs and tissues, and indeed in every cell. These “clocks” are interwoven with each other and, it now seems, with virtually all aspects of the organism’s physiology — metabolism, reproduction, cell growth and differentiation, immune responses, central nervous system functions, and on and on. In each of these areas the quest for causes and master controllers leads to the usual perplexity about who’s doing what to whom. For example: “Although metabolism is thought to be primarily downstream of the cellular clock, numerous studies provide evidence that metabolic cycles can operate independently from or even influence circadian rhythms.”[25] At the molecular level, one research team remarks that the enzymatic function of a certain clock protein “may be controlled by changing cell energy levels, or conversely, could regulate them.” [26] In general, “It seems that connections between the circadian clock and most (if not all) physiological processes are bidirectional.”[27] What we’re gaining from all this research is a wonderful portrait of the organism as a rhythmical being — a being in time. Investigators have not found controlling mechanisms that single-handedly establish or govern the circadian rhythms of the organism, but rather are discovering how those rhythms come to expression at every level and in every precinct of the organism — perhaps more centrally here and more peripherally there, but altogether in a single, organism-wide harmony. There is no sensible way, as a scientist, to

speak of particular mechanisms that explain this harmony. Instead, every isolated “mechanism” is found to be a reflection of the harmony, and we thereby gain further, detailed understanding of how the organism functions as a being in time. Finally, if there was any place where biologists expected a causal explanation of the organism to emerge clearly, it was in the study of Caenorhabditis elegans, a onemillimeter-long, transparent roundworm whose private molecular and cellular affairs may have been more exhaustively exposed than those of any other organism. The adult hermaphrodite has exactly 959 cells, each precisely identified as to origin and type; for example, 302 cells belong to the nervous system. The developmental fate of every somatic cell, from egg to adult, had already been mapped out by 1980, but this mapping and the associated molecular studies did not produce the expected explanations. Sydney Brenner — who received a 2002 Nobel prize for his work on C. elegans — acknowledged that development “is not a neat, sequential process.... It’s everything going on at the same time.” Even regarding the carefully mapped cell lineages of this “simple” roundworm, “there is hardly a shorter way of giving a rule for what goes on than just describing what there is.” In other words, the only “rule” for the development of this worm is the developmental description of it. When critics suggested he had not really come to an understanding of the worm, but had “only” described it, Brenner responded, “I’m not sure that there necessarily is anything more to understand than what it is.” [28] While there is good reason to think that Brenner never took his own words with full seriousness — and biologists in general still have not gotten the message these many years later — Goethe would certainly have seen truth in Brenner’s remark. The difficulties of causal explanation encountered by the C. elegans researchers were not accidental. You can’t explain an organism of meaning, and you don’t need to. You need only allow it, like any meaningful text, to speak ever more vividly and clearly, in ever greater detail. The separate processes do not make tidy explanations because they are not really separate and are not just doing one thing; they are harmonizing with everything else that is going on in the organism. We gain understanding when we learn to recognize this harmony in every aspect of the organism. Various analyses can play a crucial role in bringing clarity to our understanding. But the full picture takes shape only when the analytical threads are woven back into the larger fabric of meaning. We have an increasing appreciation today of the importance of organismal context, and of the organism’s plasticity, and of its dynamism, and of the complexity of its interweaving processes, and of the causal ambiguity of our explanations. For a mindset fixated upon causal mechanisms, all these factors might be viewed as unwelcome complications — detours on the way toward real understanding. But do they really make our descriptions and explanations less revelatory of the organism than what we had before, when gene-mechanisms were supposed to provide a “blueprint” or “instruction set” for the organism as a whole? Shouldn’t we expect that the processes we cannot neatly tie down or capture in mechanisms are precisely what bring the organism alive for us? Fear of Vitalism The organism, we have seen, is continually expressing the because of reason. Possessed of a certain inwardness, it is a maker of meaning, a fact most immediately presented to us in our own lives as self-conscious beings, but further evident all the way down to the eloquent and concerted molecular interactions of every living cell. We recognize meaning in the vocalizations, body language, and gestures of animals; in the qualities that make the oak tree a recognizable presence, consistently expressing its own character, distinct from a willow tree; and in the active, directed striving for self-realization in all organisms — a striving that enables us to speak reasonably of their health and disease, wholeness and injury. And yet, in a baffling show of tolerance for contradiction within science, an entrenched metaphysical dogma assures us that the universe in which these creatures of meaning exist is a universe inherently without meaning, idea, or thought. The truth of the matter may simply be so close to us — so fundamental and so intimately a part of our nature as understanding beings — that we cannot readily step back and see it. I mean the truth that any understanding of the world, animate or inanimate, must be an understanding — which is to say, it requires a conceptual grasp of things. Whatever is incommensurable with thought and idea will never be contemplated in thought and idea, and therefore will never enter into science. The world we know will always and only be a world in whose inwardness we can participate inwardly — a world whose being can take

form as a content of consciousness. Without a truth of things that can at the same time be a truth of word and thought, we could have no scientific conversations or textbooks — no science at all. The physicist has not, as so often claimed, succeeded in presenting us with a world of pure objectivity or outwardness — a “disenchanted” or “disensouled” world. He has only tried to restrict the enchantment to the sphere of mathematics. But mathematical relations or concepts are still ideas, not things, and the universe is, if nothing else, startlingly enchanted by these ideas. The question “Who is the enchantress?” may be beyond our ken at this time, but this does not remove the facts that provoke the question. Oddly, physicists seem far ahead of biologists in their occasional and explicit openness to these facts. When an astrophysicist penned an essay in Nature entitled “The Mental Universe,” it produced hardly a murmur of surprise from his peers. [29] None of this is to abolish the qualitative distinction between the animate and inanimate worlds. To say that the world is an embodiment of meaning and idea is not to say that all things have the same meaning or that meaning manifests itself in the same way in all things. We saw above that coherently evolving contexts of meaning are the very language of the organic realm. Organisms cannot be fully elucidated in terms of the definitive lawfulness so satisfactory to the physicist — a lawfulness lending itself to the application of mathematics and other reduced “skeletons” of language. This is a great difference. If we live in a thought-soaked world — one that includes the amoeba as well as the stone, celestial fires as well as earth-bound winds, human beings as well as human-devised machines — then it is the task of the scientist to find the appropriate sort of language for bringing to light the phenomena of each different realm. But this entire discussion of ideas and meaning in the world brings us face to face with a haunting specter we need to exorcise once for all: the specter of vitalism. The accusation of vitalism seems inevitably to arise whenever someone points to the being of the organism as a maker of meaning. This is owing to a legacy of dualism that makes it almost impossible for people today to imagine idea, meaning, and thought as anything other than ghostly epiphenomena within human skulls. So the suggestion that ideas and meaning are “out there” in the world of cells and organisms immediately provokes the assumption that one is really talking about some special sort of physical causation rather than about a content of thought intrinsic to organic phenomena. That is, ideas and meanings are taken to imply a vital force or energy or substance somehow distinct from the forces, energies, and substances referenced in our formulations of physical law. Such an entity or power would indeed be a spectral addition to the world — an addition for which no one has ever managed to identify a physical basis. But ideas, meanings, and thoughts are not material things, and they are not forces. Nor need they be to have their place in the world. After all, when we discover ideal mathematical relationships “governing” phenomena, we do not worry about how mathematical concepts can knock billiard balls around. If we did, we would have made our equations into occult or vital causes. But instead we simply recognize that, whatever else we might say about them, physical processes exhibit a conceptual or thought-like character. And so, too: the meanings that give expression to the because of reason do not knock biomolecules around, but — like mathematical relations — are discovered in the patterns we see. The thought-relations we discover in the world, whether in the mathematical demonstrations of the physicist or the various living forms of the biologist, need to be genuinely and faithfully and reproducibly observed, but must not be turned into mystical forces. The scientist observes meanings at play in organisms, and necessarily appeals to them in biological explanation. Anyone who construes this appeal as conjuring unacceptable vital forces needs not only to torch almost the entire biological literature, reconstructing it upon some new and as yet unknown basis; he also puts himself in an untenable position regarding the human being. For at least some of what we do, we do because we consciously think and intend it. If invoking this because of reason — this play of meaning and idea — in the explanation of human behavior is to rely on vital forces, then virtually everyone (in daily life, if not within a cocoon of theory) is a vitalist. If, on the other hand, we grant meaning to the human being without trying to make this meaning an expression of vital forces, then we can hardly voice the charge of “vitalism” when we observe meaningful activity in less conscious forms — for example, in the activity of cells and lower organisms.

So, no, we don’t need vital forces. If the organism as an expression of meaning requires us to recognize a different sort of order from that of inanimate nature, science offers no presumption against this. Our knowledge of some thought-relations in the world — for example, those of mathematized physical law — does not tell us what other thoughtrelations we might discover in various domains. The mathematical order, however, does tell us that there must be other principles of order. For mathematics alone does not give us any things or phenomena at all; numbers are not things. Whatever the things may be to which our mathematical formulations refer, they either have a qualitative character that we can consciously apprehend in a conceptually ordered way, or they must remain unknown and outside our science. And that qualitative conceptual ordering cannot be predicted from the mathematics. Rather, the qualitative order is the fuller reality that determines whatever we abstract from it, including mathematical relationships. Who can tell us in advance what forms of order we may discover in this more-thannumerical world? If, in organisms, we observe principles of coordination through which physical laws are not only fully respected but also caught up in higher-order, integrated, harmonious, and self-assertive forms — well, then, that’s what we observe. The ideas expressed in that coordination and integration may be more saturated and resonant than the concepts of the physicist, but they are no more our arbitrary invention than is the mathematical harmony of planetary motions. We may not yet understand how the coordination comes about — how living beings bring such meaningful, ideal relations to manifestation in the world — but this is no obstacle to scientific acknowledgment of the observed relationships. After all, our ignorance about how gravity works or what energy or space or time or matter is does not prevent us from teasing out certain observable, lawful relationships. Disciplined observation should be our guide to the various sorts of order displayed in the world. And while observation shows us an uninterrupted continuity of physical law when an organism dies, it also reveals a striking discontinuity, marked by a loss of the overarching coordination and the governing meaning through which a living form had been sustained. The astonishing fact that scientists of life pay very little attention to the significance of this moment of transition in no way detracts from its significance. I do not at all wish to dismiss as unimportant the question so many will feel to be urgent: Who, after all, “speaks” or gives expression to the meaning we find so clearly displayed in an organism’s life? How are we to understand the substantive nature of the beings with whom we share the earth — if, indeed, “substantive nature” is the right phrase? But this is a large issue requiring separate treatment. Given the metaphysical commitments so thoroughly distorting biology today, the first task is to make it at least possible for such questions to be asked. Fortunately, this has required only that we look unflinchingly and without the usual prejudice at what biologists themselves have been discovering. Biology — More Fundamental than Physics? A final word about the relation between physics and biology. We have seen that, in the organism, the observed thought-relations have a much thicker texture of meaning than in the physical sciences. The mathematically stated laws toward which those sciences so often strive with at least some success represent thought stripped down to the purest abstraction — to a kind of bare syntax of quantity and logic — whereas the language we see spoken in the organism is much more like a contextualized natural language, semantically rich and qualitative. While there are real differences here, there are also matters of choice. Physicists have chosen to pull back from the actual phenomena they are confronted with, viewing them as far as possible through the lens of a language blind to those qualitative, phenomenal aspects of the world where we could expect to trace any sort of a meaningful because. The kind of world they describe reflects in part the restrictions they impose upon their looking. So it is that they aim to describe the world of light and color in terms of colorless “waves” and “particles,” or mere statistical non-representations — that is, in a way that makes as much (or as little) sense for someone without sight as for those with eyes to see; and they try to describe a world of sound that is indifferent to the presence of hearing ears. In general, they tell us what the world would be like if it were not like anything at all — certainly not like anything we can know through our senses, and therefore not like anything we can describe or even imagine. It is no wonder that, at its purest, physics tends to depart from the phenomenal world into abstract and statistical formulations,

while physicists enter into debates about the nature of reality that might make a medieval metaphysician blush. These choices of the physicist are certainly productive so far as our powers of manipulation are concerned. The single-minded focus on general laws we can recognize in the world enables us to assemble the parts of a machine so as to put those laws to work for us in effective “causal systems.” Indeed, the fact that science works in this sense is often taken to be its chief glory. Certainly it has transformed civilization and given us many things we would rather not do without. But an ability to manipulate things does not imply that we have exhausted the potentials for understanding what we are manipulating. Perhaps it is hardly a beginning. Just as you can drive a car without a clue about how the motor works, so, too, you can “know” how the motor works without a clue about the true nature of forces or energies or even laws. Those who would like not only to reengineer but also to understand the world have every right to ask: If the inorganic world readily accessible to our perception and theorizing is a world partly characterizable (unlike the living aspects of the organism) by ideas reduced toward a kind of grammar, what is the fuller “speech” implied by the presence of this grammar — the speech of qualitative phenomena from which alone such a grammar could be abstracted? What would we find if we looked where the physicist disdains to look — if we attempted to penetrate physical phenomena with a profound qualitative awareness of the sort that Galileo had already foresworn and the biologist cannot avoid? To suggest that the world may be a bearer of meaning far beyond what the physicist is currently willing to investigate is not to contend that a rock can be placed on the same scale as an amoeba. It is only to point to the profound darkness of substance itself, in both rock and amoeba, and to ask what quickening mystery may be hidden within it, capable of producing the brilliant kaleidoscope of perceptible qualities we call “the world” — and, indeed, capable of producing living things. This hidden potential of the world’s substance must be at least as great as the things it brings to realization. Alluding to the void left by the physicist’s withdrawal from phenomena into mathematical law, Stephen Hawking once asked: “What is it that breathes fire into the equations and makes a universe for them to describe? The usual approach of science ... cannot answer.”[30] Whatever life it is that breathes fire into the equations of the physicist, it has retreated far enough behind the physical phenomena, as we routinely perceive and theorize about them, to leave us substantially in darkness. My own suggestion, unsupported here, is that we will have to gain a qualitative science and penetrate much more deeply into the mystery of the physical world before we will be able to see how mathematically reduced physical laws are the mere syntactic skeletons remaining after we have abstracted away the much more richly expressive meaning profoundly present in all phenomena. Surely our immediate experience of oceans and stars, mountains and rivers says nothing to discourage such a thought. The aesthetic and even moral character of this experience bespeaks a significance no less real for all our concerted ignoring of it as scientists. The depths of physical reality are, of course, as hidden from us in the living organism as they are in the rest of the physical world. But in the organism we encounter something further: reason and meaning come to much more “visible” and insistent manifestation, narrating the stories of living beings — stories that, evoking as they do the intentional and meaningful patterns of our own lives, are more accessible to us than whatever speaks to us now through the qualities of inorganic substance. It is ironic that the organism has been regarded as a more difficult challenge for science than the world of physics. The truth is that the organism is much closer to us — we are, after all, organisms ourselves — and it offers many informed, articulate responses to our inquiries. We can apprehend it with a richness and depth of comprehension far exceeding the admirable mathematical comprehension of the physicist. If the world is indeed intelligible — if it speaks meaningfully, as must be assumed by every scientist who tries to capture that meaning in revelatory words and ideas — then the place where we find it speaking most fully and explicitly is presumably the place where we will find its fundamental truths most fully declared. And that is in the living organism. The “difficulty” of the organism is really just the difficulty of reducing it to mere physics and chemistry. Yes, very difficult indeed — but that’s because the organism is alive, as we are alive, and because every biologist instinctively understands this life as offering more than lessons in physics and chemistry. As for the “nonliving” world: we imagine it is

simpler to understand only because we are bewitched by the precision and predictability of the physical laws we find implicit in things — things of whose nature we know almost nothing. Notes [1]Zenon W. Pylyshyn,  Computation and Cognition: Toward a Foundation for Cognitive Science (Cambridge, MA: MIT Press, 1984), xii. [2]Owen Barfield,  Poetic Diction: A Study in Meaning (1928; repr., Middletown, CT: Wesleyan University Press, 1973), 185ff. [3]Richard C. Lewontin, “The Corpse in the Elevator,”  New York Review of Books 29 (January 1983), 34-7. [4]Craig Holdrege, “What Does It Mean To Be a Sloth?”  NetFuture 97 (November 1999). [5]Kurt Goldstein,  The Organism (1934; repr. and trans., New York: Zone Books: 1995). [6]David Salsburg,  The Lady Tasting Tea: How Statistics Revolutionized Science in the Twentieth Century (New York: Henry Holt, 2001). [7]Peter Fraser and Wendy Bickmore, “Nuclear Organization of the Genome and the Potential for Gene Regulation,”  Nature 447 (May 2007): 413-7. [8]Assaf Weiner, Amanda Hughes, Moran Yassour,  et al., “High-Resolution Nucleosome Mapping Reveals Transcription-Dependent Promoter Packaging,” Genome Research 20, no. 1 (2010): 90-100. [9]David M. Gilbert, “Replication Timing and Transcriptional Control: Beyond Cause and Effect,”  Current Opinion in Cell Biology 14, no. 3 (2002): 377-83. [10]Anita Göndör and Rolf Ohlsson, “Chromosome Crosstalk in Three Dimensions,”  Nature 461 (September 2009): 212-7. [11]Wulan Deng and Gerd A. Blobel, “Do Chromatin Loops Provide Epigenetic Gene Expression States?,”  Current Opinion in Genetics and Development 20, no. 5 (2010): 548-54. [12]  Nadia Aubin-Horth and Susan C. P. Renn, “Genomic Reaction Norms: Using Integrative Biology to Understand Molecular Mechanisms of Phenotypic Plasticity,” Molecular Biology 18, no. 18 (2009): 3763-80. [13]Jocelyn Kaiser, “Genes Link Epigenetics and Cancer,”  Science 330, no. 6004 (2010): 577. [14]  Robert Schneider and Rudolf Grosschedl, “Dynamics and Interplay of Nuclear Architecture, Genome Organization, and Gene Expression,” Genes and Development 21, no. 23 (2007): 3027-43. [15]Sayyed K. Zaidi, Daniel W. Young, Amjad Javed,  et al., “Nuclear Microenvironments in Biological Control and Cancer,” Nature Reviews Cancer 7, no. 6 (2007): 454-63. [16]Johann Wolfgang von Goethe,  The Collected Works, vol. 12, Scientific Studies, ed. Douglas Miller (Princeton: Princeton University Press, 1995). [17]See, for example, Steve Talbott, “To Explain or Portray?,”  In Context 9 (Spring 2003): 20-4 and “A Conversation with Nature,” The New Atlantis 3 (Fall 2003). [18]David Houle, Diddahally R. Govindaraju, and Stig Omholt, “Phenomics: The Next Challenge,”  Nature Reviews Genetics 11 (December 2010): 855-66. [19]International HapMap Consortium “A Haplotype Map of the Human Genome,”  Nature 437 (October 2005): 1299-1318. [20]William Bains, “The Parts List of Life,”  Nature Biotechnology 19 (2001): 401-402. [21]Sean B. Carroll,  Endless Forms Most Beautiful: The New Science of Evo Devo (New York: W. W. Norton, 2005). [22]See, for example, Steve Talbott, “Can the New Science of Evo-Devo Explain the Form of Organisms?,”  NetFuture 171 (December 2007). [23]Monya Baker, “Genomes in Three Dimensions,”  Nature 470, no. 7333 (2011): 28994. [24]Helen Pearson, “DNA: Beyond the Double Helix,”  Nature 421 (January 2003): 310312. [25]Vivek Kumar and Joseph S. Takahashi, “PARP around the Clock,”  Cell 142, no. 6 (2010): 841-3. [26]Masao Doi, Jun Hirayama, and Paolo Sassone-Corsi, “Circadian Regulator CLOCK Is a Histone Acetyltransferase,”  Cell 125, no. 3 (2006): 497-508. [27]Xiaoyong Yang, “A Wheel of Time: The Circadian Clock, Nuclear Receptors, and Physiology,”  Genes and Development vol. 24, no. 8 (2010): 741-7.

[28]Roger Lewin, “Why is Development So Illogical?”  Science 224, no. 4655 (1984): 1327-9. [29]Richard Conn Henry, “The Mental Universe,”  Nature 436 (July 2005): 29. [30]Stephen Hawking,  A Brief History of Time (New York: Bantam, 1998), 190. Evolution and the Illusion of Randomness Most biologists, I suspect, will happily own up to the fact that they think of the organism as engaged in strikingly directed and meaningful activity. The lion stalking the gazelle, the bird building a nest, the larva spinning a cocoon, the rose flowering, the cell dividing and differentiating, the organism maintaining its own way of being amid the perturbations of its environment — they all reflect a kind of intentional pursuit we would never attribute to dust, rocks, ocean waves, or clouds. Biologists, that is, will acknowledge that, at molecular and higher levels, they see almost nothing but an effective employment of a thousand interwoven means to achieve a thousand interwoven ends — all in an almost incomprehensibly organized, coordinated, and integrated fashion expressing the striving of the organism as a whole. The organism, they will say, as it develops from embryo to adult — as it socializes, eats, plays, fights, heals its wounds, communicates, and reproduces — is the most concertedly purposeful entity we could possibly imagine. It does not merely exist in accord with the laws of physics and chemistry; rather, it is telling the meaningful story of its own life. And then they will take it all back. In other words, the routine language of biological description, highlighted in the earlier parts of this series, is fully accepted, only to be effectively disowned. The explanation for this remarkable intellectual flexibility lies in a widespread view that runs as follows. Evolution produces organisms that we cannot help describing as purposeful and meaningful agents. That is because natural selection tends to select organisms that are fit — well-adapted to their environments and “designed” for surviving and reproducing. When organisms have features that are adapted for something, we naturally see these features as meaningful and purposeful. And an organism compounded of such features seems to be an agent with a goal of some sort; if nothing else, it seems to act intentionally in order to survive and reproduce. This agency, however, is said to be more a matter of appearance than of fundamental reality. While meaning and purpose may (somehow) “emerge” during the course of evolution, they emerge from processes that, at the most basic level of explanation and understanding, know nothing of them. Certainly — as the rather strange conviction runs — meaning and purpose play no role in the evolutionary “mechanisms” that have so expertly given rise to them. Perhaps the brashest and most publicly effective advertisements for this entrenched view have arisen from Richard Dawkins and Daniel Dennett. Dawkins is a biologist and awardwinning popularizer of conventional evolutionary thought, having produced such bestsellers as The Selfish Gene (1976) and The Blind Watchmaker (1986). Dennett, philosopher and deconstructor of consciousness, wrote about evolution in his widely influential book, Darwin’s Dangerous Idea: Evolution and the Meanings of Life (1995). The two authors immensely admire each other’s work. Dennett, in one of his characteristic remarks, assures us that “through the microscope of molecular biology, we get to witness the birth of agency, in the first macromolecules that have enough complexity to ‘do things.’ ... There is something alien and vaguely repellent about the quasi-agency we discover at this level — all that purposive hustle and bustle, and yet there’s nobody home.” Then, after describing a marvelous bit of highly organized and seemingly meaningful biological activity, he concludes: Love it or hate it, phenomena like this exhibit the heart of the power of the Darwinian idea. An impersonal, unreflective, robotic, mindless little scrap of molecular machinery is the ultimate basis of all the agency, and hence meaning, and hence consciousness, in the universe.[1] Or, we can listen to Dawkins: “Wherever in nature there is a sufficiently powerful illusion of good design for some purpose, natural selection is the only known mechanism that can account for it.”[2] And: “Natural selection, the blind, unconscious, automatic process which Darwin discovered, and which we now know is the explanation for the existence and apparently purposeful form of all life, has no purpose in mind. It has no mind and no mind’s eye. It does not plan for the future. It has no vision, no foresight, no sight at all.” [3]

The general idea, then, looks something like this: • The true nature of things is evident only at the bottom, and so we must understand life from the bottom up. • What we find at the bottom are scraps of molecular machinery. • Through the power of natural selection — which operates like a mindlessly mechanistic algorithm (Dennett) or a blind, unconscious automatism (Dawkins) — these low-level molecular machines slowly evolve into the kind of apparently purposeful, complex entities we recognize as organisms, including ourselves. • Whatever we are to make of this appearance of meaning and purpose — including my own intentions as I write this and yours as you read it — we are both urged to shed our prejudices and acknowledge that we with our intentions somehow arise from more basic, underlying processes that are essentially dumb, meaningless, and mindless. Of course, questions come to mind. Is the universe so schizoid or compartmentalized that any truth we observe at the “bottom” (whatever that means) must be proclaimed real, while the truth at other levels is unreal and illusory? This would be a particularly odd position to take in biology, where characteristic explanation runs from higher-level context to lower-level part (as we saw in the previous installments “The Unbearable Wholeness of Beings” [Fall 2010] and “What Do Organisms Mean?” [Winter 2011]). And if we really did find the root essence of things only at the bottom, then where would we locate Dennett’s presumed scraps of mindless machinery amid the extraordinarily nonmachine-like (and indeed scarcely material) quantum weirdness that has so preoccupied physicists for the past century? Physicists are the last people in the world with reason to claim mechanistic behavior at the bottom — and, in fact, some among them have long been driven by their own subject matter to reflect upon the mindful universe.[4] As for the organism: are its apparently meaningful strivings meaningful or not? If they are not — if, for example, the appearance of purpose is an “illusion,” as Dawkins puts it — then what is the difference between merely illusory purpose and the real thing? Perhaps he will say that there is only illusion. But then, if there is nothing for the illusion to be a convincing illusion of, it hardly makes sense to say it is an illusion at all, as opposed to being just what it seems to be. On the other hand, if Dawkins admits that meaning and purpose actually exist as realities and are therefore available to be mimicked in an illusory way, what grounds does he have for claiming meaninglessness and purposelessness as fundamental to the world’s character? Letting the Reality of the Organism Speak But while questions such as these do point to an extraordinary slipperiness in the remarks of Dawkins and Dennett, I do not intend to pursue the endless argument to which they would doubtless lead. There is a more fruitful way to assess the claims of mindless mechanism and illusion, and that is simply by comparing them to living creatures, especially at the molecular level that so impresses these writers as being both fundamental and rooted in meaninglessness. Dennett’s contention that through the microscope we “witness the birth of agency, in the first macromolecules that have enough complexity to ‘do things’” is itself an illusion. Neither he nor anyone else has ever witnessed the birth of such agency through a microscope or any other instrument — a fact that many decades of unrestrained speculation about the creation of life some billions of years ago does nothing to change. What we see through the microscope is what we see with our unaided eyes: life comes from life. Living cells, with all their displays of agency, come from other living cells. Open any journal of any sub-sub-subdiscipline of biology, and you will immediately be overwhelmed by suggestions of agency even at the lowest levels. Molecules, we are told to a fault, are bent on regulating, signaling, stimulating, responding, controlling, assisting, suppressing, healing, repairing, sensing, coordinating — and all in a way that can be understood only contextually. There is nothing at any level of observation, whether above or below macromolecules, that is not caught up in the meaningful life of the organism as a whole. Living agency is, if anything, even more vivid when we shift our attention to evolution and consider what passes from one generation to the next — for example, through “simple” cell division and mitosis (processes of almost unfathomable complexity) or through the even more elaborately orchestrated fugue we know as meiosis in sexual reproduction. In the latter case, everything comes to an intense focus in the sublime performance that one pair of authors describes as “Chromosome Choreography: The Meiotic Ballet.” [5] Nowhere does the cell seem more intent on moving toward a definite end than in the

intricately coordinated steps of this ballet. And so a path is prepared from one generation to the next. Life engenders life. This unbroken thread of life explains why we encounter the language of meaning and purpose that the biologist breathes into every description of every organism. Everything characteristic of the organism, from its behavior as a whole down through the performance of its various organs all the way to the micro-world of interwoven molecular processes in the cell — that is, everything distinctively biological as opposed to merely physical and chemical — can only be described, and always is described, in a language of coordinated processes, governing norms, and means brought into the service of ends. We are never talking merely about physical and chemical interactions, but rather about processes continually shifting, transforming, and adjusting themselves in relation to their context in order to go somewhere, if only to hold themselves within reasonable distance of some particular state (as when warm-blooded creatures maintain their internal temperature within a certain range). And this kind of going or maintaining ceases upon death, when everything takes on an entirely different, non-living character. Such, then, is the living reality that Dawkins refers to as the “appearance of design” or the “illusion of design and planning.” [6] It is also what Dennett has in mind when he writes, “All the Design in the universe can be explained as the product of a process that is ultimately bereft of intelligence, in other words an algorithmic process that weds randomness and selection to produce ... all the intelligence that exists.” [7] (Dawkins and Dennett sometimes seem fixated upon design, presumably as a result of their severely constraining preoccupation with religion and with the “creationism” or “intelligent design” promulgated by some religious folks. Although the word has its legitimate uses, you will not find me speaking of design, simply because — as I’ve made abundantly clear in previous articles — organisms cannot be understood as having been designed, machine-like, whether by an engineer-God or a Blind Watchmaker elevated to god-like status. If organisms participate in a higher life, it is a participation that works from within — at a deep level the ancients recognized as that of the logos informing all things. It is a sharing of the springs of life and being, not a mere receptivity to some sort of external mechanical tinkering modeled anthropocentrically on human engineering.) Dawkins and Dennett’s stance is bizarre — above all, because everything in the drama of evolution presupposes the meaning-soaked activity of the organisms whose meaning is said to be explained away. The organism reproduces itself by bringing all its choreographic powers of organization, coordination, and integration to bear upon the reproductive process; only so do we have a passage from one generation to another. And only so does natural selection (which itself involves nothing other than a living, intensely directed engagement of organisms with each other in an environment partly of their own making) gain material to work on. Where, then, do we find dumb, lifeless mechanisms blindly engendering new life forms? Where do we see anything other than the elaborate, interwoven, overwhelmingly meaningful activity of living beings, playing out at every level, from the molecular to the ecological? Chance to the Rescue? One answer will occur immediately to anyone properly educated in conventional evolutionary theory: random mutation — the arbitrary change of an organism’s genomic sequence — is what most obviously happens blindly. This is the sort of change that used to be routinely evoked by mentioning the mutagenic effects of cosmic rays — the impacts of “blind chance” that are supposed to provide the raw material for natural selection to act upon. (In addition to natural selection, I could speak of other processes often considered to be “forces” of evolution — migration, physical constraints upon development, genetic drift, assortative mating, and so on — but none of this would alter the course of my argument. As for “mutation,” it will become evident that I use the term broadly to include recombination and other sorts of genetic change. I should also mention that this essay focuses upon more complex organisms, often citing work on mammals and humans. There are other stories, equally dramatic, to be told at the lower end of the scale of complexity.) Of course, every creature spends a lifetime encountering unpredictable impacts from its environment. No one would say in general that such encounters, even if they were truly “random” in some sense, overcome the coherent, insistent, and distinctive life of the organism; rather, they are occasions for expressing that life. Engagement with the never fully predictable larger environment is what life is about, and it always happens in a way

that is influenced, not only by the environment, but also by the preferred way of being of the organism. A great deal hinges upon how the organism takes up the things it encounters. Randomness in environmental encounters (if the idea makes any sense at all) does not imply randomness in the organism. This applies as much to cosmic-ray encounters as to buffetings by the wind or attacks by predators. All we can possibly mean by “random occurrences” relative to an organism is “occurrences that have not yet been woven into the meaningful life story of the organism.” And even before any such weaving takes place, the idea that an event is “random” only perplexes our understanding. We are immersed in — we participate moment by moment in — a world that is ordered and full of meaning, and it is hard to see how we can detach ourselves so fully from our context as to encounter something wholly “out of context.” As for genetic mutations specifically, the crucial point was already made by Oxford University biophysicist Norman D. Cook in 1977: “Biological intervention through enzymes and enzyme systems is the principal mechanism of in vivo mutation.” Biologists commonly interpret such mutations as random errors in vital processes such as DNA replication, but “if ... changes in the genetic material are indeed mediated by other cellular molecules, then the idea of ‘randomness’ lacks all but the most trivial descriptive meaning, referring only to our knowledge of the mutation event.” [8] Furthermore, as British radiologist B. A. Bridges pointed out: even studies of radiation-induced mutation in bacteria have shown that cellular repair systems are “necessary for nearly all of the mutagenic effect of ultraviolet and around 90 percent of that of ionizing radiation.” [9] That is, outcomes depend at least in part on what the organism does with the influences impinging upon it. You might think that radiation mostly causes very local alterations in DNA, corresponding to the immediate location of damage. Yet the great majority of radiation-induced mutations involve large regions of DNA, often encompassing more than an entire gene spanning thousands of nucleotide base pairs, or letters, of the genetic sequence.[10] The organism making such changes is apparently prepared to respond as best it can and in its own way when it engages these potentially harmful elements of its environment. Despite the fact that early work on ionizing radiation “provided the genetic basis for” modern evolutionary theory and quickly became “a theoretical cure-all for the difficult problem of genetic diversity” (Cook’s phrases), this particular cause of mutation hardly figures centrally in the broad literature on genetic change today. There are simply too many other relevant processes going on — and none of them looks like the cosmic-ray activity whose misconstrual as a kind of archetype of randomness was so vital to the formulation of evolutionary theory. In fact, we are no longer free to imagine that evolution waits around for “accidents” to knock genes askew so as to provide new material for natural selection to work on. The genome of every organism is actively and insistently remodeled as an expression of its context. Genetic sequences get rewritten, reshuffled, duplicated, turned backward, “invented” from scratch, and otherwise revised in a way that prominently advertises the organism’s accomplished skill in matters of genomic change. The illustrations of this skill are so extensive in the contemporary literature that there is no way to review it adequately here. (For some examples, see the supplement “Natural Genome Engineering” [below], which contains the bulk of the evidence for my contentions here.) And regardless of the source of mutation, or genetic change, one cannot ignore the explosively growing literature on how genes actually function within gene regulation networks. A mutation is subject not only to elaborate processes that repair, modify, or ignore the mutation, but also to regulatory networks that respond to the mutated gene according to the logic of the larger need. You will recall from a previous article how an organic context can retain a certain stable character in the face of relatively wide-ranging variations or disturbances in its lower-level constituent processes. Molecular biologists have discovered in studies with a number of organisms, including mice, that “knocking out” (disabling or mutating) both copies of a gene with important functions can in many circumstances leave the organism seemingly unimpaired and functioning normally. [11] But even leaving aside all the contextually coherent revision and all the meaning-making that bends the apparently random to the organism’s own purposes, we find that strictly low-level analyses show mutations to be nonrandom. The point isn’t disputed by anyone, and current research aimed at elucidating all the factors conducive to genomic change is steadily expanding our field of view, with huge implications for evolutionary theory. This

leaves but one last refuge for those who would persuade us that the mutational element of evolutionary change is blind, lifeless, and meaningless. Their argument runs this way: Mutations are commonly said to occur “randomly.” However ... mutations do not occur at random with respect to genomic location and gender, nor do all types of mutations occur with equal frequency. So, what aspect of mutation is random? Mutations are claimed to be random in respect to their effect on the fitness of the organism carrying them. That is, any given mutation is expected to occur with the same frequency under conditions in which this mutation confers an advantage on the organism carrying it, as under conditions in which this mutation confers no advantage or is deleterious. [12] Or as Douglas Futuyma, distinguished professor of ecology and evolution at the State University of New York at Stony Brook, once put it: “Mutation is random in [the sense] that the chance that a specific mutation will occur is not affected by how useful that mutation would be.”[13] So not even mutations, it turns out, are really random. There is only one crucial respect in which we need to declare them random if we would reduce to an illusion the meaningful coherence of all the rest of life: they are (in the special sense just given) random with respect to their effects upon fitness, and therefore in their evolutionary role. So runs the prevailing belief. Is there any excuse for the huge burden of meaninglessness attached to the slender thread of presumed chance epitomized in cosmic rays — or is this sense of meaninglessness merely an illusory spell woven by evolutionary biologists? More particularly, does the concept of randomness gain clarity when we set it, as we are advised to do, beside that of fitness? We will see. Can We Track Fitness? Fitness is usually taken to comprise all those traits affecting the organism’s ability to survive and produce viable offspring in its particular environment. But immediately we run into difficulties. In the 1970s, journalist Tom Bethell illustrated a small part of the problem this way: A mutation that enables a wolf to run faster than the pack only enables the wolf to survive better if it does, in fact, survive better. But such a mutation could also result in the wolf outrunning the pack a couple of times and getting first crack at the food, then abruptly dropping dead of a heart attack, because the extra power in its legs placed an extra strain on its heart.[14] Or perhaps, by outrunning its pack, the wolf would be more subject to the dangers of hoof or horn from a threatened animal — an animal that for a moment need not worry about more than one wolf. But this is hardly to begin a recital of the difficulties in assessing the fitness of any particular change. In a now-classic article, Harvard geneticist and evolutionary theorist Richard Lewontin once illustrated the near-impossibility of making judgments about fitness: A zebra having longer leg bones that enable it to run faster than other zebras will leave more offspring only if escape from predators is really the problem to be solved, if a slightly greater speed will really decrease the chance of being taken and if longer leg bones do not interfere with some other limiting physiological process. Lions may prey chiefly on old or injured zebras likely in any case to die soon, and it is not even clear that it is speed that limits the ability of lions to catch zebras. Greater speed may cost the zebra something in feeding efficiency, and if food rather than predation is limiting, a net selective disadvantage might result from solving the wrong problem. Finally, a longer bone might break more easily, or require greater developmental resources and metabolic energy to produce and maintain, or change the efficiency of the contraction of the attached muscles.[15] Lewontin was not the only central figure in evolutionary biology who long ago recognized the difficulty of assessing the fitness, or adaptive value, of traits. In 1953, the paleontologist George Gaylord Simpson opined that “the fallibility of personal judgment as to the adaptive value of particular characters, most especially when these occur in animals quite unlike any now living, is notorious.” [16] And in 1975, the geneticist Theodosius Dobzhansky wrote that no biologist “can judge reliably which ‘characters’ are useful, neutral, or harmful in a given species.”[17] One evident reason for this pessimism is that we cannot isolate traits — or the mutations producing them — as if they were independent causal elements. Organism-environment relations present us with so much complexity, so many possible parameters to track, that, apart from obviously disabling cases, there is no way to pronounce on the

significance of a mutation for an organism, let alone for a population or for the future of the species. To pose just one question within the sea of unknowns: even if a mutation could in one way or another be deemed harmful to the organism in its current environment, what if the organism used this element of disharmony as a spur either to reshape its environment or to alter its own behavior, thereby creating a distinctive and advantageous niche for itself and others of its kind? To see the frailty of the fitness concept most clearly, look at actual attempts to explain why a given trait renders an animal more (or less) fit in its environment. For example, many biologists have commented on the giraffe’s long neck. A prominent theory, from Darwin on, has been that, in times of drought, a longer neck enabled the giraffe to browse nearer the tops of trees, beyond the reach of other animals. So any heritable changes leading to a longer neck were favored by natural selection, rendering the animal more fit and better able to survive during drought. It sounds eminently reasonable, as such stories usually do. Problems arise only when we try to find evidence favoring this hypothesis over others. My colleague Craig Holdrege has summarized what he and others have found, including this: First, taller, longer-necked giraffes, being also heavier than their shorter ancestors, require more food, which counters the advantage of height. Second, the many browsing and grazing antelope species did not go extinct during droughts, “so even without growing taller the giraffe ancestor could have competed on even terms for those lower leaves.” Third, male giraffes are up to a meter taller than females. If the males would be disadvantaged by an inability to reach higher branches of the trees, why are not the females and young disadvantaged? Fourth, it turns out that females often feed “at belly height or below.” And in well-studied populations of east Africa, giraffes often feed at or below shoulder level during the dry season, while the rainy season sees them feeding from the higher branches — a seasonal pattern the exact opposite of the one suggested by the above hypothesis.[18] Another problem with the usual sort of fitness theorizing becomes evident when you consider the unity of the organism and the multifunctionality of its parts. Holdrege remarks of the elephant that it “stands sometimes on its back legs and extends its trunk to reach high limbs — but no one thinks that the elephant developed its trunk as a result of selection pressures to reach higher food.” The trunk develops within a complex, multifaceted, interwoven unity. It “belongs” to that unity, not to a single isolated function. The effort to analyze out of this unity a particular trait and assign it a separate causal fitness is always artificial. This is certainly true of the giraffe, whose long neck not only allows feeding from high branches, but also raises the head to where the animal has the protection of a large field of view (the giraffe’s vision is much more developed than its sense of smell), serves as an “arm” for the use of the head as a “club” in battles between males, and plays a vital role as a kind of pendulum enabling the animal’s graceful galloping movement across the African plain. The unworkability of the fitness concept has been widely acknowledged. Here is a summary statement of some of the problems: • The effect of any given mutation depends on the genetic background — the overall genetic constitution, or genotype — of the organism. So what a given mutation means will change as all the rest of the genome goes through its changes. How, then, do we establish the value of any particular mutation — and, absent any such ability, how do we make a claim of randomness? • The fitness value of any given genetic feature or combination of features can also vary with different environments. Further, “the developmental responses of different genotypes to varying environments are non-linear.... No genotype gives a phenotype unconditionally larger, smaller, faster, slower, more or less different than another.” [19] • The fitness of a trait can, in many ways, depend on its frequency in a population. For example, predators may tend to concentrate on the more common specimens of prey while ignoring the more unusual ones, thereby giving the latter an advantage. How the resulting selection works in this sort of case “is affected by prey density, palatability, coloration and conspicuousness,” and when the prey density is very high, the effect may be reversed, with predators preferentially removing rare prey. [20] Moreover, “most selective processes are frequency-dependent,” notes Lewontin. As a result, the usual practice of measuring the reproductive success of organisms with particular genotypes in particular environments tells us little, if anything; but “on the other hand, it is hopeless to

measure the net fitnesses of many genotypes in an immense array of different frequency combinations.”[21] • By all accounts, reductions in fitness can occur at various points along an evolutionary lineage — and can be essential turns in the pathway toward eventual “higher fitness.” How, then, do we evaluate supposedly harmful mutations at the time we observe them, without knowing the further trajectory of the lineage? • Perhaps most fundamentally, organisms and environments are at every moment reciprocally influencing each other. Organisms change their environment, and at the same time this changing environment affects the fitness of the organism’s traits. When beavers dam a stream, they change their environment greatly, and at the same time the deeper, quieter water differs from swift-flowing water in the significance it gives to the beavers’ swimming capacities, to their relations with predators, and so on. So the trait we are trying to assess in terms of its fitness in the existing environment is being given a different significance by an environment that is itself being altered by the trait. Where do we begin our analysis? In Lewontin’s summary: “What is required is an experimental program of unpacking ‘fitness.’ This involves determining experimentally how different genotypes juxtapose different aspects of the external world, how they alter that world and how those different environments that they construct affect their own biological processes and the biological processes of others.”[22] I doubt whether anyone has even pretended to do this unpacking in a way adequate to demonstrate the randomness of mutations relative to fitness. Fitness — An Irretrievably Obscure Concept If reduced fitness can be on the path toward higher fitness, and if the environment for which the organism is supposed to be fit is itself a modifier of the organism’s fitness, then to what solid and stable ground do we anchor our idea of fitness? If asked for a definition of “fitness,” most biologists, especially those who are not philosophically inclined, would probably answer with Carmen Sapienza, a professor at Temple University’s Fels Institute for Cancer Research and Molecular Biology: “At bottom line, fitness is simply the number of offspring provided to the next generation.” [23] And on that conviction there hangs a tale. Along with his anecdote about the wolf, Bethell argued that evolutionary theory based on natural selection (survival of the fittest) is vacuous: it states that, first, evolution can be explained by the fact that, on the whole, only the fitter organisms survive and achieve reproductive success; and second, what makes an organism fit is the fact that it survives and successfully reproduces. This is the long-running and much-debated claim that natural selection, as an explanation of the evolutionary origin of species, is tautological — it cannot be falsified because it attempts no real explanation. It tells us: the kinds of organisms that survive and reproduce are the kinds of organisms that survive and reproduce. It happens that Bethell was savaged by Stephen Jay Gould in 1976 for making this claim. Gould pointed out that Darwin and his successors hypothesized independent conditions — “engineering criteria,” as biologists like to say — for the assessment of fitness. [24] These conditions may facilitate and explain reproductive success, but do not merely equate to it. In other words, the concept of fitness need not rely only on the concept of survival (or reproductive success). However, the appeal to engineering criteria in the abstract does not by itself get us very far. As philosopher Ronald Brady reminded us when discussing this dispute in an essay entitled “Dogma and Doubt,” what matters for judging a proposed scientific explanation is not only the specification of non-tautological criteria for testing it, but also our ability to apply the test meaningfully. [25] If we have no practical way to sum up and assess the fitness or adaptive value of the traits of an organism apart from measurements of survival rates (evolutionary success), then on what basis can we use the idea of survival of the fittest (natural selection) to explain evolutionary success — as opposed to using it merely as a blank check for freely inventing explanations of the sort commonly derided as “just-so stories.” Some philosophers and evolutionary biologists have long referred with a note of patronizing scorn to anyone who brings up the “tautology problem,” as if the reference betrays hopeless ignorance of a problem long ago solved. For example, Michael Ruse, reviewing a book by Philip Kitcher, could already refer in 1984 to the “hoary old chestnut” about tautology, and then (in sympathy with Kitcher) dismiss the claim as “ridiculous.” After all, he writes, “Could generations of evolutionists really have been deceived into

thinking they were doing empirical studies, when they spent hours crouched over fruitflies in the lab, or weeks tramping through the woods looking at butterflies, snails, and finches? A tautology requires no such study.”[26] But what is really ridiculous is to suggest that empirical work, simply by virtue of being empirical work, offers a proper test of any particular theory. Certainly the work of evolutionary biologists has brought us many wonderful insights into the lives of organisms — insights of the sort that were being gained long before Darwin. But such insights provide a test of the theory that the origin of species can be adequately explained by natural selection of the fittest organisms only if they do in fact provide a test. Simply refusing to address the question does no one any good. (The dismissive attitude exemplified by Ruse continues into our own day. As a response to it, Brady’s essays remain relevant and illuminating.) But for our purposes, the argument about tautology is of interest not so much as an issue in itself (I build no case on it), but because all the sound and fury that have been vented over the topic point us toward the obscurity dogging all discussions of fitness. It is no minor problem. You have to have some reasonable notion of “fitness” if you are trying to explain all the amazingly complex, well-adapted, and diverse life forms on earth by the fact that nature preferentially selects the fitter organisms to survive. The question, “What, exactly, is being selected, and how does it explain the observed course of evolution?” needs to be answered if the theory of evolution by natural selection is to be much of a theory at all. To make the problem worse, evolutionary biologists are driven to arrive at scalar values for fitness — values enabling reasonable comparison of traits and organisms, so that we can determine which is the fittest. But how do you take all the infinitely wide-ranging and interwoven considerations that might bear on fitness and reduce them to a scalar value? It is a practical impossibility. As a pair of philosophers put it in a 2002 article, “Suppose a certain species undertakes parental care, is resistant to malaria, and is somewhat weak but very quick. How do these fitness factors add up? We have no idea at all.” [27] Susan K. Mills and John H. Beatty, major contributors to the most popular theory of fitness (a now rather shopworn and probabilistic theory known as the propensity theory), acknowledge that “since an organism’s traits are obviously important in determining its fitness, it is tempting to suggest that fitness be defined independently of survival and reproduction, as some function of traits” — that is, presumably, in terms of engineering criteria. Noting that such a definition would have the advantage of being noncircular, they go on: However, no one has seriously proposed such a definition, and it is easy to see why. The features of organisms which contribute to their survival and reproductive success are endlessly varied and context dependent. What do the fittest germ, the fittest geranium, and the fittest chimpanzee have in common? It cannot be any concretely characterized physical property, given that one and the same physical trait can be helpful in one environment and harmful in another.[28] More than a decade later, Beatty remarked that “the precise meaning of ‘fitness’ has yet to be settled, in spite of the fact — or perhaps because of the fact — that the term is so central to evolutionary thought.” [29] This is, if anything, even more emphatically true today. The concept remains troubled, as it has been from the very beginning, with little agreement on how to make it a workable part of evolutionary theory. Indeed, the “consensus view,” as Roberta L. Millstein and Robert A. Skipper, Jr., write in The Cambridge Companion to the Philosophy of Biology, is that “biologists and philosophers have yet to provide an adequate interpretation of fitness.” [30] And Lewontin, together with University of Missouri philosopher André Ariew, expresses the conviction that “no concept in evolutionary biology has been more confusing” than that of fitness. [31] Yet the neoDarwinian theory of natural selection hinges, in its “status ... as empirical science,” upon a reasonable understanding of what fitness means. [32] ‘Couldn’t You Be More Explicit Here?’ This is a stunning place to find ourselves, given the confident pronouncements we heard issuing from Dennett and Dawkins at the outset of our investigation. Not only do we have great difficulty locating meaningless chance in the context of the actual life of organisms; it now turns out that the one outcome with respect to which randomness of mutation is supposed to obtain — namely, the organism’s fitness — cannot be given any definite or agreed-upon meaning, let alone one that is testable. How then did anyone ever arrive at the conclusion that mutations are random in relation to fitness? There certainly has never

been any empirical demonstration of the conclusion, and it is difficult even to conceive the possibility of such a demonstration. What we are left to surmise, then, is that the doctrine of randomness has simply been projected onto the phenomena of organic life as a matter of pre-existing philosophical commitment. In any case, it is startling to realize that the entire brief for demoting human beings, and organisms in general, to meaningless scraps of molecular machinery — a demotion that fuels the long-running science-religion wars and that, as “shocking” revelation, supposedly stands on a par with Copernicus’s heliocentric proposal — rests on the vague conjunction of two scarcely creditable concepts: the randomness of mutations and the fitness of organisms. And, strangely, this shocking revelation has been sold to us in the context of a descriptive biological literature that, from the molecular level on up, remains almost nothing but a documentation of the meaningfully organized, goal-directed stories of living creatures. Here, then, is what the advocates of evolutionary mindlessness and meaninglessness would have us overlook. We must overlook, first of all, the fact that organisms are masterful participants in, and revisers of, their own genomes, taking a leading position in the most intricate, subtle, and intentional genomic “dance” one could possibly imagine. And then we must overlook the way the organism responds intelligently, and in accord with its own purposes, to whatever it encounters in its environment, including the environment of its own body, and including what we may prefer to view as “accidents.” Then, too, we are asked to ignore not only the living, reproducing creatures whose intensely directed lives provide the only basis we have ever known for the dynamic processes of evolution, but also all the meaning of the larger environment in which these creatures participate — an environment compounded of all the infinitely complex ecological interactions that play out in significant balances, imbalances, competition, cooperation, symbioses, and all the rest, yielding the marvelously varied and interwoven living communities we find in savannah and rainforest, desert and meadow, stream and ocean, mountain and valley. And then, finally, we must be sure to pay no heed to the fact that the fitness, against which we have assumed our notion of randomness could be defined, is one of the most obscure, ill-formed concepts in all of science. Overlooking all this, we are supposed to see — somewhere — blind, mindless, random, purposeless automatisms at the ultimate explanatory root of all genetic variation leading to evolutionary change. The situation calls to mind a widely circulated cartoon by Sidney Harris, which shows two scientists in front of a blackboard on which a body of theory has been traced out with the usual tangle of symbols, arrows, equations, and so on. But there’s a gap in the reasoning at one point, filled by the words, “Then a miracle occurs.” And the one scientist is saying to the other, “I think you should be more explicit here in step two.” In the case of evolution, I picture Dennett and Dawkins filling the blackboard with their vivid descriptions of living, highly regulated, coordinated, integrated, and intensely meaningful biological processes, and then inserting a small, mysterious gap in the middle, along with the words, “Here something random occurs.” This “something random” looks every bit as wishful as the appeal to a miracle. It is the central miracle in a gospel of meaninglessness, a “Randomness of the gaps,” demanding an extraordinarily blind faith. At the very least, we have a right to ask, “Can you be a little more explicit here?” A faith that fills the ever-shrinking gaps in our knowledge of the organism with a potent meaninglessness capable of transforming everything else into an illusion is a faith that could benefit from some minimal grounding. Otherwise, we can hardly avoid suspecting that the importance of randomness in the minds of the faithful is due to its being the only presumed scrap of a weapon in a compulsive struggle to deny all the obvious meaning of our lives. Supplement: Natural Genome Remodeling In her 1983 Nobel address, geneticist Barbara McClintock cited various ways an organism responds to stress by, among other things, altering its own genome. “Some sensing mechanism must be present in these instances to alert the cell to imminent danger,” she said, adding that “a goal for the future would be to determine the extent of knowledge the cell has of itself, and how it utilizes this knowledge in a ‘thoughtful’ manner when challenged.”[33] Subsequent research has shown how far-seeing she was.

It is now indisputable that genomic change of all sorts is rooted in the remarkable “expertise” of the organism as a whole. By means of endlessly complex and interweaving processes, the organism sees to the replication of chromosomes in dividing cells, maintains surveillance for all sorts of damage, and repairs or alters damage when it occurs — all with an intricacy and subtlety of well-gauged action that far exceeds, at the molecular level, what the most skillful surgeon accomplishes at the tissue level. But it’s not just a matter of preserving a fixed DNA sequence. In certain human immune-system cells, portions of DNA are repeatedly cut and then stitched together in new patterns, yielding the huge variety of proteins required for recognizing an equally huge variety of foreign substances that need to be rendered harmless. Clearly, our bodies have gained the skills for elaborate reworking of their DNA — and, we will see further, in many different ways. Depending on stage of development, cell type, and state of health, among other things, our cells convert millions of their genomic “letters” (most often the letter C, standing for the cytosine base) to an altered letter in a process known as “DNA methylation.” The new letter, 5-methylcytosine, is often referred to as the “fifth base” of the genome, and it has profound implications for gene expression that are far too extensive to survey here. The organism also contrives to effect several other kinds of DNA letter changes. The DNA sequence, it turns out, is subject to intense revision through its participation in the life of the larger whole. More emphatically, and with remarkable nuance, the organism contextualizes its genome, and it makes no sense to say that these powers of contextualization are under the control of the genome being contextualized. Thus, the human genome yields itself to a radical and stable “redefinition” of its meaning in the extremely varied environments of some 250 different cell types (and thousands of subtypes) found in brain and muscle, liver and skin, blood and retina. It is well to remember that the genes in your stomach lining and the genes in the cornea of your eye are supposed to be the “same” genes, and yet the immediate context makes very different things out of them. An especially revealing case of contextualization occurs when a genome fit for the needs of all the varied cells of a worm-like larva is subsequently pressed into perfectly adequate service for the entirely different cell types — and different bodily organization and different overall functioning — of a graceful, airborne butterfly. The genome, it appears, is to one extent or another like clay that can be molded in many different ways by the organism as a whole, according to contextual need. Jumping for Change. Quite aside from such contextualization, it has long been known that the organism generates altogether new genetic material by duplicating entire genes, modifying them, and supplying them with regulatory elements. This can occur through direct duplication of genes or even larger chromosomal segments, and also through reverse transcription, whereby messenger RNA molecules, produced from DNA, are transcribed back into new DNA, which can then be modified. But “the array of mechanisms underlying the origin of new genes is compelling, extending way beyond the traditionally well-studied source of gene duplication,” writes Henrik Kaessmann of the Center for Integrative Genomics in Switzerland. [34] In a broad overview of the relevant studies, Kaessmann documents a dizzying variety of techniques by which the organism diversifies and enlarges its genetic repertoire. For example, two duplicated genes can, via a number of different pathways, fuse into a single chimeric gene. And not only protein-coding RNAs, but also small regulatory RNAs can be reverse-transcribed into DNA and their functions diversified. And again, various repetitive and mobile elements called “transposons” can move around in the genome, often being duplicated in the process and then co-opted either as new protein-coding genes or new regulatory genes.[35] Let’s pause for a moment to look a little more closely at these transposons. “It now is undeniable,” writes a team of researchers from the United States, Canada, Spain, and the United Kingdom, “that transposable elements, historically dismissed as junk DNA, have had an instrumental role in sculpting the structure and function of our genomes.” [36] Directly and indirectly, transposable elements are being found crucial to many aspects of genome organization and renovation. And the diverse means by which the cell employs and regulates them have only begun to be delineated. These transposons, also known as “jumping genes” (whose discovery led to Barbara McClintock’s Nobel prize), may hold the key to a puzzle about inbred mice. Such mice, with their perfectly matched genes, are sometimes reared in the laboratory under the

strictest and most identical conditions possible. The frustration for researchers, according to Fred Gage, a neuroscientist at the Salk Institute for Biological Studies in San Diego, is that “you control for everything you can, and in behavioral tests, the variance is enormous.” Even within a single litter, “one mouse will be unusually smart, another below average.” Gage and others are proposing that jumping genes help account for this otherwise mysterious diversity.[37] Whatever may be going on with the mice, it has now been shown that transposons move around in the developing mammalian brain, altering the genome from cell to cell. They provide enough diversity among neurons, according to Gage, so that “you can optimize your response to the variety of environments you might encounter throughout life.” And now it is being found that transposons also “jump” in other cell types much more readily than was previously thought. This particularly includes various cells of the early embryo, in which case each genetically altered cell propagates its changes into a subset of the mature organism’s tissues, making them genetically distinct from other tissues. “Given how often this may happen in the early embryo, there may be much more genomic variation within individuals than most researchers had assumed,” writes one reporter in Science.[38] None of this looks particularly haphazard. In embryonic stem cells the regulatory DNA elements known as enhancers of gene expression contain an elevated number of transposons. And germ cells (of which I will have more to say in a moment) are also especially susceptible to these mutable, or mobile, elements. [39] The cell-type-specific and DNA-element-specific nature of transposon activity points to a meaningfully orchestrated process. In general, there is a bias for many transposable elements to insert themselves upstream of transcription start sites, which “prevents damage to functional coding elements and enhances the potential for a constructive regulatory change.” [40] Are transposons mere parasites? An extraordinarily profound role for jumping genes has just recently come to light with the announcement by Yale University researchers that the evolution of placental development (and hence prolonged pregnancy) in mammals was intimately bound up with the regulatory role of transposons. The Yale team found that a network of 1,532 genes recruited for expression in the human uterus (but not in marsupials, a mammalian group whose members give birth to undeveloped young a mere two weeks after conception) is coordinated by transposons. “We used to believe that changes only took place through small mutations in our DNA that accumulated over time,” remarked the lead researcher in the project, Günter Wagner. “But in this case we found a huge cut-and-paste operation that altered wide areas of the genome to create large-scale morphological change.”[41] The study authors say that their findings “strongly support the existence of transposonmediated gene regulatory innovation at the network level, a mechanism of gene regulation first suggested more than forty years ago by McClintock.... Transposable elements are potent agents of gene regulatory network evolution.” [42] It is no wonder, then, that when genomic researcher David Haussler of the University of California, Santa Cruz was asked by the journal Cell what has been most surprising about the human genome, one of the things he cited was “mounting evidence” that transposons “play a critical role” in the turnover and reinvention of regulatory elements in DNA.[43] And, responding in Science to a report about the work on jumping genes in mammalian brains, Southern Illinois University neuroscientist David G. King wrote that the “dismissive dictum, ‘Mutations are accidents,’ has grown obsolete,” adding that protocols for “the spontaneous, non-accidental production of genetic variation are deeply embedded in genomic architecture.”[44] One other remark about transposons: They exemplify a growing (and, for biologists, embarrassing) class of cellular constituents that were initially dismissed as more or less functionless simply because they didn’t fit into a kind of neat (but now hopelessly outmoded) digital coding schema linking DNA as Master Cause, to RNA as precisely programmed mediary, to protein as definitive final result. Making up a sizable portion of the human genome, transposons are to this day often referred to as “junk” or “parasitic” elements. Because they play a particularly prominent (and still barely explored) role in the germline, one often hears about the germ cell’s “defensive mechanisms” to protect itself from these highly mobile, “selfish” elements, with their genome restructuring potentials. How this kind of thinking could go on for many years without most biologists suspecting a positive role for transposons as genome remodelers with potentially powerful implications for evolution is a great mystery. Certainly transposons, like

everything else in the cell, are subject to intense oversight by their larger context — and viruses may indeed have played a role in their origin, as many suppose — but this hardly makes them mere parasites in the organisms that have so intently taken them up and put them to use. Out of thin air? With transposons, the organism reshapes its genome through elaborately organized and synchronized processes often affecting considerable stretches of DNA. But even more striking, Kaessmann notes, is the recent discovery of proteincoding genes being composed “from scratch” — that is, from non-protein-coding genomic sequences altogether unrelated to pre-existing genes or transposable sequences. He cites a famous 1977 paper by the preeminent French biologist François Jacob to the effect that the probability for creation of new protein-coding genes de novo (from scratch) by random processes “is practically zero.”[45] Such creation was widely thought to be virtually impossible. And yet, Kaessmann goes on, “recent work has uncovered a number of new protein-coding genes that apparently arose from previously noncoding (and nonrepetitive) DNA sequences.” If we take seriously Jacob’s “practically zero” probability for random, de novo assembly of functional, protein-coding genes from noncoding DNA sequences, then, given that such assembly does in fact somehow occur, the obvious thing to suspect is that the process is not random. Nor does the scale of the problem, as it is now emerging, look trivial. There is, we’re told by two biologists working in Germany — one at the Max Planck Institute for Evolutionary Biology and one at Christian Albrechts University — “accumulating evidence that de novo evolution of genes from noncoding sequences could have an important role” in a class of genes representing “up to one-third of the genes in all genomes.” [46] The seemingly unbridgeable gap between “practically zero” and this recent extraordinary claim invites evolutionary geneticists to do a lot of soul-searching. Concerted change in the germline. There is nothing in the picture so far to suggest that, when turning our attention to genetic change in reproduction, we will find much evidence of randomness. Everything we’ve looked at so far occurs in germline cells as well. But in these cells we witness additional powers of change that could hardly be exceeded. Nowhere, for example, do we see the genome more concertedly reshaped than in the two meiotic cell divisions leading to the formation of gametes in sexual reproduction — a choreography we hear described in the accompanying main article as the “meiotic ballet.” One of the central features of this ballet, referred to as “chromosomal crossover” or “genetic recombination,” involves an insistent reshuffling of stretches of DNA between chromosomes, resulting in genetic variation in the offspring. You could hardly imagine a more carefully and delicately staged dance than the one resulting in chromosomal crossover — and, with researchers speaking of “recombination hotspots” and all sorts of regulation, we can be sure it is not at all random. As usual in the cell, many different factors within the larger whole come to bear on any specific point: As is the case for transcription, no single type of DNA site, transcription factor, or histone modification can account for the regulated positioning of all recombination. Instead, these elements function combinatorially (with potential for synergism, antagonism and redundancy) to establish preferential sites of action by meiotic recombination protein complexes.[47] Context, as always, figures strongly (and nonrandomly) in shaping and directing local activities. Kaessmann further points to studies in animals showing that the testes play a “potentially central role in the process of gene birth and evolution.” For example, there is an “overall propensity” of young retrogenes — genes copied back into DNA by reverse transcription from RNA — to be expressed in the testes. “The testis may represent a crucible for new gene evolution, allowing novel genes to form and evolve, and potentially adopt functions in other (somatic) tissues with time.” Likewise, pluripotent cells such as stem cells, which bear certain similarities to germline cells, possess genomes that are “amazingly plastic”: “The incredible plasticity of pluripotent genomes is a notable discovery, and reveals the view of an unexpectedly dynamic mammalian genome for many of us.”[48] Powers of change converging from all sides. In sum, as Kaessmann writes, recent work in genomics has laid bare an astounding diversity of mechanisms underlying the birth of more recent genes. Almost any imaginable pathway toward new gene birth seems to have been documented by now,

even those previously deemed highly unlikely or impossible. Thus, new genes have arisen from copies of old ones, protein and RNA genes were composed from scratch, proteincoding genes metamorphosed into RNA genes, parasitic genome sequences were domesticated, and, finally, all of the resulting components also readily mixed to yield new chimeric genes with unprecedented functions. [49] None of this is yet to mention the way the organism massively structures, restructures, and regulates its genome through the intricate remodeling of chromatin (the DNA/protein/RNA complex comprising our chromosomes), or the way it shapes the dynamic, three-dimensional organization of the cell nucleus, which in turn has a great deal to do with how genes get expressed. (See the first article in this set, “ Getting Over the Code Delusion” [Summer 2010].) Even regarding the bare DNA sequence in the narrowest sense, Italian geneticist Vittorio Sgaramella, after noting the various alterations of the sequence throughout the cells of our bodies, was led to ask, “Which is our real genome...?” He adds, “The human genome seems more complex but less autonomous than originally believed.”[50] Less autonomous because so many concerted activities of the organism are brought to bear on it. And there is still much more we could have spoken about. For example, there is a consensus today that entire organelles of the cell originated in evolutionary history through a kind of cooperative fusion of distinct microorganisms, a process requiring an almost unimaginable degree of intricate coordination among previously independent life processes. There is also the well-demonstrated reality of lateral gene transfer, which looks like invalidating the image of an evolutionary “tree,” especially at the level of simpler organisms: repeated horizontal exchanges of genetic material between distinct species make large portions of the tree look more like a complex web. Then, again, there is good evidence that viruses have played a major role in contributing to the genomes of more complex organisms, including mammals and humans. In all this, we find organisms bringing their separate, highly coordinated life processes to bear upon each other in a symbiotic or other interactive manner that can no more be described as “random” than can, say, the complex and elaborately orchestrated mating processes we see among sexually reproducing organisms. Then, too, we could have looked at convergent evolution and the way it commonly involves changes to corresponding genes in widely different organisms, which “implies a surprising predictability underlying the genetic basis of evolutionary changes.” [51] And there is the rapidly rising interest in a kind of neo-Lamarckian, epigenetically mediated inheritance of acquired characteristics. But we have already seen enough to realize that, by one means or another, the organism pursues its own genomic alterations with remarkable insistence and subtlety. Where is randomness? All these revelations about coherent genomic change have prompted University of Chicago geneticist James A. Shapiro to speak of “natural genetic engineering.” “We have progressed from the Constant Genome, subject only to random, localized changes at a more or less constant mutation rate, to the Fluid Genome, subject to episodic, massive and non-random reorganizations capable of producing new functional architectures.”[52] Crucially, “genetic change is almost always the result of cellular action on the genome.”[53] Likewise, two geneticists from the University of Michigan Medical School, writing in Nature Reviews Genetics, remember how “it was previously thought that most genomic rearrangements formed randomly.” Now, however, “emerging data suggest that many are nonrandom, cell type-, cell stage- and locus-specific events. Recent studies have revealed novel cellular mechanisms and environmental cues that influence genomic rearrangements.”[54] Bear in mind that we’ve been looking at the one aspect of organismal functioning — the mutational aspect — where we are assured most confidently that “blind chance,” or randomness, becomes visible within the evolutionary process. Certainly from the organism’s side we see nothing to suggest any fundamental role for randomness. The accompanying article explores the question in a larger context, where our understanding of evolutionary fitness becomes crucial. Notes [1] Daniel Dennett, Darwin’s Dangerous Idea: Evolution and the Meanings of Life (New York: Simon and Schuster, 1995), 202-3. [2] Richard Dawkins, Climbing Mount Improbable (New York: W. W. Norton, 1996), 223.

[3] Richard Dawkins, The Blind Watchmaker: Why the Evidence of Evolution Reveals a Universe Without Design, (1986; repr., New York: W. W. Norton, 2006), 5. [4] Richard Conn Henry, “The Mental Universe,” Nature 436, no. 7047 (2005): 29. [5] Scott L. Page and R. Scott Hawley, “Chromosome Choreography: The Meiotic Ballet,” Science 301, no. 5634 (2003): 785-9. [6] Dawkins, The Blind Watchmaker, 29. [7] Daniel Dennett, “Evolution as Algorithm,” abstract, in The Mind, the Brain and Complex Adaptive Systems, ed. Harold Morowitz and Jerome Singer, Santa Fe Institute Studies in the Sciences of Complexity, Proceedings, 22 (Boston: Addison-Wesley, 1995): 221-3. [8] Norman D. Cook, “The Case for Reverse Translation,” Journal of Theoretical Biology 64, no. 1 (1977): 113-35. [9] B. A. Bridges, “Mechanisms of Radiation Mutagenesis in Cellular and Subcellular Systems,” Annual Review of Nuclear Science 19 (1969): 139-78. [10] R. K. Elespuru and K. Sankaranarayanan, “New Approaches to Assessing the Effects of Mutagenic Agents on the Integrity of the Human Genome,” Mutation Research 616 (2006): 83-9. [11] Ivana Barbaric, Gaynor Miller, and T. Neil Dear, “Appearances Can Be Deceiving: Phenotypes of Knockout Mice,” Briefings in Functional Genomics and Proteomics 6, no. 2 (2007): 91-103. [12] Dan Graur, “Single-base Mutation,” in Encyclopedia of Life Sciences (Chichester: John Wiley & Sons, 2008). [13] Douglas J. Futuyma, Evolutionary Biology (Sunderland, Mass.: Sinauer, 1979), 249, quoted in John Beatty, “Chance and Natural Selection,” Philosophy of Science 51, no. 2 (1984): 183-211. [14] Tom Bethell, “Darwin’s Mistake,” Harper’s, February 1976, 70-75. [15] Richard C. Lewontin, “Adaptation,” Scientific American 239, no. 3 (1978): 212-230. [16] G. G. Simpson, The Major Features of Evolution, (New York: Columbia University Press., 1953), quoted in Ronald H. Brady, “Dogma and Doubt,” Biological Journal of the Linnean Society 17 (1982): 79-96. Brady’s essay is available online at http://natureinstitute.org/txt/rb/dogma/dogmadoubt.htm. [17] Theodosius Dobzhansky, “Review: Darwinian or ‘Oriented’ Evolution?” Evolution 29, no. 2 (1975): 376-378. [18] Craig Holdrege, “The Giraffe’s Long Neck: From Evolutionary Fable to Whole Organism,” Nature Institute Perspectives, no. 4 (2005). [19] Richard C. Lewontin, “Gene, Organism, and Environment,” in Cycles of Contingency: Developmental Systems and Evolution, ed. Susan Oyama, Paul E. Griffiths, and Russell D. Gray (Cambridge, Mass.: M.I.T., 2001), 62. [20] J. A. Allen, “Frequency-dependent Selection by Predators,” Philosophical Transactions of the Royal Society B (Biological Sciences) 319 (1988): 485-503. [21] Lewontin, “Gene, Organism and Environment,” 65; Richard C. Lewontin, “Gene, Organism, and Environment: A New Introduction,” in Cycles of Contingency: Developmental Systems and Evolution, ed. Susan Oyama, Paul E. Griffiths, and Russell D. Gray (Cambridge, Mass.: M.I.T., 2001), 57. [22] Lewontin, “Gene, Organism, and Environment: A New Introduction,” 57. [23] Carmen Sapienza, “Selection Does Operate Primarily on Genes,” in Contemporary Debates in Philosophy of Biology, ed. Francisco J. Ayala and Robert Arp (Malden, Mass.: Wiley-Blackwell, 2010). [24] Stephen Jay Gould, “Darwin’s Untimely Burial,” Natural History 85 (1976): 24-30. [25] Brady, “Dogma and Doubt.” See also Ronald H. Brady, “Natural Selection and the Criteria by Which a Theory Is Judged,” Systematic Biology 28 (1979): 600-21. [26] Michael Ruse, review of Abusing Science: The Case against Creationism, by Philip Kitcher, Philosophy of Science 51, no. 2 (1984): 348-354. [27] Mohan Matthen and André Ariew, “How to Understand Causal Relations in Natural Selection: Reply to Rosenberg and Bouchard,” Biology and Philosophy 20 (2005): 355-64. [28] Susan K. Mills and John H. Beatty, “The Propensity Interpretation of Fitness,” Philosophy of Science 46, no. 2 (1979): 263-86. [29] John Beatty, “Fitness: Theoretical Contexts,” in Keywords in Evolutionary Biology, ed. Evelyn Fox Keller and Elisabeth A. Lloyd (Cambridge, Mass.: Harvard University Press, 1992).

[30] Roberta L. Millstein, and Robert A. Skipper Jr., “Population Genetics,” in The Cambridge Companion to the Philosophy of Biology, ed. David L. Hull and Michael Ruse (Cambridge, U.K.: Cambridge University Press, 2007). [31] André Ariew and Richard C. Lewontin, “The Confusions of Fitness,” British Journal for the Philosophy of Science 55 (2004): 347-363. [32] Frédéric Bouchard and Alex Rosenberg, “Fitness, Probability and the Principles of Natural Selection,” British Society for the Philosophy of Science 55 (2004): 693-712. [33] Barbara McClintock, “The Significance of Responses of the Genome to Challenge,” Nobel lecture, December 8, 1983. Available online at http://www.nobelprize.org/nobel_prizes/medicine/laureates/1983/mcclintock-lecture.pdf. [34] Henrik Kaessmann, “Origins, Evolution, and Phenotypic Impact of New Genes,” Genome Research 20 (2010): 1313-26. [35] Ibid. [36] Christine R. Beck et al., “LINE-1 Elements in Structural Variation and Disease,” Annual Review of Genomics and Human Genetics 12 (2011): 187-215. [37] Gretchen Vogel, “Do Jumping Genes Spawn Diversity?” Science 332, no. 6027 (2011): 300-1. [38] Ibid. [39] Li Teng, Hiram A. Firpi, and Kai Tan, “Enhancers in Embryonic Stem Cells Are Enriched for Transposable Elements and Genetic Variations Associated with Cancers,” Nucleic Acids Research 39, no. 17 (2011): 7371-9. [40] James A. Shapiro, “Genome Informatics: The Role of DNA in Cellular Computations,” Biological Theory 1, no. 3 (2006): 288-301. [41] Bill Hathaway, “Invasion of Genomic Parasites Triggered Modern Mammalian Pregnancy,” Yale University, press release, September 26, 2011. [42] Vincent J. Lynch et al., “Transposon-Mediated Rewiring of Gene Regulatory Networks Contributed to the Evolution of Pregnancy in Mammals,” Nature Genetics 43, no. 11 (2011): 1154-1159. [43] David Page et al., “Human Genome: What’s Been Most Surprising,” Cell 147, no. 1 (2011): 9-10. [44] David G. King, “Genetic Variation Among Developing Brain Cells,” Science, e-letters, May 16, 2011. Available at http://www.sciencemag.org/content/332/6027/300/reply#sci_el_14847. [45] François Jacob, “Evolution and Tinkering,” Science 196, no. 4295 (1977): 1161–6. [46] Diethard Tautz and Tomislav Domazet-Lošo, “The Evolutionary Origin of Orphan Genes,” Nature Reviews Genetics 12, no. 10 (2011): 692-702. [47] Wayne P. Wahls and Mari K. Davidson, “Discrete DNA Sites Regulate Global Distribution of Meiotic Recombination,” Trends in Genetics 26, no. 5 (2010): 202-8. [48] Maria A. Blasco, Manuel Serrano, and Oscar Fernandez-Capetillo, “Genomic Instability in iPS: Time for a Break,” EMBO Journal 30, no. 6 (2011): 991-3. [49] Kaessmann, “Origins, Evolution, and Phenotypic Impact of New Genes.” [50] Vittorio Sgaramella, “Variability of Our Somatic (Epi)Genomes,” Science 329, no. 5987 (2010): 32-33. [51] Nicola Nadeau and Chris D. Jiggins, “A Golden Age for Evolutionary Studies? Genomic Studies of Adaptation in Natural Populations,” Trends in Genetics 26, no. 11 (2010): 48492. [52] James A. Shapiro, “A Third Way,” Boston Review 22 (1997): 32-33. [53] James A. Shapiro, “Revisiting the Central Dogma in the 21st Century,” Annals of the New York Academy of Sciences 1178 (2009): 6-28. [54] Ram-Shankar Mani and Arul M. Chinnaiyan, “Triggers for Genomic Rearrangements: Insights into Genomic, Cellular and Environmental Influences,” Nature Reviews Genetics 11 (2010): 819-829.