Agrobacterium Protocols_ Volume 2. 2-Humana Press (2014)

Methods in Molecular Biology 1224

Kan Wang Editor

Agrobacterium Protocols Volume 2 Third Edition

METHODS

IN

M O L E C U L A R B I O LO G Y

Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes: http://www.springer.com/series/7651

Agrobacterium Protocols Volume 2 Third Edition

Edited by

Kan Wang Center for Plant Transformation, Plant Sciences Institute, and Department of Agronomy, Iowa State University, Ames, IA, USA

Editor Kan Wang Center for Plant Transformation Plant Sciences Institute Department of Agronomy Iowa State University Ames, IA, USA

ISSN 1064-3745 ISSN 1940-6029 (electronic) ISBN 978-1-4939-1657-3 ISBN 978-1-4939-1658-0 (eBook) DOI 10.1007/978-1-4939-1658-0 Springer New York Heidelberg Dordrecht London Library of Congress Control Number: 2014950243 © Springer Science+Business Media New York 2015 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work. Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the Publisher’s location, in its current version, and permission for use must always be obtained from Springer. Permissions for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution under the respective Copyright Law. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. While the advice and information in this book are believed to be true and accurate at the date of publication, neither the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be made. The publisher makes no warranty, express or implied, with respect to the material contained herein. Printed on acid-free paper Humana Press is a brand of Springer Springer is part of Springer Science+Business Media (www.springer.com)

Dedication To Marc Van Montagu and Jeff Schell (1935–2003), my Ph.D. mentors, for their inspiration and encouragement.

Preface Agrobacterium tumefaciens is a soil bacterium that for more than a century has been known as a pathogen causing the plant crown gall disease. Unlike many other pathogens, Agrobacterium is able to deliver DNA to plant cells and permanently alter the plant genome. The discovery of this unique feature has provided plant scientists with a powerful tool to genetically transform plants for both basic research purposes and for agricultural advancement. The first transgenic plants were reported a little over 30 years ago in 1983 by three independent research groups. Using disarmed Agrobacterium vectors, these groups produced antibiotic-resistant transgenic tobacco Nicotiana tobaccum (Herrera-Estralla et al., 1983, Nature 303: 209), Nicotiana plumbaginifolia (Bevan et al., 1983, Nature 304: 184), and petunia (Petunia hybrid, Fraley et al., 1983, Proceedings of the National Academy of Sciences 80: 4803). The three scientists who led the landmark work, Marc Van Montagu, Mary-Dell Chilton, and Robert Fraley, were the laureates for the 2013 World Food Prize (http://www.worldfoodprize.org/en/laureates/2013_laureates/#StatementAchievem ent). As the statement of achievement of the World Food Prize says, “… each conducted groundbreaking molecular research on how a plant bacterium could be adapted as a tool to insert genes from another organism into plant cells, which could produce new genetic lines with highly favorable traits.” While other methods such as biolistic gun, electroporation or polyethylene glycol can also be used for introducing DNA molecules into plant cells, the Agrobacterium-mediated transformation method remains the method of choices for most plant species in many laboratories due to its efficiency and its propensity to generate single or a low copy number of integrated transgenes with defined ends. When the first edition of Agrobacterium Protocols was published in 1995, exactly 20 years ago, only a handful of plants could be routinely transformed using Agrobacterium. The second edition, which was published in 2006, collected transformation protocols for 59 plant species. In this third edition, we have updated protocols for 32 plant species from the second edition and added protocols for 17 new species. Together with the first and second editions, these two new volumes offer Agrobacterium-mediated genetic transformation protocols for a total of 76 plant species. The third edition of Agrobacterium Protocols contains 57 chapters (two volumes) divided into 9 parts. This edition emphasizes on agricultural crops or plant species with economic values. For a number of important plants such as rice, barley, wheat, and citrus, multiple protocols using different starting plant materials for transformation are included. Like the second edition, plants are grouped according to their practical uses rather than their botanical classifications. Agrobacterium Protocols provides a benchtop manual for tested protocols involving Agrobacterium-mediated transformation. All chapters are written in the same format as that used in the Methods in Molecular Biology series. Each chapter is contributed by authors who are leaders or veterans in their respective areas. The “Abstract” and “Introduction” sections provide outlines of protocols, the rationale for selection of particular target tissues, and information regarding overall transformation efficiency. The “Materials” section lists the host materials, Agrobacterium strains and vectors, stock solutions, media, and other

vii

viii

Preface

supplies necessary for carrying out these transformation experiments. The “Methods” section is the core of each chapter. It provides a step-by-step description of the entire transformation procedure from the preparation of starting materials to the harvest of transgenic plants. To ensure the reproducibility of each protocol, the “Notes” section lists possible pitfalls in the protocol and suggests alternative materials or methods for generating transgenic plants. Typically, most laboratories only work on one or a few plant species. Each laboratory or individual researcher has his or her own favorite variation or modification of any given plant transformation protocol. The protocols presented in this edition represent the most efficient methods used in the laboratories of the contributors. They are by no means the only methods for successful transformation of your plant of interest. The broad range of target tissue selection and in vitro culture procedures indicate the complexity in plant transformation. It is the intention of this book to facilitate the transfer of this rapidly developing technology to all researchers for use in both fundamental and applied biology. I take this opportunity to thank all my colleagues whose time and effort made this edition possible. Special thanks go to my family for their unconditional love and support during the process of editing this book. Ames, IA, USA

Kan Wang

Contents Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

INDUSTRIAL PLANTS

1 Brassica rapa. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tom Lawrenson, Cassandra Goldsack, Lars Ostergaard, and Penny A.C. Hundleby née Sparrow 2 Cotton (Gossypium hirsutum L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Keerti S. Rathore, LeAnne M. Campbell, Shanna Sherwood, and Eugenia Nunes 3 Jatropha (Jatropha curcas L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Devendra Kumar Maravi, Purabi Mazumdar, Shamsher Alam, Vaibhav V. Goud, and Lingaraj Sahoo 4 Sesame (Sesamum indicum L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sonia Kapoor, Sanjay S. Parmar, Manju Yadav, Darshna Chaudhary, Manish Sainger, Ranjana Jaiwal, and Pawan K. Jaiwal 5 Sunflower (Helianthus annuus L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Laura M. Radonic, Dalia M. Lewi, Nilda E. López, H. Esteban Hopp, Alejandro S. Escandón, and Marisa López Bilbao

PART II

3

11

25

37

47

ROOT PLANTS

6 Carrot (Daucus carota L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Owen S.D. Wally and Zamir K. Punja 7 Cassava (Manihot esculenta Crantz) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Simon E. Bull 8 Potato (Solanum tuberosum L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Venkateswari J. Chetty, Javier Narváez-Vásquez, and Martha L. Orozco-Cárdenas 9 Taro (Colocasia esculenta (L.) Schott) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Xiaoling He, Susan C. Miyasaka, Maureen M.M. Fitch, and Yun J. Zhu

PART III

vii xiii

59 67 85

97

NUTS AND FRUITS

10 Apricot (Prunus armeniaca L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . César Petri, Nuria Alburquerque, and Lorenzo Burgos 11 Blueberry (Vaccinium corymbosum L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Guo-Qing Song

ix

111 121

x

Contents

12 Cherry . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Guo-Qing Song 13 Chestnut, American (Castanea dentata (Marsh.) Borkh.) . . . . . . . . . . . . . . . . Charles A. Maynard, Linda D. McGuigan, Allison D. Oakes, Bo Zhang, Andrew E. Newhouse, Lilibeth C. Northern, Allison M. Chartrand, Logan R. Will, Kathleen M. Baier, and William A. Powell 14 Chestnut, European (Castanea sativa) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Elena Corredoira, Silvia Valladares, Ana M. Vieitez, and Antonio Ballester 15 Grapevine (Vitis vinifera L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Laurent Torregrosa, Sandrine Vialet, Angélique Adivèze, Pat Iocco-Corena, and Mark R. Thomas 16 Melon (Cucumis melo) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Satoko Nonaka and Hiroshi Ezura 17 Peach (Prunus persica L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Silvia Sabbadini, Tiziana Pandolfini, Luca Girolomini, Barbara Molesini, and Oriano Navacchi 18 Strawberry (Fragaria × ananassa) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Roberto Cappelletti, Silvia Sabbadini, and Bruno Mezzetti 19 Walnut (Juglans) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Charles A. Leslie, Sriema L. Walawage, Sandra L. Uratsu, Gale McGranahan, and Abhaya M. Dandekar

PART IV

143

163

177

195 205

217 229

TROPIC PLANTS

20 Citrus Transformation Using Juvenile Tissue Explants. . . . . . . . . . . . . . . . . . . Vladimir Orbović and Jude W. Grosser 21 Citrus Transformation Using Mature Tissue Explants . . . . . . . . . . . . . . . . . . . Vladimir Orbović, Alka Shankar, Michael E. Peeples, Calvin Hubbard, and Janice Zale 22 Coffee (Coffea arabica L.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Eveline Déchamp, Jean-Christophe Breitler, Thierry Leroy, and Hervé Etienne 23 Pineapple [Ananas comosus (L.) Merr.] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gaurab Gangopadhyay and Kalyan K. Mukherjee 24 Sugarcane (Saccharum Spp. Hybrids) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hao Wu and Fredy Altpeter

PART V

133

245 259

275

293 307

OTHER IMPORTANT PLANTS

25 Hemp (Cannabis sativa L.). . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mistianne Feeney and Zamir K. Punja 26 Orchids (Oncidium and Phalaenopsis) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Chia-Wen Li, Chia-Hui Liao, Xia Huang, and Ming-Tsair Chan

319 331

Contents

27 Poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch). . . . . . . . . . . . . . . . . . . M. Ashraful Islam, Tage Thorstensen, and Jihong Liu Clarke 28 Populus trichocarpa . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Quanzi Li, Ting-Feng Yeh, Chenmin Yang, Jingyuan Song, Zenn-Zong Chen, Ronald R. Sederoff, and Vincent L. Chiang 29 Tall Fescue (Festuca arundinacea Schreb.). . . . . . . . . . . . . . . . . . . . . . . . . . . . Yaxin Ge and Zeng-Yu Wang Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

xi

347 357

365 373

Contributors ANGÉLIQUE ADIVÈZE • Montpellier SupAgro-INRA, UMR AGAP–Genetic Improvement and Adaptation of Mediterranean and Tropical Plants, Montpellier Cedex, France SHAMSHER ALAM • Department of Biotechnology, Indian Institute of Technology Guwahati, Guwahati, India NURIA ALBURQUERQUE • Grupo de Biotecnología de Frutales, Departamento de Mejora, CEBAS-CSIC, Murcia, Spain FREDY ALTPETER • Plant Molecular and Cellular Biology Program, Agronomy Department, Genetics Institute, University of Florida, Gainesville, FL, USA KATHLEEN M. BAIER • Department of Environmental and Forest Biology, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA ANTONIO BALLESTER • Instituto de Investigaciones Agrobiológicas de Galicia, IIAG, CSIC, Santiago de Compostela, Spain JEAN-CHRISTOPHE BREITLER • Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR RPB, Montpellier, France SIMON E. BULL • Plant Biotechnology Group, ETH Zurich, Universitaetstrasse, Zurich, Switzerland LORENZO BURGOS • Grupo de Biotecnología de Frutales, Departamento de Mejora, CEBAS-CSIC, Murcia, Spain LEANNE M. CAMPBELL • Institute for Plant Genomics and Biotechnology, Texas A&M University, College Station, TX, USA ROBERTO CAPPELLETTI • Department of Agriculture, Food and Environmental Sciences, Università Politecnica delle Marche, Ancona, Italy MING-TSAIR CHAN • Academia Sinica Biotechnology Center, Tannan, Taiwan; Academia Sinica Agricultural Biotechnology Research Center, Taipei, Taiwan ALLISON M. CHARTRAND • Horn Performance and Environmental Science, Northwestern University, Evanston, IL, USA DARSHNA CHAUDHARY • Centre for Biotechnology, M. D. University, Rohtak, India ZENN-ZONG CHEN • Division of Silviculture, Taiwan Forestry Research Institute, Taipei, Taiwan VENKATESWARI J. CHETTY • Plant Transformation Research Center, University of California Riverside, Riverside, CA, USA VINCENT L. CHIANG • Forest Biotechnology Group, Department of Forestry, North Carolina State University, Raleigh, NC, USA JIHONG LIU CLARKE • Bioforsk- Norwegian Institute for Agricultural and Environmental Research, Ås, Norway ELENA CORREDOIRA • Instituto de Investigaciones Agrobiológicas de Galicia, IIAG, CSIC, Santiago de Compostela, Spain ABHAYA M. DANDEKAR • Plant Science Department, University of California, Davis, CA, USA EVELINE DÉCHAMP • Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR RPB, Montpellier, France

xiii

xiv

Contributors

ALEJANDRO S. ESCANDÓN • Instituto de Genética Ewald A. Favret, Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires, Argentina HERVÉ ETIENNE • Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR RPB, Montpellier, France HIROSHI EZURA • University of Tsukuba, Tsukuba, Ibaraki, Japan MISTIANNE FEENEY • School of Life Sciences, University of Warwick, Coventry, UK MAUREEN M.M. FITCH • Hawaii Agriculture Research Center, Kunia, HI, USA GAURAB GANGOPADHYAY • Division of Plant Biology, Bose Institute, Kolkata, India YAXIN GE • Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA LUCA GIROLOMINI • Scienze Agrarie, Alimentari ed Ambientali D3A, Università Politecnica delle Marche, Ancona, Italy CASSANDRA GOLDSACK • Department of Crop Genetics, John Innes Centre, Norwich Research Park, Norwich, UK VAIBHAV V. GOUD • Center for Energy and Department of Chemical Engineering, Indian Institute of Technology Guwahati, Guwahati, India JUDE W. GROSSER • Citrus Research and Education Center, University of Florida/IFAS, Lake Alfred, FL, USA XIAOLING HE • Hawaii Agriculture Research Center, Kunia, HI, USA H. ESTEBAN HOPP • Instituto de Biotecnología, Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires, Argentina XIA HUANG • Sun Yat-sen University, Guangzhou, The People’s Republic of China CALVIN HUBBARD • Citrus Research and Education Center, University of Florida/IFAS, Lake Alfred, FL, USA PENNY A.C. HUNDLEBY NÉE SPARROW • Department of Crop Genetics, John Innes Centre, Norwich Research Park, Norwich, UK PAT IOCCO-CORENA • Horticulture Unit, CSIRO Plant Industry, Glen Osmond, SA, Australia M. ASHRAFUL ISLAM • Department of Horticulture, Bangladesh Agricultural University, Mymensingh, Bangladesh RANJANA JAIWAL • Department of Zoology, M. D. University, Rohtak, India PAWAN K. JAIWAL • Centre for Biotechnology, M. D. University, Rohtak, India SONIA KAPOOR • Centre for Biotechnology, M. D. University, Rohtak, India; University Institute of Engineering and Technology, M. D. University, Rohtak, India TOM LAWRENSON • Department of Crop Genetics, John Innes Centre, Norwich Research Park, Norwich, UK THIERRY LEROY • Centre de Coopération Internationale en Recherche Agronomique pour le Développement, UMR AGAP, Montpellier, France CHARLES A. LESLIE • Plant Sciences Department, University of California Davis, Davis, CA, USA DALIA M. LEWI • Instituto de Genética Ewald A. Favret, Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires, Argentina CHIA-WEN LI • Department of Biotechnology, TransWorld University, Douliu City, Yunlin, Taiwan QUANZI LI • Forest Biotechnology Group, Department of Forestry, North Carolina State University, Raleigh, NC, USA CHIA-HUI LIAO • Academia Sinica Biotechnology Center in Southern Taiwan, Tainan, Taiwan; Academia Sinica Agricultural Biotechnology Research Center, Taipei, Taiwan

Contributors

xv

MARISA LÓPEZ BILBAO • Instituto de Biotecnología, Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires, Argentina NILDA E. LÓPEZ • Instituto de Biotecnología, Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires, Argentina DEVENDRA KUMAR MARAVI • Center for Energy, Indian Institute of Technology Guwahati, Guwahati, India CHARLES A. MAYNARD • Department of Forest and Natural Resources Management, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA PURABI MAZUMDAR • Center for Energy, Indian Institute of Technology Guwahati, Guwahati, India GALE MCGRANAHAN • Plant Science Department, University of California, Davis, CA, USA LINDA D. MCGUIGAN • Department of Forest and Natural Resources Management, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA BRUNO MEZZETTI • Department of Agriculture, Food and Environmental Sciences, Università Politecnica delle Marche, Ancona, Italy SUSAN C. MIYASAKA • Department of Tropical Plant and Soil Sciences, University of Hawaii, Hilo, HI, USA BARBARA MOLESINI • Dipartimento di Biotecnologie, Università di Verona, Verona, Italy KALYAN K. MUKHERJEE • Division of Plant Biology, Bose Institute, Kolkata, India JAVIER NARVÁEZ-VÁSQUEZ • Plant Transformation Research Center, University of California Riverside, Riverside, CA, USA ORIANO NAVACCHI • Vitroplant Italia, Cesena, Italy ANDREW E. NEWHOUSE • Department of Environmental and Forest Biology, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA SATOKO NONAKA • University of Tsukuba, Tsukuba, Ibaraki, Japan LILIBETH C. NORTHERN • Department of Environmental and Forest Biology, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA EUGENIA NUNES • Faculty of Science, The University of Porto, Porto, Portugal ALLISON D. OAKES • Department of Environmental and Forest Biology, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA VLADIMIR ORBOVIĆ • Citrus Research and Education Center, University of Florida/IFAS, Lake Alfred, FL, USA MARTHA L. OROZCO-CÁRDENAS • Plant Transformation Research Center, University of California Riverside, Riverside, CA, USA LARS OSTERGAARD • Department of Crop Genetics, John Innes Centre, Norwich Research Park, Norwich, UK TIZIANA PANDOLFINI • Dipartimento di Biotecnologie, Università di Verona, Verona, Italy SANJAY S. PARMAR • Centre for Biotechnology, M. D. University, Rohtak, India MICHAEL E. PEEPLES • Citrus Research and Education Center, University of Florida/IFAS, Lake Alfred, FL, USA CÉSAR PETRI • Grupo de Biotecnología de Frutales, Departamento de Mejora, CEBAS-CSIC, Murcia, Spain WILLIAM A. POWELL • Department of Environmental and Forest Biology, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA ZAMIR K. PUNJA • Department of Biological Sciences, Simon Fraser University, Burnaby, BC, Canada LAURA M. RADONIC • Instituto de Biotecnología, Instituto Nacional de Tecnología Agropecuaria, Castelar, Buenos Aires, Argentina

xvi

Contributors

KEERTI S. RATHORE • Institute for Plant Genomics and Biotechnology, Texas A&M University, College Station, TX, USA; Department of Soil and Crop Sciences, Texas A&M University, College Station, TX, USA SILVIA SABBADINI • Scienze Agrarie, Alimentari ed Ambientali D3A, Università Politecnica delle Marche, Ancona, Italy LINGARAJ SAHOO • Center for Energy and Department of Biotechnology, Indian Institute of Technology Guwahati, Guwahati, India MANISH SAINGER • Centre for Biotechnology, M. D. University, Rohtak, India RONALD R. SEDEROFF • Forest Biotechnology Group, Department of Forestry, North Carolina State University, Raleigh, NC, USA ALKA SHANKAR • Citrus Research and Education Center, University of Florida/IFAS, Lake Alfred, FL, USA SHANNA SHERWOOD • Institute for Plant Genomics and Biotechnology, Texas A&M University, College Station, TX, USA GUO-QING SONG • Department of Horticulture, Plant Biotechnology Resource and Outreach Center, Michigan State University, East Lansing, MI, USA JINGYUAN SONG • Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China MARK R. THOMAS • Horticulture Unit, CSIRO Plant Industry, Glen Osmond, SA, Australia TAGE THORSTENSEN • Bioforsk- Norwegian Institute for Agricultural and Environmental Research, Ås, Norway LAURENT TORREGROSA • Montpellier SupAgro-INRA, UMR AGAP—Genetic Improvement and Adaptation of Mediterranean and Tropical Plants, Montpellier Cedex, France SANDRA L. URATSU • Plant Science Department, University of California, Davis, CA, USA SILVIA VALLADARES • Instituto de Investigaciones Agrobiológicas de Galicia, IIAG, CSIC, Santiago de Compostela, Spain SANDRINE VIALET • Unité Expérimentale de Pech-Rouge, INRA, UEPR, Gruissan, France ANA M. VIEITEZ • Instituto de Investigaciones Agrobiológicas de Galicia, IIAG, CSIC, Santiago de Compostela, Spain SRIEMA L. WALAWAGE • Plant Science Department, University of California, Davis, CA, USA OWEN S.D. WALLY • Department of Plant Sciences, University of Manitoba, Winnipeg, MB, Canada ZENG-YU WANG • Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA LOGAN R. WILL • The American Chestnut Research and Restoration Project, SUNY College of Environmental Science and Forestry, Syracuse, NY, USA HAO WU • Agronomy Department, Plant Molecular and Cellular Biology Program, Genetics Institute, University of Florida, Gainesville, FL, USA MANJU YADAV • Centre for Biotechnology, M. D. University, Rohtak, India CHENMIN YANG • Forest Biotechnology Group, Department of Forestry, North Carolina State University, Raleigh, NC, USA TING-FENG YEH • School of Forestry and Resource Conservation, National Taiwan University, Taipei, Taiwan JANICE ZALE • Citrus Research and Education Center, University of Florida/IFAS, Lake Alfred, FL, USA BO ZHANG • Therapeutic Proteins International, LLC, Chicago, IL, USA YUN J. ZHU • Hawaii Agriculture Research Center, Kunia, HI, USA

Part I Industrial Plants

Chapter 1 Brassica rapa Tom Lawrenson, Cassandra Goldsack, Lars Ostergaard, and Penny A.C. Hundleby née Sparrow Abstract Within this chapter we outline an A. tumefaciens-mediated transformation method for B. rapa using 4-day-old cotyledonary explants and the genotype R-o-18. Transformation efficiencies are typically achieved in the region of 1 % (based on 2 PCR-positive independent shoots from 200 inoculated explants). This system has been developed to work with gentamicin selection. Key words Agrobacterium tumefaciens, Brassica rapa, Diploid, Gentamicin selection, Oilseed, Transformation

1

Introduction Brassica rapa has historically been the most recalcitrant of Brassica species to transform, with published work focusing on Chiffu, the genotype of the sequencing program, and other B. rapa pekinensis genotypes (Chinese cabbage). However, one significant downside to these genotypes is that they are vegetable types and also highly self-incompatible. As a transformation resource, the economic cost of generating enough seed for routine transformation, as well as the time to hand-pollinate transgenic lines to obtain nextgeneration material, makes these undesirable candidates for routine transformation studies. The B. rapa variety R-o-18 was chosen as the target genotype for studies in our laboratories as its plant architecture is similar to B. napus oilseed rape. R-o-18 is derived from a B. rapa oilseed crop grown in Pakistan and India and is therefore already a crop in its own right. Moreover, the genotype is rapid cycling and self-compatible, enabling the production of large seed stocks to use in transformation studies, as well as generating next-generation transgenic material cost-effectively without the need for laborious hand pollination. This genotype is also used as a model B. rapa genotype by a number of research labs, in particular complementing the R-o-18 TILLING resource available via

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_1, © Springer Science+Business Media New York 2015

3

4

Tom Lawrenson et al.

the John Innes Centre (http://revgenuk.jic.ac.uk). In the current chapter, we describe our protocol for the routine transformation of R-o-18 using a gentamicin-based selection system. Typically, transformation efficiencies in the region of 1 % are achieved (based on 2 PCR-positive independent rooted shoots from 200 inoculated explants).

2

Materials

2.1 Plant Culture Media and Components

1. Vitamins: 10 g/L thiamine-HCl, 1 g/L pyridoxine, 1 g/L nicotinic acid, and 100 g/L myoinositol. All vitamins are made up in sterile distilled water (SDW), filter sterilized, and stored individually at 4 °C, with the exception of myoinositol, which is stored at room temperature. 2. 1-Naphthaleneacetic acid (NAA): 1 mg/mL stock solution. Prepare by dissolving the powder in 1 M NaOH (50 mg in 100 μL). Make to final volume with sterile distilled water (SDW) and filter sterilize. Store at 4 °C. 3. 6-Benzylaminopurine (BAP): 4 mg/mL stock solution. Dissolve the powder in 1 M NaOH (100 mg in 200 μL). Make to final volume with SDW and filter sterilize. Store at 4 °C. 4. Indole-3-butyric acid (IBA): 1 mg/mL stock solution. Prepare by dissolving the powder in 1 M NaOH (50 mg in 100 μL). Make to final volume with SDW and filter sterilize. Store at 4 °C. 5. Gentamicin: 50 mg/mL stock solution. Store at 4–8 °C. 6. Timentin: 160 mg/mL stock solution. Dissolve in SDW, filter sterilize, and store at −20 °C. 7. AgNO3: 20 mg/mL stock solution. Filter sterilize and store foil-wrapped at 4 °C. 8. Germination medium: 4.3 g/L Murashige and Skoog [1] (MS) basal salts only, 30 g/L Sucrose, pH 5.7, 8 g/L phytagar. Autoclave at 120 °C for 20 min. Prior to pouring add 1 mL of each of the four vitamin stocks. One liter typically pours 20 Magenta™ boxes with 50 mL/Magenta™. 9. Callus induction media for cocultivation (CIM-C): As germination medium plus 500 mg/L 2-(N-morpholino)ethanesulfonic acid (MES). MES is a buffering agent, therefore ensure the pH is adjusted after adding. After autoclaving and before pouring, add 1 mL each of the four vitamin stocks, 4 mg/L BAP (1 mL of BAP at 4 mg/mL), and 0.1 mg/L NAA (100 μL of 1 mg/mL NAA). One liter typically pours 20 petri dishes (20 × 90 mm). 10. Callus induction medium for selection (CIM-S): As CIM-C with the addition after autoclaving and before pouring of 160 mg/L Timentin (1 mL of 160 mg/mL stock), 4 mg/L

Brassica rapa

5

AgNO3 (200 μL of the 20 mg/L AgNO3 stock), 10 mg/L gentamicin (200 μL of 50 mg/mL stock). One liter typically pours 20 petri dishes (20 × 90 mm). Selection is not included in the control plates (a single control plate can be poured before gentamicin is added to the medium for the other plates). 11. Shoot induction selection media: 1 L MS basal medium plus 500 mg/L MES. After autoclaving and before pouring, add 4 mg/L BAP (1 mL of BAP stock at 4 mg/mL), 160 mg Timentin (1 mL of 160 mg/mL stock), 4 mg/L AgNO3 (200 μL of AgNO3 at 20 mg/mL), 10 mg/L gentamicin (200 μL gentamicin at 50 mg/mL), 1 mL each of the four vitamin stocks. No gentamicin is added to control plates. 12. Shoot elongation selection medium: 3.05 g/L Gamborg’s B5 salts, 30 g/L sucrose, pH 5.7, 8 g/L phytagar. Autoclave at 120 °C for 20 min. Prior to pouring add 1 mL each of the four vitamin stocks, 0.05 mg/L BAP (12.5 μL of 4 mg/mL stock), 160 mg/L Timentin (1 mL of 160 mg/mL stock), 4 mg/L AgNO3 (200 μL of 20 mg/mL stock), and 10 mg/L gentamicin (200 μL of 50 mg/mL stock). No gentamicin in control plates. 13. Rooting media based on Gamborg’s B5 medium [2]: 3.05 g/L Gamborg’s B5 salts, 10 g/L sucrose, pH5.7, 8 g/L phytagar. Autoclave at 120 °C for 20 min. Prior to pouring add 1 mg/L IBA (1 mL of 1 mg/mL stock), gentamicin 10 mg/L (200 μL of 50 mg/mL stock), and Timentin 160 mg/L (1 mL of 160 mg/mL stock). No gentamicin is added to control jars. 2.2 Agrobacterium Culture Media

1. LB medium: 5 g/L yeast extract, 10 g/L NaCl, 10 g/L peptone ±15 g/L Bacto agar (for solid/liquid medium); autoclave at 120 °C for 20 min. 2. 20× AB salts: To prepare 1 L, add 20 g NH4Cl, 6 g MgSO4 · 7H2O, 3 g KCl, 0.26 g CaCl2 · H2O, and 0.05 g FeSO4 · 7H2O in SDW. Store at −20 oC in 50 mL aliquots. 3. Induction media: To prepare 200 mL, add 10 mL 20× AB salts, 4 g glucose, 1.18 g MES, 0.06 g NaH2PO4, and 0.06 g Na2HPO4 in SDW. Adjust pH to 5.6 with 1 M NaOH. Filter sterilize and store at 4 °C for up to 1 month. 4. Acetosyringone (20 mg/mL in dimethyl sulfoxide). Aliquot into 20 μL volumes and store at −20 °C.

2.3

Seed Source

R-o-18 is an inbred line of the Brassica rapa subsp. trilocularis (yellow sarson) with transparent seed coat [3] closely related to B. rapa oilseed crops grown in Pakistan [4]. Seeds can be obtained by contacting Lars Østergaard on email: [email protected].

6

Tom Lawrenson et al.

2.4 Other Supplies and Reagents

1. Sterilizing solution: 15 % sodium hypochlorite (BDH Chemicals), plus 0.1 % of surfactant Tween 20. 2. Soil: John Innes No. 2 commercial compost. 3. Perforated “bread” bags: supplied by Cryovac (UK) Ltd. 4. Phytagar: supplied by Duchefa (P1003). 5. Timentin: sold as ticarcillin disodium/clavulanate potassium (Duchefa T0190). 6. Sterile peat pots: Sterile peat pots (Jiffy No. 7) are placed into Magenta™ pots (Sigma), and soaked in water until fully expanded. Excess water is poured off and Magentas™ autoclaved at 120 °C for 20 min.

3

Methods The protocol described below is applicable to B. rapa genotype R-o-18. Transformation is based on a previously reported method for B. napus [5].

3.1 Seed Sterilization and Germination

1. Seeds are sterilized by immersion in 70 % ethanol for 2 min prior to treating with 15 % sodium hypochlorite commercial bleach/0.01 % Tween 20 for 15 min, and washed in SDW three times. 2. Seeds are transferred to the surface of germination medium in Magentas™ at a density of 25 seeds per Magenta™ pot. Magentas™ are then maintained in a 23 °C growth room with 16/24 light hours regime at 40 μmol/m2/s for 4 days (see Note 1).

3.2 Agrobacterium Preparation

1. Agrobacterium strain AGL1 is transformed by electroporation with the construct of interest using a suitable bacterial selectable marker (see Notes 2 and 3). 2. Single colonies are used to inoculate liquid cultures which are subsequently used to make glycerol stocks for use as inoculum (standard inoculum) and to confirm integrity of the construct of interest. The latter is done via plasmid miniprep of the Agrobacterium suspension and transformation into E. coli in order to obtain a sufficient quantity of DNA to confirm by restriction digest. 3. Glycerol stocks are composed of 20 % glycerol and 80 % LB Agrobacterium culture. Sterility during all stages of preparation as well as subsequent inoculation is of utmost importance to avoid contamination of tissue culture material. 4. The standard inoculum is stored at −70 °C and used to initiate fresh 10 mL LB cultures 48 h prior to explant isolation/ inoculation.

Brassica rapa

7

5. Twenty-four hours after inoculation with standard inoculum, the LB should be visibly turbid and ready to induce. 6. 5 mL of the resulting suspension is pelleted in a microfuge at full speed for 10 s, and then resuspended in 5 mL of induction medium (pre-warmed to room temperature). A fresh aliquot of acetosyringone (at 20 mg/mL) is defrosted, and 5 μL of this is added to give a concentration of 20 mg/L. 7. The suspension is then incubated in a shaker at 22 °C for 16–20 h in darkness. 8. Directly before the inoculation is made, cells are diluted to OD650 = 0.3 using induction media. 3.3 Explant Isolation, Inoculation, and Cocultivation

1. Cotyledonary petioles are isolated from 4-day-old seedlings. Cotyledons are cut with a sharp scalpel at the point indicated in Fig. 1a–c maximizing the length of the petiole extending from the cotyledons, but not so much as to prevent the separation of the two cotyledons with a single cut. If the cut is made too far from the cotyledons and they do not cleanly separate, then apical meristem tissue will be included in the explant leading to regeneration of escape shoots. 2. The explants are immediately moved to CIM-C plates with just the cut end of the petiole imbedded. Ten explants are held on each plate. 3. When all explants are held on CIM-C plates, inoculation with the Agrobacterium harboring the construct of interest is carried out by dipping the cut end of the petiole into an Agrobacterium suspension. 4. One plate should remain without inoculation to be used as a regeneration control. Explants are then returned to the same CIM-C plates which are then sealed with Micropore tape and moved to a growth room at 23 °C with 16/8 light hours regime at 40 μmol/m2/s for 72 h.

3.4

Selection

1. After 72 h explants are moved to CIM-S plates with the exception of the two control plates (one inoculated and the other not exposed to Agrobacterium) which are moved to fresh CIM-C plates. 2. Plates are returned to the same growth conditions for a further 48 h, before being transferred to shoot induction medium (with the two controls moved to shoot induction with no selection). At this point the shallow lid of the tissue culture dish is replaced with a deeper base of a fresh dish, and the two are joined with Micropore tape (see Note 4). 3. On day 11 (after explant isolation), explants are moved to shoot elongation selection media, retaining the “base-lid” format. Explants are moved to fresh shoot elongation selection media

Fig. 1 Stages in Agrobacterium-mediated Brassica rapa transformation. Four-day-old R-o-18 seedlings ready for explant isolation, showing (a) excision line, (b) scalpel about to make cut, and (c) explant with correct petiole length. Explant cultures 14 days after isolation/inoculation seen from the basal side of plate showing (d) control explants; no Agrobacterium inoculation and no gentamicin selection, (e) control explants; inoculated but maintained in the absence of selection and (f) inoculated explants maintained on gentamicin selection. Explant cultures 3 weeks after isolation/inoculation seen from the top side of plate showing (g) proliferation of shoots in control explants where no inoculation or gentamicin selection was used; (h) proliferation of shoots in control explants inoculated but where no gentamicin selection has been applied; and (i) inoculated explants on gentamicin selection with one putative transgenic shoot (circled); (j) an enlarged view of the marked shoot in (i). Shoots isolated and moved to rooting media at approximately 4 weeks postinoculation (k) and root development after a further 2 weeks (l)

Brassica rapa

9

after a further 10–14 days (maximum). There is a gradual increase in the size of the petiole base around the cut surface, from the time of isolation, as callus begins to form. 4. Two weeks after isolation, inoculated petioles will be in the region of 5 mm in diameter when on selection media (larger and more developed on nonselective controls). Typically, viewing from the base, inoculated petioles have a green center with a white surround under selection conditions and in the nonselective controls will be all green (Fig. 1d–f). A small amount of browning is normal between 14 and 21 days. 3.5

Shoot Isolation

1. When using R-o-18, the emergence of green shoots on control plates (no selection) occurs between 14 and 21 days after explant isolation (Fig. 1g, h), with 90–100 % of explants producing shoots. Transgenic (green) shoots can be seen from 3 weeks onward on selection plates (Fig. 1i, j). From 3 weeks transgenic shoots can be isolated to rooting media (Fig. 1k). The period when most transgenic shoots are likely to appear is between 21 days and 1 month after inoculation. 2. Putative transgenic (green) shoots are excised and transferred to 100 mL jars containing 25 mL of rooting medium using the base of 50 mm petri dishes (Sterilin 124) as lids and maintained at 23 °C under 16-h day length of 40 μmol/m2/s (see Note 5). 3. After root elongation (Fig. 1l) (to approximately 20 mm in length), plantlets are transferred to sterile peat pots to allow further root growth (approx. 2 weeks) before being transferred to the glasshouse (see Note 6).

3.6 Transfer of Plants to Greenhouse

1. Plants are transferred to soil in 9 cm pots (John Innes No. 2) and maintained under shade within a propagator for the first week. This ensures that plants gradually adjust to reduced humidity and increased light intensity. Glasshouse light conditions; day/night temperatures of 18/12 ± 2 °C, 16-h day length, with supplementary lighting (“high pressure sodium lamps” with an average bench reading of 200 μmol/m2/s). Plants are fed weekly with a 2:1:1 NPK fertilizer. 2. After 3 weeks, plants are potted up into 2 L containers under long day conditions (16 h light, 8 h dark) and 18–20 °C. R-o18 will flower after 6–8 weeks, and seeds can be harvested after 20–25 weeks. The time can be shortened if grown in smaller pots but the seed yield is often reduced. 3. When in bud, plants are covered with clear, perforated “bread” bags to prevent cross-pollination and shaken daily once in flower to encourage seed set. Pods are allowed to dry on the plant, before being threshed.

10

4

Tom Lawrenson et al.

Notes 1. Typically, 1.2 g of seed is enough for a 300 explant transformation. Seed should be placed onto the surface of the medium and not embedded. 2. AGL1 is the Agrobacterium tumefaciens strain routinely used in our lab. 3. We used a plant selection cassette consisting of a double 35S promoter driving the aacC1 coding region with a CaMV terminator to provide gentamicin resistance. 4. Using large petri dishes (20 × 90 mm) and the deeper base as a lid gives a larger vessel volume which helps prevent the accumulation of ethylene and water vapor. Sealing with Micropore tape also helps with better gas exchange. We have found that these changes result in a less stressful environment, leading to healthier shoots. 5. It may be possible to omit the inclusion of gentamicin at the root induction stage, as the number of escapes making it through to this stage will be few; however, we recommend that you confirm transgene presence by PCR. 6. R-o-18 plants are often on the verge of flowering during the rooting period in peat pots. To reduce the risk of flowering, the time spent in vitro once roots are established and moving to the greenhouse should be kept as short as possible. Once established in greenhouse pots, early flowers may fail to set, but plants should gather vigor to produce fruit.

Acknowledgments The authors acknowledge the support of the Biotechnology and Biological Science Research Council (BBSRC) Strategic Tools and Resources Grant BB/I023763/1 “Development of an efficient B. rapa transformation system to facilitate studies on fruit development in a diploid Brassica oilseed crop” and further support by BBSRC Strategic Programme Grant B/J004588/1 (GRO) and the John Innes Foundation. References 1. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays and tobacco tissue culture. Physiol Plant 15:437–497 2. Gamborg OL, Miller RB, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50:151–158 3. Rusholme RL, Higgins EE, Walsh JA, Lydiate DJ (2007) Genetic control of broad-spectrum resistance to turnip mosaic virus in Brassica rapa (Chinese cabbage). J Gen Virol 88:3177–3186

4. Rana D, van den Boogaart T, O’Neill C, Hynes L, Bent E, Macpherson L, Park JY, Lim YP, Bancroft I (2004) Conservation of the microstructure of genome segments in Brassica napus and its diploid relatives. Plant J 40: 725–733 5. Moloney MM, Walker JM, Sharma KK (1989) High-efficiency transformation of Brassica napus using Agrobacterium vectors. Plant Cell Rep 8:238–242

Chapter 2 Cotton (Gossypium hirsutum L.) Keerti S. Rathore, LeAnne M. Campbell, Shanna Sherwood, and Eugenia Nunes Abstract Cotton continues to be a crop of great economic importance in many developing and some developed countries. Cotton plants expressing the Bt gene to deter some of the major pests have been enthusiastically and widely accepted by the farmers in three of the major producing countries, i.e., China, India, and the USA. Considering the constraints related to its production and the wide variety of products derived from the cotton plant, it offers several target traits that can be improved through genetic engineering. Thus, there is a great need to accelerate the application of biotechnological tools for cotton improvement. This requires a simple, yet robust gene delivery/transformant recovery system. Recently, a protocol, involving large-scale, mechanical isolation of embryonic axes from germinating cottonseeds followed by direct transformation of the meristematic cells has been developed by an industrial laboratory. However, complexity of the mechanical device and the patent restrictions are likely to keep this method out of reach of most academic laboratories. In this chapter, we describe the method developed in our laboratory that has undergone further refinements and involves Agrobacterium-mediated transformation of cotton cells, selection of stable transgenic callus lines, and recovery of plants via somatic embryogenesis. Key words Agrobacterium, Regeneration, Somatic embryogenesis, Transformation, Transgenic cotton

1

Introduction Cotton, the most important source of natural fiber worldwide, is grown in more than 80 countries across five continents. Compared to the synthetic fibers, cotton provides some major environmental/societal benefits. Firstly, unlike the petroleum-based synthetics, it is a renewable resource. Secondly, its cultivation, processing, and use in textile manufacturing provide for the livelihoods of a much higher number of people compared to the synthetic fibers. Of course, the superiority of cotton clothing in terms of its comfort level cannot be matched by the synthetic versions. With an unrelenting growth in global population and the resulting demand for food and feed, cottonseed is also becoming an increasingly precious commodity. A major by-product, it is used as cattle feed,

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_2, © Springer Science+Business Media New York 2015

11

12

Keerti S. Rathore et al.

either as seed or as meal following the extraction of edible oil. Biotechnology-based solutions are playing a major role in improving cotton yields in most cotton-growing regions. Genetically engineered cotton developed to confer resistance against a class of insects through the expression of the Bt gene represents the first successful application of genetic engineering for commercial purposes [1, 2]. Bt-cotton has lowered production costs by reducing the use of chemical pesticides, fuel, and labor input [3, 4]. In addition, this biotechnology product has had a positive impact on the environment and health of farmers in poor countries by reducing pesticide use. In future, genetic engineering (GE) is likely to play a major role not only in increasing the production but also in improving the quality of fiber and the seed. One of the major hurdles in the application of GE for cotton improvement is our ability to generate transgenic cotton plants in a reliable, rapid, and efficient manner. The first two reports on the generation of transgenic cotton were both published in 1987 [5, 6], only 4 years following the successful transformation of the model species, tobacco. Despite these early successes, few reports on successful transformation of cotton followed for the next 15 years. This was because the production of transgenic cotton plants was extremely difficult and highly inefficient and required a high degree of tissue culture skills. There are two critical steps in the production of transgenic plants in any species. The first step entails transfer and stable integration of the transgene into the plant genome. The second step involves regeneration of a transgenic plant from the stably transformed cell. Considering the difficulties involved in the production of transgenic cotton, our laboratory conducted a comprehensive study to investigate both of these aspects of transgenic cotton production [7]. Although it is possible to transform cotton with a gene gun [8, 9] as well as with the Agrobacterium method [5, 6], our study [7] focused on the latter since it does not require specialized equipment, is relatively inexpensive, and is more likely to result in singlecopy transgenic events. The choice of explant is critical in successfully obtaining transgenic plants since the cells within these tissues must be susceptible to Agrobacterium infection and be able to regenerate into healthy, fertile plants. Most published studies had used either hypocotyl segments [1, 5, 10–13] or cotyledon pieces [6, 10] derived from a young seedling as tissue explants for transformation. However, the use of these explants necessitates passage of transformed cells through either a callus phase or a combination of callus and suspension cultures prior to the induction of somatic embryogenesis for recovering transgenic plants. In addition to these tissue culturebased approaches, there are a few reports that claim the transformation of cells within shoot apices in cotton [14–18]. Direct transformation of the “germline progenitor” cells within the shoot apex has the obvious advantages of avoiding laborious tissue

Cotton (Gossypium hirsutum L.)

13

culture passages and reducing the length of time for the recovery of transformants and, therefore, somaclonal variations. Another major advantage of this system is that regeneration from shoot apices is genotype independent. Various systems for obtaining transgenic cotton were thoroughly evaluated in our laboratory [7, 19] using a reporter gene encoding the green fluorescent protein (GFP) [20]. GFP expression provided an excellent tool to measure the efficiency of T-DNA transfer to cotton cells and was also useful in revealing the timing and localization of transient transgene expression [7]. Cells at the cut edge of the cotyledon segments proved to be the most susceptible to Agrobacterium-mediated transformation as indicated by the transient GFP activity. This was followed by conversion of some of these transiently transformed cells to stable transformation events. Fewer cells at the cut surface of the hypocotyl showed transient GFP activity as compared to the cotyledonary tissue. The cells that showed GFP expression were seen as a ring of fluorescent cells in the middle of the cut surface that appeared to be part of the vascular tissue; however, their true identity was masked by the hypersensitive response displayed by cells around them. Despite the lower rate of transient transformation, hypocotyl segments gave rise to several stable transgenic events that grew as small fluorescent clusters at the cut surface of hypocotyls during the selection on kanamycin-supplemented medium over 3–4 weeks. Thus, although hypocotyl segments showed a low level of transient activity as compared to the cotyledons, these explants were still capable of producing several stable transgenic events [7, 19]. Cotyledonary petiole segments are also as efficient as the hypocotyl segments in terms of producing stable transformation events. Thus, the use of GFP as the reporter gene in combination with neomycin phosphotransferase II (npt II) gene as a selectable marker showed that cotyledons, hypocotyls, and cotyledonary petioles are highly competent explants for Agrobacterium-mediated transformation [7, 19]. A single experiment involving 50 donor seedlings can yield several hundred independent transgenic events in the form of kanamycin-resistant calli. Although most of the experiments with GFP were conducted with cv. Coker 312, we have shown previously that cotyledon segments of several Texas cultivars are also competent for Agrobacterium-mediated T-DNA transfer and are capable of yielding stable transgenic callus [7]. As mentioned earlier, there are a few studies that have reported transformation of cells within the shoot apical meristem via the Agrobacterium method [15–18]. However, these investigations relied heavily on the ability of explants to survive selection pressure as a measure of their transgenic status and/or did not provide convincing molecular and genetics data to support their claims. In our laboratory, the competence of shoot apices for Agrobacteriummediated transformation was evaluated by cocultivating these with

14

Keerti S. Rathore et al.

Agrobacterium under conditions that were found to be optimal for the infection of the other three tissue explants. Both GFP and gusA reporter genes were used in these experiments. However, neither transient nor stable reporter gene expression in the “germline progenitor” cells within these tissues was observed in any of the experiments, each involving several hundred shoot apices. The results indicated that the efficiency of Agrobacterium-mediated transformation of apical meristems may be extremely low in cotton. Limitations and weaknesses of this method and some other alternative methods have been described previously [21]. A recent patent issued to Monsanto [22] describes a mechanical device that can be used to isolate several thousand embryonic axes from germinating cottonseeds in a few hours. The investigators have used these explants to recover germline transformants following Agrobacterium-mediated transgene delivery. The patent further describes optimization of various experimental conditions to obtain transgenic regenerants. Thus, the low efficiencies for direct transformation of germline cells appear to have been overcome by using brute force. However, patent restrictions on the device and the method will prevent most public sector laboratories to utilize this method to generate transgenic cotton plants. There are a few reports in the literature that claim to obtain regeneration via adventitious organogenesis in cotton [23, 24]. Over the past 18 years, a number of attempts have been made in our laboratory to obtain adventitious shoot organogenesis in cotton without success. In a majority of the laboratories involved in the generation of transgenic cotton, the mode of regeneration from callus or suspension cultures is via somatic embryogenesis [25–30]. However, embryogenesis in the cultured tissue occurs at a very low frequency and is highly genotype dependent (Table 1). In addition, only a small number of genotypes have been identified that are competent for regeneration [10, 30–35]. Even with genotypes that exhibit the best response, regeneration requires 6–8 subcultures on various media and can take as long as 6–9 months to

Table 1 Screening of five different genotypes of G. hirsutum for their embryogenic response using the tissue culture protocol described in this chapter (# of lines undergoing somatic embryogenesis 8 months following culture initiation/# of cultured lines) Coker 312

TM-1

Tamcot 22

Tamcot 73

DP50

Hypocotyl

67/86

1/16

0/7

0/7

0/5

Petiole

45/52

0/14

0/3

0/6

0/8

Cotyledon

5/6

0/9

0/6

0/11

0/14

Root

37/45

0/8

0/6

0/2

0/4

Combined total

154/189

1/47

0/22

0/26

0/31

Cotton (Gossypium hirsutum L.)

15

obtain plants following transformation. Problems are encountered at every step during regeneration. These include (1) survival of transgenic events following excision from the hypocotyl, petiole, or cotyledon segments; (2) low efficiencies of the excised events forming embryogenic calli, somatic embryogenesis, and germination of the somatic embryo into a normal plantlet with a proper shoot and root; and (3) extreme fragility of the plantlets during the transition from culture to soil. Thus, while the production of stably transformed calli is an efficient process in cotton as mentioned earlier, the recovery of healthy transgenic cotton plants from transformed cells was found to be highly inefficient. We conducted a thorough examination of the factors impacting both transformation and regeneration and developed an efficient protocol for the production of transgenic cotton plants [7]. The percentage of transgenic events obtained from hypocotyl and cotyledonary petiole explants (number of kanamycin-resistant, transgenic events obtained/number of explants cocultivated with Agrobacterium strain × 100) ranged from 97 to 384 % in various experiments. Although regeneration is possible through suspension cultures in cotton, we prefer to recover plants from callus cultures because this culture system requires less labor and equipment, and the possibility of contamination is lower. By using the protocol described in this chapter, regeneration efficiencies (number of transgenic callus lines regenerating into healthy plants/number of kanamycin-resistant culture lines × 100) have ranged from 0 to 24 %. The method refined over the last 12 years for producing transgenic cotton (cv. Coker 312) is presented in detail in this chapter.

2

Materials All media are autoclaved at 121 °C for 20 min after adjusting the pH and after the addition of the gelling agent. Autoclaved media (with the gelling agent) should be cooled to 50 %) is required. Fertilize plants (e.g., 1 g/L Vitax fertilizer) twice weekly. Water daily allowing the soil to become dry between watering.

4

Notes 1. Carbenicillin disodium forms a viscous solution in water at this concentration. Therefore, add the powder gradually and stir continuously to dissolve. A gelatinous lump will form if the powder is added too quickly. 2. Experiments have been conducted to assess the impact of Noble agar (high-grade agar from red algae) and Gelrite™ (a gellan gum derived from Pseudomonas elodea) on cassava tissue development [61]. Hyperhydricity of somatic cassava tissue appeared to occur on Gelrite™-containing medium, whereas high-quality tissue was generated on medium containing Noble agar. Gelrite™ (which is usually cheaper than Noble agar) is still used for in vitro plantlet stock propagation where it had no discernible negative impact on growth. 3. Following sterilization via autoclaving, tissue culture medium should be plated; do not reheat because this may affect chemical/ nutrient content and caramelize the sucrose. 4. To prevent heat-induced degradation of antibiotics, the media should be allowed to cool to approximately 50 °C before carbenicillin is added. 5. Wrapping the Petri dishes in aluminum foil creates a dark environment that aids bud enlargement and slows development. Additionally, it will be easier to handle the stem cuttings in this and subsequent steps if they are approximately 5–10 mm in length on either side of the node. To minimize tissue multiplication in subsequent steps, it is advisable to use stem cuttings from approximately 75 in vitro plantlets. 6. Leaves larger than approximately 1 cm in diameter should be removed from the propagated apical shoot to reduce risk of leaf senescence before the plantlet is established. Additionally, to encourage root growth, ensure the cutting has a node in the medium. 7. The incubator used for cassava tissue culture can affect tissue quality [61]. Most prominent is the accumulation of moisture on Petri dish lids that may be detrimental to light penetration

Cassava (Manihot esculenta Crantz)

79

and media properties. Ergo, it is advisable to use precise climatecontrolled chambers (e.g., Sanyo/Panasonic MLR Plant Growth Chamber). Culture plates can be stacked 2–3 high with no discernible compromise to tissue growth or quality. 8. Clusters of embryogenic tissue should be no smaller than approximately 5 mm in diameter; otherwise their growth may be attenuated. 9. At this stage, you should aim to have more than 20 CIM plates of tissue to ensure enough material is available for transfer and FEC production. 10. It is important not to disrupt or spread the clusters of FEC as this will attenuate their growth. 11. The extent to which FEC material can be subcultured repeatedly is somewhat dependent on experience and growth conditions. However, it is advisable that a batch of FEC is maintained for no more than six months to minimize the risk of somaclonal variation [37]. 12. It is imperative that the FEC clusters are not completely disassociated as this will negatively affect development. Using syringe needles, gently scoop clumps of FEC avoiding where possible NEFC and other unwanted tissue. 13. The rate of bacterial growth can be variable. Therefore, it is recommended that two or three cultures are inoculated at various times during the day to improve the probability that one of them will be at the optimal OD when required by the researcher. 14. Try to avoid flooding the plate with the Agrobacterium suspension as this will likely result in overaccumulation of bacterial growth. 15. Use material from approximately six culture plates per 25 mL of GDS + C500 for washing. Too much material makes resuspension more difficult and the washing is less effective. 16. It is important that the FEC are spread thinly on the mesh; regeneration is compromised if too thickly layered and may also exacerbate Agrobacterium growth. As a general guide, 12–18 pieces of mesh would be prepared for FEC from six cocultivation plates. 17. This step provides the FEC with a period of recovery and the carbenicillin in the medium suppresses Agrobacterium growth. 18. The stepwise increase in antibiotic concentration and weekly transfer to fresh medium allow transformed material to acclimatize while minimizing changes in culturing/media conditions. A sample of material transformed with a CaMV35S:uidA construct may be used at this stage for a

80

Simon E. Bull

GUS assay (add a sample of tissue to GUS buffer and incubate at 37 °C for 12 h. A blue-black precipitate will appear if successfully transformed. Destain tissue with 70 % (v/v) ethanol). 19. Ordinarily, these structures will appear after approximately three weeks and should be retained on the mesh/medium until cotyledons appear. Material may be cycled on this medium for as long as regeneration is occurring. 20. Although the green cotyledons are clearly visible to the naked eye, it is advisable to use a binocular light microscope when isolating the material to minimize damage and aid the identification of unwanted tissue. A sample of material transformed with a CaMV35S:uidA construct may be used at this stage for a GUS assay (see Note 18; Fig. 2j). 21. The inclusion of carbenicillin in CEM is crucial to suppress Agrobacterium that may be transferred with the plant tissue. A surprisingly small amount of bacterial growth can prevent plant regeneration. 22. The accumulation of callus at the base of the developing plant material presumably hinders uptake of nutrients/hormones and therefore should be removed during transfer to the fresh medium. 23. It is advisable that only shoots 2 cm or more in length are transferred to CBM + C50 to improve their chances of survival. Additionally, the inclusion of carbenicillin in CBM is crucial to suppress Agrobacterium growth. A sample of material transformed with a CaMV35S:uidA construct may be used at this stage for a GUS assay (see Note 18; Fig. 2k). 24. The reduced concentration of Gelrite™ provides a softer medium that facilitates removal of the plantlet, minimizing risk of damage. 25. The larger leaves (if retained on the transferred plantlet) tend to wilt and die before the plant is established, resulting in accumulation of diseased material in the pot. Necrotic leaves should be removed from juvenile plants if they develop.

Acknowledgments This protocol was developed by the author at the University of Bath (UK) and ETH Zürich (Switzerland) and partially funded by the Bill & Melinda Gates Foundation (BioCassava Plus Program Phase I). The author thanks Hervé Vanderschuren (ETH Zürich, Switzerland) for helpful comments and discussion.

Cassava (Manihot esculenta Crantz)

81

References 1. Burns A, Gleadow R, Cliff J, Zacarias A, Cavagnaro T (2010) Cassava: the drought, war and famine crop in a changing world. Sustainability 2:3572–3607 2. FAO (2008) Cassava for food and energy security. http://www.fao.org/newsroom/en/ news/2008/1000899/index.html. FAO Media Centre. October 2010 3. Jansson C, Westerbergh A, Zhang J, Hu X, Sun C (2009) Cassava, a potential biofuel crop in (the) People’s Republic of China. Appl Energy 86:S95–S99 4. Balat M, Balat H (2009) Recent trends in global production and utilization of bioethanol fuel. Appl Energy 86:2273–2282 5. Rosenthal DM, Slattery RA, Miller RE, Grennan AK, Cavagnaro TR, Fauquet CM, Gleadow RM, Ort DR (2012) Cassava aboutFACE: Greater than expected yield stimulation of cassava (Manihot esculenta) by future CO2 levels. Glob Chang Biol 18:2661–2675 6. Sayre R, Beeching JR, Cahoon EB, Egesi C, Fauquet C, Fellman J, Fregene M, Gruissem W, Mallowa S, Manary M, Maziya-Dixon B, Mbanaso A, Schachtman DP, Siritunga D, Taylor N, Vanderschuren H, Zhang P (2011) The BioCassava Plus program: biofortification of cassava for sub-Saharan Africa. Annu Rev Plant Biol 62:251–272 7. Hahn SK, Terry ER, Leuschner K (1980) Breeding cassava for resistance to cassava mosaic disease. Euphytica 29:673–683 8. Okogbenin E, Porto MCM, Egesi C, Mba C, Espinosa E, Santos LG, Ospina C, Marín J, Barrera E, Gutiérrez J, Ekanayake I, Iglesias C, Fregene MA (2007) Marker-assisted introgression of resistance to cassava mosaic disease into Latin American germplasm for the genetic improvement of cassava in Africa. Crop Sci 47(5):1895–1904 9. Chavez AL, Sanchez T, Jaramillo G, Bedoya JM, Echeverry J, Bolanos EA, Ceballos H, Iglesias CA (2005) Variation of quality traits in cassava roots evaluated in landraces and improved clones. Euphytica 143(1–2):125–133 10. Ceballos H, Sanchez T, Morante N, Fregene M, Dufour D, Smith AM, Denyer K, Perez JC, Calle F, Mestres C (2007) Discovery of an amylosefree starch mutant in cassava (Manihot esculenta Crantz). J Agric Food Chem 55:7469–7476 11. Morante N, Sánchez T, Ceballos H, Calle F, Pérez JC, Egesi C, Cuambe CE, Escobar AF, Ortiz D, Chávez AL, Fregene M (2010) Tolerance to postharvest physiological deterioration in cassava roots. Crop Sci 50:1333–1338

12. Ceballos H, Iglesias CA, Perez JC, Dixon AGO (2004) Cassava breeding: opportunities and challenges. Plant Mol Biol 56(4):503–516 13. Kawano K (2003) Thirty years of cassava breeding for productivity—biological and social factors for success. Crop Sci 43(4):1325–1335 14. Nassar N, Ortiz R (2010) Breeding cassava to feed the poor. Sci Am 302(5):78–84 15. Liu J, Zheng Q, Ma Q, Gadidasu KK, Zhang P (2011) Cassava genetic transformation and its application in breeding. J Integr Plant Biol 53(7):552–569 16. Vanderschuren H, Alder A, Zhang P, Gruissem W (2009) Dose-dependent RNAi-mediated geminivirus resistance in the tropical root crop cassava. Plant Mol Biol 70(3):265–272 17. Vanderschuren H, Moreno I, Anjanappa RB, Zainuddin IM, Gruissem W (2012) Exploiting the combination of natural and genetically engineered resistance to cassava mosaic and cassava brown streak viruses impacting cassava production in Africa. PLoS One 7(9):e45277 18. Siritunga D, Arias-Garzon D, White W, Sayre RT (2004) Over-expression of hydroxynitrile lyase in transgenic cassava roots accelerates cyanogenesis and food detoxification. Plant Biotechnol J 2(1):37–43 19. Jørgensen K, Bak S, Busk PK, Sørensen C, Olsen CE, Puonti-Kaerlas J, Møller BL (2005) Cassava plants with a depleted cyanogenic glucoside content in leaves and tubers. Distribution of cyanogenic glucosides, their site of synthesis and transport, and blockage of the biosynthesis by RNA interference technology. Plant Physiol 139(1):363–374 20. Xu J, Duan X, Yang J, Beeching JR, Zhang P (2013) Enhanced reactive oxygen species scavenging by overproduction of superoxide dismutase and catalase delays postharvest physiological deterioration of cassava storage roots. Plant Physiol 161(3):1517–1528 21. Zidenga T, Leyva-Guerrero E, Moon H, Siritunga D, Sayre R (2012) Extending cassava root shelf life via reduction of reactive oxygen species production. Plant Physiol 159(4):1396–1407 22. Koehorst-van Putten HJ, Sudarmonowati E, Herman M, Pereira-Bertram IJ, Wolters AM, Meima H, de Vetten N, Raemakers CJ, Visser RG (2012) Field testing and exploitation of genetically modified cassava with low-amylose or amylose-free starch in Indonesia. Transgenic Res 21(1):39–50 23. Li HQ, Sautter C, Potrykus I, Puonti-Kaerlas J (1996) Genetic transformation of cassava

82

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

Simon E. Bull (Manihot esculenta Crantz). Nat Biotechnol 14(6):736–740 Arias-Garzon DI, Sayre RT (1993) Tissue specific inhibition of transient gene expression in cassava (Manihot esculenta Crantz). Plant Sci 93(1–2):121–130 Franche C, Bogusz D, Schöpke C, Fauquet C, Beachy RN (1991) Transient gene expression in cassava using high-velocity microprojectiles. Plant Mol Biol 17(3):493–498 Luong HT, Shewry PR, Lazzeri PA (1995) Transient gene expression in cassava somatic embryos by tissue electroporation. Plant Sci 107:105–115 Zhang P, Legris G, Coulin P, Puonti-Kaerlas J (2000) Production of stably transformed cassava plants via particle bombardment. Plant Cell Rep 19:939–945 Taylor NJ, Edwards M, Kiernan RJ, Davey CD, Blakesley D, Henshaw GG (1996) Development of friable embryogenic callus and embryogenic suspension culture systems in cassava (Manihot esculenta Crantz). Nat Biotechnol 14(6):726–730 Raemakers CJJM, Sofiari E, Jacobsen E, Visser RGF (1997) Regeneration and transformation of cassava. Euphytica 96(1):153–161 Raemakers CJJM, Sofiari E, Taylor N, Henshaw G, Jacobsen E, Visser RGF (1996) Production of transgenic cassava (Manihot esculenta Crantz) plants by particle bombardment using luciferase activity as selection marker. Mol Breed 2(4):339–349 Niklaus M, Gruissem W, Vanderschuren H (2011) Efficient transformation and regeneration of transgenic cassava using the neomycin phosphotransferase gene as aminoglycoside resistance marker gene. GM Crops 2(3):193–200 Zhang P, Gruissem W (2004) Production of transgenic cassava (Manihot esculenta Crantz). In: Curtis IS (ed) Transgenic crops of the world—essential protocols. Kluwer Academic Publishers, Boston, pp 301–319 Zhang P, Puonti-Kaerlas J (2004) Regeneration of transgenic cassava from transformed embryonic tissues. In: Peña L (ed) Methods in molecular biology, vol 286. Humana, Totowa, pp 165–176 Bull SE, Owiti JA, Niklaus M, Beeching JR, Gruissem W, Vanderschuren H (2009) Agrobacterium-mediated transformation of friable embryogenic calli and regeneration of transgenic cassava. Nat Protoc 4(12):1845–1854 Schreuder MM, Raemakers CJJM, Jacobsen E, Visser RGF (2001) Efficient production of transgenic plants by Agrobacterium-mediated transformation of cassava (Manihot esculenta Crantz). Euphytica 120:35–45

36. Gonzalez AE, Schopke C, Taylor NJ, Beachy RN, Fauquet CM (1998) Regeneration of transgenic cassava plants (Manihot esculenta Crantz) through Agrobacterium-mediated transformation of embryogenic suspension cultures. Plant Cell Rep 17(11):827–831 37. Raemakers K, Schreuder M, Pereira I, Munyikwa T, Jacobsen E, Visser R (2001) Progress made in FEC transformation of cassava. Euphytica 120:15–24 38. Zhang P, Potrykus I, Puonti-Kaerlas J (2000) Efficient production of transgenic cassava using negative and positive selection. Transgenic Res 9(6):405–415 39. Ibrahim AB, Heredia FF, Pinheiro CB, Aragao FJL, Campos FAP (2008) Optimization of somatic embryogenesis and selection regimes for particle bombardment of friable embryogenic callus and somatic cotyledons of cassava (Manihot esculenta Crantz). Afr J Biotechnol 7(16):2790–2797 40. Hankoua BB, Ng SYC, Fawole I, PuontiKaerlas J, Pillay M, Dixon AGO (2005) Regeneration of a wide range of African cassava genotypes via shoot organogenesis from cotyledons of maturing somatic embryos and conformity of the field-established regenerants. Plant Cell Tiss Org Cult 82:221–231 41. Zainuddin IM, Schlegel K, Gruissem W, Vanderschuren H (2012) Robust transformation procedure for the production of transgenic farmer-preferred cassava landraces. Plant Methods 8(24):1–8 42. Rossin CB, Rey MEC (2011) Effect of explant source and auxins on somatic embryogenesis of selected cassava (Manihot esculenta Crantz) cultivars. S Afr J Bot 7(1):59–65 43. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15(3):473–497 44. George EF, Hall MA, Klerk G-JD (2008) Plant growth regulators I: introduction; auxins, their analogues and inhibitors. In: Hall MA, Klerk G-JD, George EF (eds) Plant propagation by tissue culture. Springer, Netherlands, pp 175–204 45. Stamp JA (1987) Somatic embryogenesis in cassava: the anatomy and morphology of the regeneration process. Ann Bot 59(4):451–459 46. George EF, Hall MA, Klerk G-JD (2008) Somatic embryogenesis. In: Hall MA, Klerk G-JD, George EF (eds) Plant propagation by tissue culture. Springer, Netherlands, pp 335–354 47. Stamp JA, Henshaw GG (1986) Adventitious regeneration in cassava. In: Withers LA, Alderson PG (eds) Plant tissue culture and its agricultural applications. Butterworths, London, pp 147–157

Cassava (Manihot esculenta Crantz) 48. Stamp JA, Henshaw GG (1987) Secondary somatic embryogenesis and plant regeneration in cassava. Plant Cell Tiss Org Cult 10(3): 227–233 49. Raemakers KJ, Jacobsen E, Visser RG (1999) Direct cyclic somatic embryogenesis of cassava for mass production purposes. Methods Mol Biol 111:61–70 50. Raemakers K, Jacobsen E, Visser R (2000) The use of somatic embryogenesis for plant propagation in cassava. Mol Biotechnol 14(3):215–221 51. Gresshoff P, Doy C (1974) Derivation of a haploid cell line from Vitis vinifera and the importance of the stage of meiotic development of the anthers for haploid culture of this and other genera. Z Pflanzenphysiol 73:132–141 52. Sofiari E, Raemakers CJJM, Bergervoet JEM, Jacobsen E, Visser RGF (1998) Plant regeneration from protoplasts isolated from friable embryogenic callus of cassava. Plant Cell Rep 18(1):159–165 53. Waldron C, Murphy EB, Roberts JL, Gustafson GD, Armour SL, Malcolm SK (1985) Resistance to hygromycin B. Plant Mol Biol 5(2):103–108 54. Fraley RT, Rogers SG, Horsch RB, Sanders PR, Flick JS, Adams SP, Bittner ML, Brand LA, Fink CL, Fry JS, Galluppi GR, Goldberg SB, Hoffmann NL, Woo SC (1983) Expression of bacterial genes in plant cells. Proc Natl Acad Sci U S A 80(15):4803–4807

83

55. Bull SE, Ndunguru J, Gruissem W, Beeching JR, Vanderschuren H (2011) Cassava: constraints to production and the transfer of biotechnology to African laboratories. Plant Cell Rep 30(5): 779–787 56. Chetty CC, Rossin CB, Gruissem W, Vanderschuren H, Rey ME (2013) Empowering biotechnology in southern Africa: establishment of a robust transformation platform for the production of transgenic industry-preferred cassava. N Biotechnol 30(2): 136–143 57. Vanderschuren H (2012) Strengthening African R&D through effective transfer of tropical crop biotech to African institutions. Nat Biotechnol 30(12):1170–1172 58. Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5(4):387–405 59. Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6(13):3901–3907 60. Hoekema A, Hirsch PR, Hooykaas PJJ, Schilperoort RA (1983) A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303(5913):179–180 61. Bull SE (2011) Study of post-harvest physiological deterioration in transgenic cassava. University of Bath, Bath

Chapter 8 Potato (Solanum tuberosum L.) Venkateswari J. Chetty, Javier Narváez-Vásquez, and Martha L. Orozco-Cárdenas Abstract Agrobacterium-mediated transformation is the most common method for the incorporation of foreign genes into the genome of potato as well as many other species in the Solanaceae family. This chapter describes protocols for the genetic transformation of three species of potato: Solanum tuberosum subsp. tuberosum (Desiréé), S. tuberosum subsp. andigenum (Blue potato), and S. tuberosum subsp. andigena using internodal segments as explants. Key words Agrobacterium tumefaciens, Andigena, β-Glucuronidase (uidA), Blue potato, Desiréé, Neomycin phosphotransferase II (npt II), Plant transformation, Solanum tuberosum

1

Introduction Potato (Solanum tuberosum L.) is the world’s third most important food crop next to rice and wheat in terms of human consumption with its production exceeding 300 million metric tons as reported by International Potato Center [1]. Potato is a critical crop in terms of food security. More than one billion population around the globe consume potato. Potato is vegetatively propagated, meaning that a whole plant can be grown from a potato tuber or a piece of it. The new plant can produce 5–20 new tubers, which will be genetic clones of the mother plant. Potato enjoys a long history of improvement through traditional breeding. Breeders target multiple traits, including resistance to biotic and abiotic stresses, and tuber quality [2]. Recently, the full sequence of the potato genome has been completed [3], opening a broad spectrum of possibilities to understand gene function and the genetic manipulation through plant transformation for the improvement of this important crop. Agrobacterium-mediated transformation is the most common technique used for functional genomic studies in potato, and for the introduction of novel traits into commercial potato varieties,

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_8, © Springer Science+Business Media New York 2015

85

86

Venkateswari J. Chetty et al.

while preserving combinations of desirable traits. Even though well-developed transformation protocols are available for common potato varieties, potato transformation is genotype dependent, limiting their usage and making practical applications not easily adaptable to all genotypes [4–16]. In this chapter we describe the Agrobacterium-mediated transformation protocols routinely used in our laboratory for three different potato cultivars, namely, Andigena, blue potato, and Desiréé. A. tumefaciens strain AGL1 harboring the binary vector pBI121 is used to infect the precultured internodal explants and deliver transgenes into plant cells. After cocultivation the infected internodal explants are selected on kanamycin-containing callus induction medium (CIM). Putative transgenic plants are regenerated on shoot induction medium (SIM) from selected calli. The process from explants preparation to getting a transgenic plant takes about 90 days (Fig. 1). The average transformation frequency (defined as the number of PCR-positive transgenic plants/total number of explants used) for Andigena, blue potato, and Desiréé is 35, 22, and 65 % respectively.

Fig. 1 Steps in the transformation of potato with Agrobacterium tumefaciens strain AGL1 harboring plasmid pBI121. (a) Four-week-old in vitro plants used as source of inter nodal explants. (b) Pre-culture of internodal explants on CIM for 2 days. (c) Callus formation on CIM with antibiotic selection in 2–3 weeks. (d) Shoot regeneration on SIM with antibiotic selection (4 weeks). (e) Shoot elongation on SIM with antibiotic selection (2 weeks). (f) Rooting on RIM with antibiotic selection (3 weeks). (g) Histochemical detection of GUS expression in transgenic shoots

Potato (Solanum tuberosum L.)

2 2.1

Materials Plant Material

2.2 Bacterial Strain and the Binary Vector

2.3

87

Stock Solutions

In vitro micropropagated plants are used as source of stem internodal explants for transformation. Solanum tuberosum subsp. tuberosum cv Desiréé and S. tuberosum subsp. andigenum (blue potato) plants were originally established in vitro from tuber sprouts. The plants are grown at 25 °C under 16 h light/8 h dark cycle with fluorescent light (irradiance of 60 μmol/m2/s). Fourweek-old plantlets are used for the transformation studies. 1. Agrobacterium tumefaciens strain AGL1. 2. Binary vector: The binary vector pBI121 (Clontech, Palo Alto, CA, USA) contains β-glucuronidase (uidA) and neomycin phosphotransferase II (npt II) genes under the regulation of the CaMV 35S promoter [17, 18]. The binary vector pBI121 is transformed into AGL1 using electroporation. Transformed cells are selected on YEP plates with kanamycin (100 mg/L). Kanamycin-resistant colonies are screened by colony PCR using npt II primers. A PCR-positive colony is grown in 5 mL of YEP with kanamycin, and Agrobacterium glycerol stocks are prepared by mixing equal volumes of glycerol and the Agrobacterium culture (1:1 ratio v/v). Glycerol stocks are stored at −80 °C. All chemicals for stock solutions and culture media can be obtained from different vendors including Sigma-Aldrich (www. sigmaaldrich.com), Plantmedia (www.plantmedia.com), PhytoTechnology Laboratories (www.phytotechlab.com), and Caisson Laboratories (www.caissonlabs.com). Unless otherwise specified, all stock solutions are filter sterilized and stored at −20 °C: 1. Gamborg’s B5 vitamin solution (1,000×): Dissolve 200 mg nicotinic acid, 200 mg pyridoxine hydrochloride, and 2,000 mg of thiamine hydrochloride in 180 mL of ddH2O [19]. Bring the volume up to 200 mL with ddH2O. 2. MS vitamin solution (1,000×): Dissolve 100 mg thiamine HCl, 50 mg pyridoxine HCl, 50 mg nicotinic acid, and 200 mg glycine in 100 mL of ddH2O [20]. 3. Indole-3 butyric acid (IBA) solution (1 mg/mL): Dissolve 20 mg of IBA in 2 mL of 95 % ethanol. Bring the volume up to 20 mL with ddH2O. 4. Naphthalene acetic acid (NAA) solution (1 mg/mL): Dissolve 20 mg of NAA in 1 mL of 1 M NaOH. Bring the volume up to 20 mL with ddH2O. 5. Zeatin solution (1 mg/mL): Dissolve 50 mg zeatin in 1 mL of 1 M NaOH. Bring up the volume to 50 mL with ddH2O. Filter sterilize, dispense into1 mL aliquots, and store at −20 °C.

88

Venkateswari J. Chetty et al.

6. Benzyl amino purine (BAP) solution (1 mg/mL): Dissolve 50 mg BAP in a few drops of 1 N NaOH; bring the volume to 50 mL with ddH2O. Store at 4 °C. 7. Acetosyringone solution (74 mM): Dissolve 145 mg acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone) in 10 mL of 95 % ethanol, and store at −20 °C. 8. Kanamycin sulfate solution (100 mg/mL): Dissolve 1 g of kanamycin sulfate in 5 mL ddH2O, vortex, and bring the volume up to 10 mL with ddH2O. Filter sterilize, dispense into 1 mL aliquots, and store at −20 °C. 9. Cefotaxime sodium salt solution (250 mg/mL): Dissolve 2.5 g of cefotaxime in 5 mL ddH2O, vortex, and bring the volume up to 10 mL with ddH2O. Filter sterilize, dispense into 1 mL aliquots, and store at −20 °C. 10. Carbenicillin disodium salt solution (500 mg/mL): Dissolve 5 g of carbenicillin in 5 mL ddH2O, vortex, and bring the volume up to 10 mL with ddH2O. Filter sterilize, dispense into 1 mL aliquots, and store at −20 °C. 11. Rifampicin solution (25 mg/mL): Dissolve 25 mg of rifampicin in 1 mL DMSO, vortex, and store at −20 °C. 2.4

Culture Media

1. YEP-Agrobacterium medium: 10 g/L yeast extract, 10 g/L peptone, 5 g/L NaCl; adjust pH to 7.2 with 1 M NaOH. For solid medium, add Bacto agar (15 g/L) before autoclaving. 2. Agrobacterium infection medium (AIM): 4.3 g/L MS salts, 30 g/L sucrose, 1 mL MS vitamin stock solution (1,000×). 3. Clonal propagation medium (CPM): Murashige and Skoog (MS) salts [20] with sucrose 30 g/L, B5 vitamins (1×), myoinositol 100 mg/L, naphthalene acetic acid 0.02 mg/L, agar 8 g/L, and pH 5.8. 4. Callusing, shoot regeneration, and rooting media. The composition of the medium for callus induction (callus induction medium, CIM), shoot regeneration (shoot induction medium, SIM), and rooting of shoots (root induction medium, RIM) for the three potato genotypes is presented in Table 1. The pH of all plant culture media is adjusted to pH 5.8 with 1 M KOH and sterilized by autoclaving. The hormones are added prior to autoclaving, but zeatin and all antibiotics are added after autoclaving, when the temperature of the medium has dropped to 55 °C. Sterile medium is poured into 100 × 15 mm petri dishes or magenta vessels in a laminar flow hood. All media (liquid or solid) can be stored for several weeks at 4 °C, but media with the antibiotics must be fresh.

89

Potato (Solanum tuberosum L.)

Table 1 Composition of medium for the induction of callus, shoots, and roots from stem internode segments in three different genotypes of potato Desiréé Media components (L)

CIM

SIM

RIM

Blue potato

S. andigena

CIM/SIM RIM

CIM

SIM

RIM

MS salts (g)

4.33

4.33

4.33

4.33

4.33

4.33

4.33

4.33

B5 vitamins (1,000×) (mL)

0

0

0

1

1

0

0

0

MS vitamins (1,000×) (mL)

1

1

1

0

0

1

1

1

Sucrose (g)

20

20

20

30

20

0

0

0

Glucose (g)

0

0

0

0

0

16

16

16

100

100

100

100

100

100

100

100

IAA (mg)

0

0

0

0.5

0.05

0

0

0

BAP (mg)

0

0

0

0

0

0.1

0

0

NAA (mg)

0.2

0.02

0

0

0

5

0.02

0

Zeatin (mg)

2.5

2

0

1

0

2.2

0

GA3 (mg)

0.02

0.02

0

0

0

0

0.15

0

pH

5.8

5.8

5.8

5.8

5.8

5.8

5.8

5.8

Gelrite (g)

0

0

0

0

0

2

2

2

Agar (g)

8

8

8

8

8

0

0

0

Myoinositol (mg)

-

CIM callus induction medium, SIM shoot induction medium, RIM root induction medium

2.5 Stock Solutions for DNA Isolation, PCR Reaction, and Electrophoresis [21]

1. 1 M Tris–HCl (pH 7.5): Dissolve 121.1 g Tris base in 800 mL of ddH2O. Adjust the pH to 7.5 by adding approximately 70 mL of concentrated HCl. Adjust the volume of the solution to 1 L with ddH2O. Store into aliquots and sterilize by autoclaving. 2. 5 M NaCl: Dissolve 146.1 g NaCl in 350 mL ddH2O. Bring the volume up to 500 mL with ddH2O. 3. 0.5 M ethylenediaminetetraacetic acid (EDTA, pH 8.0): Add 186.1 g of disodium EDTA to 800 mL of ddH2O. Stir vigorously on a magnetic stirrer. Adjust the pH to 8.0 with NaOH (~20 g of NaOH pellets). Bring the volume up to 1 L with ddH2O. Dispense into aliquots and sterilize by autoclaving (see Note 1). 4. 10 % sodium dodecyl sulfate (SDS): Dissolve 10 g SDS in 80 mL H2O. Place in 250 mL bottle on a shaker until dissolved. Bring the volume up to 100 mL with ddH2O. Sterilize by autoclaving.

90

Venkateswari J. Chetty et al.

5. DNA extraction buffer: Mix 10 mL 1 M Tris pH 7.5, 2.5 mL 5 M NaCl, 2.5 mL 0.5 M EDTA, and 2.5 mL 10 % SDS in a 50 mL Falcon tube. Bring the volume up to 50 mL with sterile ddH2O. This buffer is stable at room temperature (RT). 6. TAE buffer (50×): Dissolve 242 g of Tris base in 700 mL ddH2O. Add 57 mL of glacial acetic acid and 100 mL 0.5 M EDTA (pH 8.0). Bring the final volume of the mixture to 1 L with ddH2O. Dispense in to 250 mL aliquots in 500 mL glass bottles. Sterilize by autoclaving and store at RT. 7. TE buffer: Mix 5 mL 1 M Tris–HCl pH 7.5 and 1 mL 0.5 M EDTA pH 8.0 in about 100 mL ddH2O, and bring the volume up to 500 mL with ddH2O. Sterilize by autoclaving. Make 25 mL aliquots and store at 4 °C. 8. Loading buffer (6×): Dissolve 25 mg of bromophenol blue in 3 mL sterile ddH2O, add 3 mL of glycerol, and bring the volume up to 10 mL with sterile ddH2O. Store at 4 °C. 9. Ethidium bromide: Dissolve 10 mg in 1 mL of ddH2O. Bring the volume up to 10 mL with sterile ddH2O. Store in a darkbrown glass bottle at RT (see Note 2). 10. 1 kb plus DNA ladder (Invitrogen): Mix 67 μL of 6× loading buffer, 100 μL of DNA ladder, and 733 μL of TE. Store at −20 °C. 2.6 Histochemical Analyses

Gus staining is a convenient way to analyze the expression of uidA gene, which encodes the β-glucuronidase (GUS). After staining for GUS expression, the tissue can be either examined as whole preparation or processed further to observe activity patterns in tissue sections using a microscope [17]: 1. Chloramphenicol (25 mg/mL): Dissolve 25 mg of chloramphenicol in 1 mL 100 % ethanol. Store at −20 °C. 2. Phosphate buffer pH 7.0: Dissolve 2.76 g NaH2PO4 · H2O in 20 mL of ddH2O. In a different beaker, dissolve 9.38 g Na2HPO4 · 2H2O dibasic in 35 mL ddH2O (dissolves at 37 °C). Combine 20 mL monobasic solution with 15 mL dibasic solution. Adjust the pH to 7 with dibasic solution. 3. K3(FeCN6) 0.5 M: Dissolve 82.5 mg in 500 μL ddH2O. 4. K4(FeCN6) 0.5 M: Dissolve 105.5 mg in 500 μL ddH2O. 5. Triton X-100 (10 %): Dissolve 10 g of Triton X-100 in 80 mL of ddH2O. Bring the volume up to 100 mL and stir until well mixed. Sterilize by autoclaving and store at 4 °C. 6. X-gluc staining solution: Dissolve 100 mg of X-gluc in 200 μL N,N-dimethylformamide (DMF). Add more DMF until the solution is transparent.

Potato (Solanum tuberosum L.)

91

7. GUS solution: Combine all the following components: 800 μL chloramphenicol (25 mg/mL), 200 μL 0.5 M K3(FeCN6), 200 μL 0.5 M K4(FeCN6), 4 mL 0.5 M EDTA pH 8.0, 200 μL 100 % Triton X-100, and 200 μL X-gluc solution. Bring the volume up to 200 mL with ddH2O. Filter the solution with a 0.2 μm Millipore filter. Aliquot in 50 mL Falcon tubes (covered with aluminum foil) and store at −20 °C. 2.7 Other Solutions and Supplies

1. Sterilization solution: 20 % commercial bleach (5.25 % sodium hypochlorite) plus few drops of Tween-20. 2. Sunshine Universal Mix soil: Fosters (Waterloo, IA). 3. Sterile paper plates and towels. 4. Greenhouse standard open flat with drainage hole: McConkey, Cat # EJPFONH. 5. Clear Humi-dome 7″ (plastic, transparent): McConkey, Cat # HYFCKDOME-50. Jiffy Peat Pellets 42 mm: McConkey, Cat # JPA703. 6. Round Euro Pot 16 cm (diameter 6.25″, height 6.75″, Volume 2.5 qt/2.37 L McConkey, Cat # JMCATRI100B).

3

Methods

3.1 Growth of In Vitro Plants from Tuber Sprouts

1. Excise sprout tips (3–5 cm long) from germinating tubers under storage or tubers planted in sterile soil. 2. Rinse cut sprouts with running tap water for 5 min. 3. Place sprouts in a 50 mL sterile Falcon tube, add 50 mL of 70 % ethanol, and shake for 5 min at 50 rpm at RT. 4. Remove the ethanol and rinse sprouts once with sterile deionized distilled water. 5. Add 50 mL of sterilization solution, and shake the tube for 20 min in a shaker at 100 rpm. 6. Remove the sterilization solution and wash the sprout tips five times with sterile ddH2O. In a laminar flow hood, place the sterilized sprouts on sterile paper towels on a paper plate to remove the excess water. 7. Sprout tips are cultured on potato clonal propagation medium. 8. Incubate the shoot tips at 25 °C under fluorescent light at 60 μmol/m2/s with a photoperiod of 16/8 h light/dark.

3.2 In Vitro Plant Propagation Using Internodal Explants

1. Fully developed plants can be obtained from sprout tips in about 4 weeks. 2. Stem node cuttings about 5 mm long are dissected from developed plants and placed onto CPM for plant micropropagation.

92

Venkateswari J. Chetty et al.

3. The explants are incubated under the same conditions as the sprouts (step 8 in Subheading 3.1). 4. Four-week-old plantlets are used as source of internodal explants for the transformation. 3.3 Preparation of Agrobacterium Culture

1. Follow standard techniques to transform Agrobacterium strains with a binary vector that carries the gene or genes of interest. The Agrobacterium strain AGL1 is stored as glycerol stocks at −80 °C. 2. To initiate the transformation take a loop full of culture from a glycerol stock of Agrobacterium and streak it on YEP solid medium containing the appropriate antibiotics (see Note 3). Incubate the plate at 28 °C for 2 days. 3. Inoculate a freshly grown single colony of Agrobacterium in 2 mL YEP with specific antibiotics. Incubate the culture in a shaker (250 rpm) for two days at 28 °C. 4. Add 100 μL of liquid Agrobacterium culture to 50 mL YEP with specific antibiotics, and incubate overnight at 28 °C with shaking. 5. Spin down the culture at 5,000 rpm (5,152 × g) for 10 min and resuspend the pellet in 10 mL of AIM. 6. Determine the OD600 of the Agrobacterium culture, and adjust the OD to 0.6 with AIM (see Note 4). 7. Add 20 μL of acetosyringone stock (74 mM) to 40 mL AIMdiluted Agrobacterium culture to be used for transformation.

3.4 Preparation of Explants for Agrobacterium Inoculation

1. Excise internodal explants of 5 mm length from 4-week-old propagated in vitro plants, by removing the nodal segments with a sterile sharp scalpel blade on a sterile paper plate with humid paper towels. 2. Transfer the internodal explants onto Whatman filter paper placed over CIM medium in 100 × 15 mm petri dishes. 3. Seal the plates using plastic wrap, and incubate them for 2 days in a growth room at 25 °C, under fluorescent light (60 μmol/m2/s) with a photoperiod of 16/8 h light/dark.

3.5 Agrobacterium Infection and Cocultivation

1. Transfer the internodal explants into a Falcon tube with 40 mL of the Agrobacterium suspension in AIM previously prepared (see Subheading 3.3). 2. Incubate the explants with Agrobacterium cells for 20 min. Shake the tubes gently during the incubation time in a rotatory or horizontal shaker at 50 rpm. 3. Remove the Agrobacterium suspension and transfer the explants onto sterile paper towels. Blot dry the explants between two sterile filter papers or sterile paper towels.

Potato (Solanum tuberosum L.)

93

This step is very critical to avoid overgrowth of Agrobacterium and obtain good transformation efficiencies. 4. Transfer the explants onto a new 100 × 20 mm petri dish containing a Whatman filter paper placed on CIM. 5. Seal the plates using plastic wrap, and incubate the explants for 2 days as described in step 8 of Subheading 3.1. 3.6 Selection of Transgenic Callus and Shoot Induction

1. After 2 days of cocultivation, collect the explants in Falcon tubes and rinse them for 5 min with 40 mL of sterile ddH2O with 250 mg/L of cefotaxime. 2. Blot dry the tissue explants between sterile filter paper and sterile paper towels and transfer them to CIM containing 500 mg/L carbenicillin, 250 mg/mL cefotaxime, and 100 mg/L kanamycin (without filter paper). 3. Seal the plates with plastic wrap and incubate them as described in step 8 of Subheading 3.1. 4. Transfer the explants on to fresh CIM plates once every 2 weeks. 5. If Agrobacterium overgrowth is observed, the explants should be washed again 3× with 250 mg/L cefotaxime and 500 mg/L carbenicillin, blot dry, and continue culturing on CIM. 6. Shoot primordia start to appear after the first 4 weeks.

3.7 Shoot Elongation and Root Induction

1. Transfer explants with callus and shoot primordia to shoot induction medium (SIM) supplemented with the same antibiotics (see step 2 of Subheading 3.5) in magenta boxes, and incubate as before (see Note 5). 2. After 4 weeks on SIM, transfer elongated shoots that are at least 2 cm long to test tubes containing 10 mL of RIM supplemented with 250 mg/L carbenicillin, 125 mg/L cefotaxime, 50 mg/L kanamycin, and incubate them as before.

3.8 Transplanting and Acclimation of Rooted Shoots

1. Gently remove the shoots with well-formed root systems from the test tubes. Wash off the agar medium from the roots using ddH2O (see Note 6). 2. Transfer each in vitro plantlet to a Jiffy peat pellet and place them in a flat tray with water in the greenhouse. Use a transparent dome to cover the flat to maintain a high relative humidity for acclimation during the first 3 days.

3.9 Greenhouse Care of Transgenic Plants

1. After 1 week of acclimation, when roots are coming out of the Jiffy pellet, transfer the established potato plantlet to 2″ pots with Sunshine Universal soil mix, wet with regular water, and then move them to the greenhouse. Ensure that plants are accurately labeled. The ideal greenhouse environmental conditions for all the three potato cultivars are temperature 22 °C, relative humidity (~70 %), and natural light.

94

Venkateswari J. Chetty et al.

2. After 3 weeks in small pots, transfer the potato plants to 6.5″ pots with Sunshine Universal soil mix; water and fertilize them regularly using a half-strength Hoagland’s solution [22]. 3. Keep plants growing in the greenhouse for around 3 months for tuber production. 3.10 DNA Extraction and PCR Analysis

1. Grind 100 mg of leaves from putative transgenic plants (i.e., kanamycin resistant) in an Eppendorf tube with 450 μL of extraction buffer (200 mM Tris–HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA (pH 8.0), 0.5 % SDS), followed by chloroform extraction, and isopropanol precipitation of nucleic acids. 2. Wash the DNA pellet with 70 % ethanol two times, and resuspend in 50 μL of TE buffer. 3. Dilute the DNA to a final concentration of 100 ng/μL using nuclease free water. 4. For regular end-PCR analysis, 100 ng of DNA is added to a 20 μL of PCR reaction mix. 5. PCR reaction mix contains 0.25 mM dNTPs, 2 mM MgCl2, 0.5 U Ex Taq DNA polymerase (Life Technologies®, NY, USA), and 0.5 μM of each primer pair for the amplification of the nptII gene (forward primer: 5′-GGATTGCACGCAGGTTCTCC-3′, and reverse primer: 5′-AACTCGTCAAGAAGGCGATA-3′). 6. Reaction conditions for end-PCR are 94 °C for 5 min, followed by 29 cycles of 94 °C for 30 s, 57 °C for 30 s, 72 °C for 1 min, and a final extension at 72 °C for 10 min. The PCR products are visualized after electrophoresis on 0.8 % agarose gels. The gel is scored for the presence or absence of the nptII product (773 bp).

3.11 Histochemical Analyses for GUS Assay

1. Submerge tissue samples in GUS solution. 2. Place the tissue under vacuum for 10 min. Close the valve and let it stay for another 20 min in the dark. 3. Slowly open the valve and release the vacuum. Cover the container with Parafilm and then wrap it in aluminum foil and incubate at 37 °C for 8–16 h. Incubation time depends on the tissue and the promoter fusion being used. 4. Remove the container from the incubator, and replace the GUS solution with 50 % ethanol and incubate at 37 °C for 1 h. Repeat the process with 70–100 % ethanol until the tissue is cleared. Tissue can remain in 70–100 % ethanol indefinitely at 4 °C. 5. Look at the tissue samples under a microscope and take pictures.

Potato (Solanum tuberosum L.)

4

95

Notes 1. The EDTA disodium salt will not go into solution until the pH of the solution is adjusted to ~8.0 by the addition of NaOH. 2. Ethidium bromide is a strong mutagen and a possible carcinogen or teratogen. Its hazardous properties require the use gloves for handling and safety disposal. 3. Rifampicin (25 mg/L) and kanamycin (50 mg/L) are added to grow Agrobacterium strain AGL1 transformed with pBI121. 4. To calculate the final dilution volume of Agrobacterium (V1), use the equation C1V1 = C2V2, where C1 and C2 are respectively the initial and final OD and V2 the final volume. Use AIM to dilute the Agrobacterium cells. Diluted Agrobacterium culture has to be used immediately to avoid aggregation. 5. Shoots regenerated from the two cut ends of the explants can be considered independent events. It is important to cut off the calli at the base from the shoot. 6. Transgenic shoots start rooting after 3–5 days.

References 1. Potato (2013) Retrieved from http://cipotato. org/potato 2. Facts and figures about potato (2013) Retrieved from http://cipotato.org/potato/ publications/pdf/005449.pdf 3. Xu X, Pan S, Cheng S, Zhang B, Mu D, Ni P, Visser RG (2011) Genome sequence and analysis of the tuber crop potato. Nature 475:189–195 4. Bradeen JM, Carputo D, Douches D (2009) Part 7 Transgenic sugar, tuber and fiber crops. doi:10.1002/9781405181099. k0704 in compendium of transgenic crop plants 5. De Block M (1998) Genotype-independent leaf disc transformation of potato (Solanum tuberosum) using Agrobacterium tumefaciens. Theor Appl Genet 76:767–774 6. Stiekema WJ, Heidekamp F, Louwerse JD, Verhoeven HA, Dijkhuis P (1998) Introduction of foreign genes into potato cultivars Bintje and Desiree using an Agrobacterium tumefaciens binary vector. Plant Cell Rep 7:47–50 7. Sheerman S, Bevan MW (1988) A rapid transformation method for Solanum tuberosum using binary Agrobacterium tumefaciens vectors. Plant Cell Rep 7:13–15 8. Tavazza R, Tavazza M, Ordas RJ, Ancora G, Benvenuto E (1988) Genetic transformation

9.

10.

11.

12.

13.

14.

of potato (Solanum tuberosum): an efficient method to obtain transgenic plants. Plant Sci 59:175–181 Wenzler H, Mignery G, May G, Park A (1989) A rapid and efficient transformation method for the production of large numbers of transgenic potato plants. Plant Sci 63:79–85 Mitten DH, Horn M, Burrel MM, Blundy KS (1990) Strategies for potato transformation and regeneration. In: Vayda ME, Park WD (eds) The molecular and cellular biology of the potato. CAB International, Wallingford, pp 181–191 Beaujean A, Sangwan RS, Lecardonnel A, Sangwan-Norreel BS (1998) Agrobacteriummediated transformation of three economically important potato cultivars using sliced internodal explants: an efficient protocol of transformation. J Exp Bot 49:1589–1595 Millam S (2006) Potato (Solanum tuberosum L.). In: Wang K (ed) Agrobacterium protocols, vol 2, 2nd edn. Humana, Totowa, NJ, pp 25–35 Chakravarty B, Wang-Pruski G (2010) Rapid regeneration of stable transformants in cultures of potato by improving factors influencing Agrobacterium-mediated transformation. Adv Biosci Biotechnol 1:409–416 Trujillo C, Rodriguez-Arango E, Jaramillo S, Hoyos R, Orduz S, Arango R (2001) One step transformation of two Andean potato cultivars

96

15.

16.

17.

18.

Venkateswari J. Chetty et al. (Solanum tuberosum L. subsp. andigena). Plant Cell Rep 20:637–641 Banerjee AK, Prat S, Hannapel DJ (2006) Efficient production of transgenic potato (S. tuberosum L. ssp. andigena) plants via Agrobacterium tumefaciens-mediated transformation. Plant Sci 170:732–738 Narváez-Vásquez J, Ryan AC (2002) The systemin precursor gene regulates both defensive and developmental genes in Solanum tuberosum. Proc Natl Acad Sci U S A 99:15818–15821 Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusion: glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901–3907 Po-Yen C, Chen-Kuen W, Shaw-Ching S, KinYing T (2003) Complete sequence of the binary vector pBI121 and its application in

19.

20.

21.

22.

cloning T-DNA insertion from transgenic plants. Mol Breeding 11:287–293 Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50: 151–158 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio-assays with tobacco tissue cultures. Physiol Plant 15: 473–497 Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual (3rd ed), CSHL Press, New York, NY 3:1–1453 Hoagland DR, Arnon DI (1950) The water culture method for growing plants without soil. University of California. Agric. Exp. Station, Berkeley

Chapter 9 Taro (Colocasia esculenta (L.) Schott) Xiaoling He, Susan C. Miyasaka, Maureen M.M. Fitch, and Yun J. Zhu Abstract Genetic engineering of taro is an effective method to improve taro quality and the resistance to various diseases of taro. Agrobacterium tumefaciens-mediated transformation of taro is more efficient than the particle bombardment transformation method based on current research. The development of a regeneration system starting from taro shoot tip explants could produce dasheen mosaic virus (DsMV)-free plantlets. Highly regenerative calluses could be developed from DsMV-free, in vitro plantlets on the Murashige and Skoog (MS) medium with 2 mg/L BA and 1 mg/L NAA (M5 medium). The Agrobacterium tumefaciensmediated transformation method is reported in this chapter. The highly regenerative calluses were selected and cocultivated with the Agrobacterium strain EHA105 harboring the binary vector PBI121 with either a rice chitinase gene chi11 or a wheat oxalate oxidase gene gf2.8. After cocultivation for 3–4 days, these calluses were transferred to selection medium (M5 medium) containing 50 mg/L Geneticin G418 and grown for 3 months in the dark. Transgenic shoot lines could be induced and selected on the MS medium containing 4 mg/L BA (M15 medium) and 50 mg/L Geneticin G418 for 3 months further in the light. Molecular analyses are used to confirm the stable transformation and expression of the disease resistance gene chi11 or gf2.8. Pathologic bioassays could be used to demonstrate whether the transgenic plants had increased disease resistance to taro pathogens Sclerotium rolfsii or Phytophthora colocasiae. Key words Agrobacterium tumefaciens, Colocasia esculenta, Dasheen mosaic-free plantlets, Genetic engineering, Shoot tip explants, Taro, Transformation

1

Introduction Taro (Colocasia esculenta (L.) Schott) is an important tropical root crop which is cultivated worldwide especially in Southeast Asia and the Pacific Islands [1, 2]. Traditionally, taro is propagated vegetatively using underground stems from sucker plants (i.e., cormels) [3]. Approximately 10 % of the previous crops’ cormels need to be used for propagation [3]. Several tissue culture protocols for various taro cultivars have been developed. The development of an efficient taro tissue culture system could reduce the usage of the cormels for propagating materials and increase the speed and production of the taro propagation. For example, Chand et al. in 1999 [4], Fukino et al. in 2000 [5],

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_9, © Springer Science+Business Media New York 2015

97

98

Xiaoling He et al.

Hartman in 1974 [6], and He et al. in 2008, 2010, and 2013 [7–9] have reported that efficient tissue culture systems could be developed using taro shoot tips as explants. Murakami et al. in 1995 [10] developed a regeneration system via protoplasts. In addition, Deo et al. in 2009 [11] reported a protocol of the somatic embryogenesis, organogenesis, and plant regeneration in taro. In this chapter, we describe a protocol of establishment of in vitro stock culture using taro shoot tips as explants and a protocol of inducing calluses and multiple shoots using in vitro shoot tips [7–9]. The protocols we used are easy to conduct and only need 1–2 cormels as propagating materials. Also, the regeneration efficiency is relatively high with an average of 12 multiple shoots developed from each callus within 1 month [8]. In addition, this regeneration method using shoot tip explants could eliminate the taro pathogen dasheen mosaic virus (DsMV) from infected taro [8]. Major limiting factors in taro production are various taro diseases that can severely decrease taro yields [12]. These taro diseases include: (1) taro leaf blight (TLB) caused by the oomycete pathogen Phytophthora colocasiae, (2) taro pocket rot (TPR) caused by a new species of Phytophthora, and (3) and southern blight caused by the fungal pathogen Sclerotium rolfsii [12]. Conventional breeding is ongoing to increase resistance to these diseases. However, one commercial taro cultivar that originated in China (cv. Bun Long) rarely flowers under natural environmental conditions in Hawaii. Cultivar Bun Long as well as several other cultivars does not respond to gibberellic acid (GA) which is applied to induce flowering [13]. Lack of flowering makes it impossible to improve taro quality and disease resistance by conventional breeding. Genetic engineering of taro is an alternative to conventional breeding to improve disease resistance. To date, four journal articles have reported transformation protocols of taro by either particle bombardment method or Agrobacterium-mediated method [5, 7–9]. Fukino et al. in 2000 [5] first reported transformation of taro cultivar Eguimo using a marker gene glucuronidase (gus) gene. They used a particle bombardment method with a very low efficiency (less than 0.5 %). He et al. in 2010 [8] also reported a successful particle bombardment transformation method to insert a disease resistance gene, rice chitinase gene chi11 with the same low efficiency (less than 0.5 %). In addition, the Southern blot analysis showed a high-copy insertion of the transgene (13 copies) that indicated a high risk of transgene silencing and rearrangement [8]. He et al. in 2008 [7] transformed a commercial taro cultivar Bun Long with the rice chitinase gene chi11 via Agrobacterium-mediated transformation, and transgenic plants showed increased disease resistance to the pathogen Sclerotium rolfsii. Also, He et al. in 2013 [9]

Taro (Colocasia esculenta (L.) Schott)

99

used the same Agrobacterium-mediated transformation protocol to insert a wheat oxalate oxidase gene gf2.8 into taro cv. Bun Long, and the transgenic plants showed increased disease resistance to the pathogen Phytophthora colocasiae. Agrobacterium-mediated transformation method had a higher transformation efficiency (1–3 %) and lower-copy insertion of transgene (single copy or 2–3 copies) than the particle bombardment transformation method [5, 7–9]. In this chapter, we describe this Agrobacterium-mediated transformation protocol in step-by-step laboratory procedures.

2 2.1

Materials Plant Material

2.2 Growth Regulator Stock Solutions

Taro cv. Bun Long cormels were obtained from the University of Hawaii’s Waiakea Experiment Station. In vitro plantlets in culture were established from primary shoot apices and axillary buds on taro cormels. Highly regenerative calluses were induced from the DsMV-free in vitro plantlets. These calluses were the targets of Agrobacterium tumefaciens-mediated transformation. 1. α-Naphthalene acetic acid (NAA): 100 ml 0.5 mg/mL stock is prepared by dissolving 50 mg of NAA in 2 mL 1 N NaOH and making up to volume with 98 mL of sterile distilled water. Stock solution can be stored at 4 °C for 6 months. 2. 6-Benzylaminopurine (BA): 100 ml 0.5 mg/mL stock is prepared by dissolving 50 mg of BA in 2 mL 1 N NaOH and making up to volume with 98 mL of sterile distilled water. Stock solution can be stored at 4 °C for 6 months.

2.3 Antibiotics Stock Solutions

1. Cefotaxime sodium salt: Prepare as 250 mg/mL stock solution in sterile distilled water, filter-sterilize through 0.2 μm membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and store at −20 °C for 6 months. 2. G418 Sulfate: Prepare as 50 mg/mL stock solution in sterile distilled water, filter-sterilize through 0.2 μm membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and store at −20 °C for 6 months. 3. Kanamycin monosulfate: Prepare as 50 mg/mL stock solution in sterile distilled water, filter-sterilize through 0.2 μm membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and store at −20 °C for 6 months. 4. Rifampicin: Prepare as 25 mg/mL stock solution in dimethyl sulfoxide (DMSO), filter-sterilize through 0.2 μm membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, wrap Eppendorf tubes using foil paper to protect from light, and store at −20 °C for 1 year.

100

Xiaoling He et al.

2.4 Other Stock Solutions

1. MS vitamin stock (1,000×): 0.5 g/L thiamine HCl, 0.5 g/L pyridoxine HCl, 0.05 g/L nicotinic acid, 2.0 g/L glycine. Store 50 mL aliquots in Falcon tubes at 4 °C for 6 months. 2. Acetosyringone (AS): 300 mM of stock solution is prepared by dissolving 0.588 g of AS in 10 mL of DMSO, filter-sterilize through 0.2 μm membrane, aliquot 1 mL into 1.5 mL sterile Eppendorf tubes, and store at −20 °C for 6 months.

2.5

Culture Media

2.5.1 Plant Culture Medium

The liquid medium for plant culture is prepared as either 3 mL aliquots in test tubes or 30 mL aliquots in Magenta boxes, pH adjusted with NaOH (1 N) to 5.8, and autoclaved for 30 min at 121 °C. All solid medium for plant culture is prepared as 500 mL aliquots in 1,000 mL Erlenmeyer flasks and pH adjusted with NaOH (1 N) to 5.8 before adding gellan gum (Caisson). After adding 3 g/L gellan gum, the medium is autoclaved for 30 min at 121 °C and poured into 25 petri dishes (9 cm) when medium is cooled down to about 55 °C. The liquid medium for Agrobacterium culture is prepared as 30 mL aliquots in 125 mL Erlenmeyer flasks, pH adjusted with 1 N NaOH to 7.0–7.2, and autoclaved for 30 min at 121 °C. For tube culture, aliquots of 3 mL autoclaved medium are added to sterile 14 mL round bottom tubes (Thermo Scientific Nalgene). The solid medium for Agrobacterium culture is prepared as 100 mL aliquots in 300 mL Erlenmeyer flasks and pH adjusted with 1 N NaOH to 7.0–7.2 before adding agar. After adding 15 g/L agar, the medium is autoclaved for 30 min at 121 °C and poured into five 9 cm diameter petri dishes when medium is cooled down to about 55 °C. 1. Cocultivation medium: Murashige and Skoog (MS) medium [14]—4.3 g/L 1× MS basal salts, 30 g/L sucrose, 0.1 g/L myoinositol, and 1 ml/L MS stock vitamin. 2. Callus induction medium (M5) [7]: MS medium plus 2 mg/L BA and 1 mg/L NAA. 3. Shoot induction and multiplication medium (M15) [7]: MS medium plus 4 mg/L BA. 4. Callus stage selection medium (CSM) [7]: M5 medium plus 250 mg/L of cefotaxime and 50 mg/L of G418. 5. Stage one shoot selection medium (SSM1) [7]: M15 medium plus 250 mg/L of cefotaxime and 50 mg/L of G418. 6. Stage two shoot selection medium (SSM2) [7]: M15 medium plus 125 mg/L of cefotaxime and 25 mg/L of G418. 7. Stage three shoot selection medium (SSM3) [7]: M15 medium plus 25 mg/L of G418.

Taro (Colocasia esculenta (L.) Schott)

101

2.5.2 Agrobacterium Culture Medium

1. YEB media: 5 g/L of tryptone; 1 g/L of yeast extract; 5 g/L beef extract, 0.24 g/L MgSO4, and 5 g/L of sucrose.

2.6 Bacterial Strains and Vector

1. Disarmed Agrobacterium tumefaciens strain EHA105 [15] containing the binary vector pBI121/ricchi11 or pBI121/gf2.8. All EHA105 culture stocks are maintained in 30 % sterile glycerol (v/v), 1 mL aliquots in 2 mL Eppendorf tubes stored at -80 °C. 2. Both vectors pBI121/ricchi11 [7] and pBI121/gf2.8 [9] contain the selectable marker gene neomycin phosphotransferase II (nptII) for kanamycin and G418 resistance under the NOS promoter and the reporter gene β-glucuronidase (gus) driven by the cauliflower mosaic virus (CaMV) 35S promoter. In addition to these two genes, pBI121/ricchi11 contains the rice chitinase gene chi11 driven by the CaMV 35S promoter. In a separate construct, pBI121/gf2.8 contains the wheat oxalate oxidase gene gf2.8 driven by the gf2.8 promoter.

2.7 Other Supplies and Solutions

1. Sterilizing solution: 20 % commercial bleach (Clorox) which contains 1.25 % sodium hypochlorite as the active ingredient and one drop of detergent Tween-80. 2. Planting medium: Sunshine Mix 4 (Aggregate Plus): perlite mixture (2:1 v/v). 3. 2, 4, 8, and 14 in. diameter pots and plastic bags. 4. Fertilizer: Osmocote Classic (14:14:14) (Scotts), Professional Horticulture.

3

Methods

3.1 Establishment of In Vitro Plantlets

In vitro shoot or plantlet cultures are maintained under environmental conditions of 25 ± 2 °C, 16 h photoperiod at light intensity of 15 μmol/m2/s. In vitro shoot or plantlet cultures in liquid medium are placed on a shaker with shaking at 95 rpm under the same environmental conditions. In vitro callus cultures are maintained in the dark at 25 ± 2 °C: 1. Wash the cormels in running tap water for 5 min. 2. Excise approximately 1 cm3 cormel sections containing one primary shoot apex or axillary bud each section. 3. Immerse cormel cubes in 70 % ethanol with 1 drop of Tween-80 for 5 min. 4. Peel and remove cormel section outer layer tissues and pick and excise the 0.5–1.5 mm shoot tips from the center of shoot apices or axillary buds using a sterile needle. Microscope can be used to help find the shoot tips (see Note 1).

102

Xiaoling He et al.

5. Place shoot tips into a sterile petri dish containing surfacesterilizing solution (1.25 % sodium hypochlorite plus 1 drop of Tween-80) for 16 s (see Note 1). 6. Transfer shoot tips to another sterile petri dish containing sterile distilled H2O; lightly shake the petri dish by hand for 2 min to rinse the shoot tips. 7. Transfer the shoot tips to the test tubes containing 3 mL M15 liquid media, with one shoot tip per test tube. Shake culture for 2 months. Multiple shoots could be induced after 2 months (see Fig. 1a). ELISA assay for DsMV can be conducted at this stage (see Note 1). 8. Excise multiple DsMV-free shoots (approximately 10 mm in length) and transfer them to M5 petri dish plate for inducing calluses. Place these culture plates in the dark for 3–4 months. Subculture every month to remove brown and dead tissues.

Fig. 1 (a) The multiple shoots induced from one shoot tip explant in the M15 liquid media. (b) The calluses induced after transferring the DsMV-free shoots onto the M5 plate for 3–4 months. (c) The multiple shoots and plantlets induced after transferring the callus onto the M15 plate for 3–4 months. (d) The cocultivated calluses selected on the callus selection medium CSM. (e) The PCR-positive multiple shoots of the independent line C6 with the rice chitinase gene chi11 further selected on the stage two shoot selection medium SSM2. (f) The plantlets of the independent line g5 with the wheat oxalate oxidase gene gf2.8 further selected on the stage three shoot selection medium SSM3

Taro (Colocasia esculenta (L.) Schott)

103

Calluses should be induced after 3–4 months and can be maintained on the M5 plates for 2 years with subculturing every month (see Fig. 1b and Note 2). 9. Transfer calluses onto M15 petri dish plates for inducing shoots. Place these culture plates in the light for 3–4 months. Subculture every month to remove brown and dead tissues. Multiple shoots and plantlets can be induced after 3–4 months and can be maintained on the M15 plates for 7 years with subculturing every month (see Fig. 1c and Note 3). 3.2 Preparation of Agrobacterium Culture

1. Thaw the frozen Agrobacterium culture glycerol stocks EHA105/ricchi11 or EHA105/gf2.8 on ice and mix by gently tapping the Eppendorf tubes (see Note 4). 2. Streak a portion of the Agrobacterium EHA105/ricchi11 or EHA105/gf2.8 on the YEB media plate supplemented with 25 μg/mL rifampicin and 50 μg/mL kanamycin. 3. Incubate the inoculated plates at 28 °C for 48–72 h. These Agrobacterium culture plates can be used immediately or maintained at 4 °C within 1 month for future use. 4. Pick a single colony from the Agrobacterium culture plate and inoculate it into the 3 mL YEB medium containing 25 μg/mL rifampicin and 50 μg/mL kanamycin. Culture in an incubator shaker at 250 rpm, 28 °C for 48 h until the Agrobacterium suspension becomes turbid (check the OD600 = 0.8–1 by using a spectrophotometer). 5. Add 2 μl of 0.3 M acetosyringone (AS) to the Agrobacterium culture and mix well. Incubate in 28 °C, 95 rpm for 30 min (see Notes 5 and 7). Pour this 3 mL Agrobacterium + AS culture into 30 mL YEB medium in an Erlenmeyer flask for a dilution of tenfold. Stand in a bio-safe hood for 10 min (see Notes 6 and 7).

3.3 Infection and Cocultivation

1. Pour the 10 mL Agrobacterium + AS culture into a 9 cm sterile petri dish for infection. For control (no Agrobacterium) treatment, retain 10 mL of YEB media in a separate sterile petri dish. 2. Pick white soft calluses of taro and chop them into small pieces as infection targets (0.2–0.5 cm/callus) (see Note 7). Drop the calluses immediately in the Agrobacterium + AS culture. Immerse treatment calluses into the Agrobacterium + AS culture using sterile forceps. Immerse control calluses in YEB media similarly. Immerse 30–40 calluses in one petri dish at the same time. Immersion time in the Agrobacterium + AS culture is approximately 20 min for 30–40 calluses (see Note 7). 3. Transfer all infected calluses of the same treatment side by side onto a solid MS medium petri dish plate. Seal plates with Parafilm and cocultivate at 25 ± 2 °C in the dark for 4 days (see Notes 5 and 7).

104

Xiaoling He et al.

3.4 Selection and Regeneration for Independent Transgenic Lines

1. Transfer 30–40 cocultivated calluses of the same treatment to a 15 cm sterile petri dish containing sterile tissue paper. Blot and dry the calluses with the sterile tissue paper to remove excess Agrobacterium. 2. Transfer the calluses onto a callus selection medium (CSM) (see Note 8). Place 9–10 calluses side by side for each plate (see Fig 1d). 3. Incubate the plates in the dark at 25 ± 2 °C for 3 months. Subculture monthly onto fresh CSM plates. Examine at least once a week for any regrowth of Agrobacterium and subculture if necessary (see Note 9). After 3 months of selection, histochemical β-glucuronidase (GUS) assay and polymerase chain reaction (PCR) analysis can be conducted on approximately 1/3 of the surviving calluses to screen putative transgenic callus lines. 4. Transfer the PCR-positive callus lines to stage one shootinducing selection medium SSM1 (see Note 8). Place the selection plates under environmental conditions of 25 ± 2 °C, 16 h photoperiod at light intensity of 15 μmol/m2/s for 3 months. Subculture monthly onto fresh SSM1 plates. 5. After 3 months of selection, GUS assay and PCR analysis can be conducted using induced shoot tissue to screen the independent shoot lines. 6. Transfer PCR-positive multiple shoots of each independent shoot line onto separated stage two shoot selection medium SSM2. Place the selection plates under the same environmental conditions for 1 month (see Fig. 1e). 7. Transfer the healthy plantlets with normal morphology of each independent shoot line onto separate stage three shoot selection medium SSM3. Place the selection plates under the same environmental conditions for another month (see Fig. 1f). 8. Transfer the healthy plantlets of each independent line with normal morphology onto separate M15 medium plates. Place the plates under the same environmental conditions for another month. 9. Transfer the plantlets of each independent line into separate Magenta boxes with liquid M15 medium. Shake at 95 rpm under the same environmental conditions. Subculture the multiple plantlets by cutting and placing the roots and leaves monthly into fresh liquid M15 medium (see Note 10). 10. Molecular analyses including PCR, reverse transcription-PCR (RT-PCR), and Southern blot can be conducted using plantlet leaves of this stage to confirm the independent transgenic lines (see Note 11).

Taro (Colocasia esculenta (L.) Schott)

3.5

Transplanting

105

1. Transgenic plantlets confirmed by Southern blot can be transplanted to the pots containing nursery medium. In the month before transplanting, do not cut roots for subculturing, ensure roots of plantlets are immersed in the medium, and ensure that other parts of plantlets are floating on the medium without rafts. It is ready for transplanting when the size of plantlet is 5–7 cm in height and it has at least three roots (see Note 12). 2. Wash the plantlets in tap water to remove the M15 media and brownish, dead tissues. Separate the twisted roots carefully. 3. Transplant the individual plantlet into one 2 in. plastic pot filled with pre-watered planting medium described in Subheading 2.7. Gently press the plantlet roots in to the planting medium. Cover each pot using one plastic bag and seal it to maintain a high-moisture environment. 4. Place the pots in the growth room under environmental conditions of 25 ± 2 °C, 16 h photoperiod at light intensity of 15 μmol/m2/s for 1 month. Open the plastic bag after 2 weeks and remove the bag after 4 weeks. Water the individual plant every other day (see Note 13). 5. Move the entire plant and nursery medium from the 2 in. pot to the 4 in. pot. Fill the pots with the same pre-watered plant medium and gently press it. Culture the plants for another 1 month under the same environmental conditions as described in step 4. Water the individual plant every other day (see Note 13). 6. Move the entire plant and nursery medium from the 4 in. pot to 8 in. pot using the same method as described in step 5. Add approximately 2 g of slow-release fertilizer on the top of the planting medium around the plant. Water the individual plant every other day (see Note 13). Culture the plants for another month. 7. Move entire plant and the nursery medium from the 8 in. pot to 14 in. pot using the same method as described in step 5. Use the same fertilizing and watering method as described in step 6. 8. Bioassay of transgenic plants by taro pathogen Phytophthora colocasiae can be conducted using the leaves or whole plants at this stage, and the bioassay for pathogen Sclerotium rolfsii can be conducted using the whole plants.

4

Notes 1. Unlike other protocols of in vitro shoot tip culture, this protocol describes directly surface-sterilizing the 0.5–1.5 mm shoot tips for a very short time of 16 s. Using this protocol, contamination can be easily controlled and most explants remain

106

Xiaoling He et al.

healthy after surface sterilization. In addition, all ELISA tests for DsMV conducted in our shoot tip culture experiment were negative, indicating that this protocol is very efficient in eliminating DsMV. Most other protocols involve surface-sterilizing 1–1.5 cm corm sections first and then excising the 0.5–1.5 mm shoot tips under microscope, making it difficult to prevent microbial contamination. 2. Various protocols of inducing regenerative calluses for different taro cultivars have been reported. We also tested over 40 combinations of auxin (NAA or 2, 4-D) and cytokine (BA or kinetin), taro extract, or sucrose in media for inducing regenerative calluses of taro cultivars Bun Long and Maui Lehua [8, 16]. We found that the M5 medium is the best one among the 40 media for inducing highly regenerative calluses of Bun Long. However, regenerative calluses could not be produced from Maui Lehua on all media tested. 3. Various protocols of shoot regeneration for different taro cultivars have been reported [4–6, 8, 16]. We also tested [8, 16] several media with different plant hormones for inducing multiple shoots from Bun Long, and we found M15 medium was the best for multiple shoot production. 4. In another experiment [16], we tested the effect of Agrobacterium strains on Agrobacterium-mediated transformation of taro cv. Bun Long using Agrobacterium strains EHA105 and LBA4404 harboring same binary vector pCNL65 containing GUS gene. EHA105 showed high GUS expression level, but LBA4404 showed no GUS activity at all, indicating LBA4404 is ineffective for transformation of taro using this protocol. 5. In another experiment [16], we tested the effect of acetosyringone and cocultivation time on transformation of Bun Long using EHA105/pCNL65 by evaluating the GUS expression efficiency. Based on our results, 20 μM acetosyringone and 4 days of cocultivation showed the highest transformation efficiency. 6. Many other protocols use original Agrobacterium suspensions (approximately OD600 = 0.8–1) to infect and cocultivate with target explants. We found that it was very difficult to remove the overgrowth Agrobacterium if we used such high concentrations of EHA105. Therefore, in this protocol, we diluted the EHA105 tenfold to prevent the Agrobacterium overgrowth problem. 7. To ensure effective infection of Bun Long with EHA105, we made cutting wounds by slicing the calluses (0.2–0.5 cm/callus) and extended the time of EHA105 and AS mixing, the time of immersion of calluses and EHA105, and cocultivation from the original protocol.

Taro (Colocasia esculenta (L.) Schott)

107

8. The selection gene nptII confers resistance to kanamycin or Geneticin G418. Many other protocols use kanamycin as the selection antibiotic. In this protocol, we use Geneticin G418 as the selection antibiotic, because we found that non-transformed Bun Long calluses and shoots could be grown on a high concentration of kanamycin (200 mg/L), indicating that the selection stress of kanamycin is low for taro cv. Bun Long. We found that the 50 mg/L of Geneticin G418 was an optimal concentration to select transgenic lines of taro [16]. 9. Normally, there is very little Agrobacterium regrowth due to the low concentration of the Agrobacterium suspension used. If there is Agrobacterium overgrowing on calluses, these calluses should be washed using 250 mg/L cefotaxime solution and blotted on sterile tissue paper before transferring to fresh CSM medium. 10. Both solid and liquid M15 medium can be used for fast micropropagation of multiple shoots. Normally, liquid M15 medium produces more multiple shoots, but it is more susceptible to microbial contamination than solid M15 medium. 11. Chimeric transformed calluses and shoots can occur and some non-transformed events can escape the selection stress. Therefore, molecular analyses PCR and Southern blot should be conducted to confirm the successful transformation of lines and copy numbers of the transgene. 12. Roots and leaves will grow if multiple shoots are cultured in M15 medium. There is no need to transfer to a specific rooting medium. Normally, roots grow faster and healthier in liquid M15 medium than in solid M15 medium. 13. Normally, no watering is needed before opening the plastic bag, but you will need to check the planting media moisture every other day by observing if there are water drops in the bag. After the plastic bag is removed, more watering is needed. Typically, plants can be watered every other day, but you should check the planting media every day to ensure that moisture is adequate. References 1. Kreike CM, Van Eck HJ, Lebot V (2004) Genetic diversity of taro, Colocasia esculenta (L.) Schott, in Southeast Asia and the Pacific. Theor Appl Genet 109:761–768 2. Food and Agriculture Organization of the United Nations (FAO) (2010) http://faostat.fao.org/ 3. Cho JJ, Yamakawa RA, Hollyer J (2007) Hawaiian Kalo, past and future. Univ. of Hawaii, College of Trop. Agr. and Human Resources. SA-1 4. Chand H, Pearson MN, Lovell PH (1999) Rapid vegetative multiplication in Colocasia

esculenta (L) Schott (taro). Plant Cell Tiss Org Cult 55:223–226 5. Fukino N, Hanada K, Ajisaka H (2000) Transformation of taro (Colocasia esculenta Schott) using particle bombardment. JARQ 34(3):159–165 6. Hartman RD (1974) Dasheen mosaic virus and other phytopathogens eliminated from caladium, taro, and cocoyam by culture of shoot tips. Phytopathology 64:237–240 7. He X, Miyasaka SC, Fitch MM, Zhu YJ, Moore P (2008) Agrobacterium tumefaciens-mediated

108

8.

9.

10.

11.

Xiaoling He et al. transformation of taro (Colocasia esculenta (L.) Schott) with a rice chitinase gene for improved tolerance to a fungal pathogen Sclerotium rolfsii. Plant Cell Rep 27:903–909 He X, Miyasaka SC, Fitch MM, Zhu YJ (2010) Regeneration and transformation of taro (Colocasia esculenta) with a rice chitinase gene enhances resistance to Sclerotium rolfsii. HortScience 45:1014–1020 He X, Miyasaka SC, Fitch MM, Khuri S, Zhu YJ (2013) Taro (Colocasia esculenta) transformed with a wheat oxalate oxidase gene for improved resistance to taro pathogen Phytophthora colocasiae. HortScience 48(1):22–27 Murakami K, Kimura M, Matsubara S (1995) Plant regeneration from protoplasts isolated from callus of taro. J Jpn Soc Hortic Sci 63(4):773–778 Deo PC, Harding RM, Taylor M, Tyagi AP, Becker DK (2009) Somatic embryogenesis, organogenesis and plant regeneration in taro

12.

13.

14.

15.

16.

(Colocasia esculenta var. esculenta). Plant Cell Tiss Org Cult 99:61–71 Ooka JJ (1994) Taro diseases, a guide for field identification. Univ of Hawaii, Hawaii Inst Trop Agr Human Res, Res. Ext. Ser. 148. pp 13 Ivancic A, Lebot V, Roupsard O, QueroGarcia J, Okpul T (2004) Thermogenic flowering of taro (Colocasia esculenta, Araceae). Can J Bot 82:1557–1565 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 Hood EE, Gelvin SB, Melchers S, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants (EHA105). Trans Res 2:208–218 He X (2006) Transformation and regeneration of taro with two plant disease resistance genes: a rice chitinase gene and a wheat oxalate oxidase gene. Ph D dissertation. University of Hawaii. ProQuest, UMI number: 3251049

Part III Nuts and Fruits

Chapter 10 Apricot (Prunus armeniaca L.) César Petri, Nuria Alburquerque, and Lorenzo Burgos Abstract A protocol for Agrobacterium-mediated stable transformation of whole leaf explants of the apricot (Prunus armeniaca) cultivars ‘Helena’ and ‘Canino’ is described. Regenerated buds were selected using a two-step selection strategy with paromomycin sulfate and transferred to bud multiplication medium 1 week after they were detected for optimal survival. After buds were transferred to bud multiplication medium, antibiotic was changed to kanamycin and concentration increased gradually at each transfer to fresh medium in order to eliminate possible escapes and chimeras. Transformation efficiency, based on PCR analysis of individual putative transformed shoots from independent lines, was 5.6 %. Green and healthy buds, surviving high kanamycin concentration, were transferred to shoot multiplication medium where they elongated in shoots and proliferated. Elongated transgenic shoots were rooted in a medium containing 70 μM kanamycin. Rooted plants were acclimatized following standard procedures. This constitutes the only transformation protocol described for apricot clonal tissues and one of the few of Prunus. Key words Agrobacterium tumefaciens, Apricot, Fruit trees, Prunus armeniaca, Rosaceae

1

Introduction Fruit trees are among the most recalcitrant of plants to regenerate adventitious shoots from cultured explants. In most woody fruit species, transformation and regeneration are generally difficult and often limited to a few genotypes or to seedlings [1]. This feature is the major limiting factor preventing the development of gene transfer technologies for fruit trees. Apricot (Prunus armeniaca L.) is not an exception. For many years our research group at CEBAS-CSIC in Murcia (Spain) has been working in the development of a reproducible and efficient procedure of apricot transgenic shoots regeneration by using clonal tissues as the source of the explants. Back in the late 1990s, some commercial cultivars were established in vitro and successfully micropropagated, as the first requirement for regeneration and transformation protocols [2, 3]. At this point, an adventitious shoot regeneration protocol from clonal mature tissues (leaves) was developed and later optimized

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_10, © Springer Science+Business Media New York 2015

111

112

César Petri et al.

reaching regeneration rates of around 80 and 60 % for the cultivars ‘Helena’ and ‘Canino’, respectively [4, 5]. Several factors affecting gene transfer mediated by Agrobacterium tumefaciens were studied [6, 7], and different antibiotics for nptII-based selection (aminoglycoside antibiotics) were tested in apricot [8]. With these previous studies, we observed and demonstrated stable transformation and expression of foreign genes in apricot, but no transformed shoot was obtained. Selection strategy and bud recovery resulted as key factors for transgenic shoot regeneration, and only when selection was gradually increased transformed shoots were obtained [9, 10]. More recently this protocol, or modifications, has been used combined with MAT or Cre-loxP system for “marker-free” transformed apricot shoot regeneration [11, 12]. With the protocol we described in this chapter, transformation efficiencies up to 5.6 % were reached for the ‘Helena’ apricot cultivar, comparable to those described for other woody species when mature tissues were used as the source of explants [1].

2

Materials

2.1 Agrobacterium tumefaciens Strain and Vector

Agrobacterium tumefaciens strain EHA105, derivative of A281, carrying the binary plasmid pBin19-sgfp [13] or p35SGusint [14] has been used. The T-DNA of both plasmids contains the nptII gene (the selectable marker gene, conferring aminoglycoside antibiotics resistance to transformed cells) under control of the nopaline synthase promoter and terminator (NOS) and the reporter gene (sgfp or uidA) under control of the 35S promoter and the NOS terminator (see Note 1).

2.2

Plant Material

First four expanded leaves from in vitro apricot shoots of ‘Helena’ or ‘Canino’ cultivars.

2.3

Stock Solutions

2.3.1 Basal Salt Stock Solutions

1. QL macronutrients [15] solution (10×): Dissolve 4 g of NH4NO3 and 12 g of Ca(NO3)2·4H2O in 300 mL ddH2O. In a separate container, dissolve 3.6 g of MgSO4·7H2O, 18 g of KNO3, and 2.7 g of KH2PO4 in 300 mL. When everything is dissolved, mix together and add water to a final volume of 1 L (see Note 2). Store at 4 °C for several months. 2. DKW micronutrient and vitamin [16] solution (100×): Dissolve in 200 mL ddH2O 120 mg of H3BO3, 6.25 mg of CuSO4·5H2O, 837.5 mg of MnSO4·H2O, 9.75 mg of Na2MoO4·2H2O, 425 mg of ZnSO4·7H2O, 845 mg of FeSO4·7H2O, 1,256.5 mg of Na2-EDTA·2H2O, 50 mg of glycine, 2,500 mg of myoinositol, 25 mg of nicotinic acid, and 50 mg of thiamine. When everything is dissolved, add ddH2O to a final volume of 250 mL. Store at 4 °C and protect from light. Keep for a maximum of 2 months.

Apricot (Prunus armeniaca L.) 2.3.2 Vitamins and Phytohormones

113

1. 6-Benzylaminopurine riboside (BA-riboside, 0.56 mM): Dissolve 20 mg BA in 1 mL 1 N NaOH. Add ddH2O to 100 mL final volume. Store at 4 °C up to 4 weeks (see Note 3). 2. 3-Indolebutyric acid (IBA, 1.23 mM): Dissolve 25 mg IBA in 1 mL 1 N NaOH. Add ddH2O up to 100 mL final volume. Store at 4 °C. 3. 6-(3-Hydroxybenzylamino) purine (meta-topolin, 0.84 mM): Dissolve 20 mg meta-topolin in 1 mL 1 N NaOH. Add ddH2O to 100 mL final volume. Store at 4 °C. 4. Adenine (3.7 mM): Dissolve 50 mg adenine in hot water. Add ddH2O to 100 mL final volume. Store at 4 °C. 5. Thidiazuron (TDZ, 23 mM): Dissolve 25 mg TDZ in 5 mL dimethyl sulfoxide (DMSO). Store at 4 °C up to 4 weeks. 6. α-Naphthaleneacetic acid (NAA, 34 mM). Dissolve 25 mg NAA in 1 mL 1 N NaOH. Add ddH2O up to 100 mL final volume. Store at 4 °C. 7. 2,4-Dichlorophenoxyacetic acid (2,4-D, 2.26 mM). Dissolve 50 mg 2,4-D in 3 mL 96 % ethanol. Add ddH2O up to 100 mL final volume. Store at 4 °C.

2.3.3 Antibiotics

1. Nalidixic acid (10 mg/mL): Dissolve in 0.1 N NaOH, filter sterilize, and store at −20 °C in aliquots. 2. Rifampicin (50 mg/mL): Dissolve in DMSO, filter sterilize, and store at −20 °C in aliquots. 3. Kanamycin sulfate (KAN, 50 mg/mL): Dissolve 500 mg in 10 mL ddH2O, filter sterilize, and store at −20 °C in aliquots. 4. Paromomycin sulfate (PAR, 50 mg/mL): Dissolve 500 mg in 10 mL ddH2O, filter sterilize, and store at −20 °C in aliquots. 5. Cefotaxime (CEF, 50 mg/mL): Dissolve 500 mg in 10 mL ddH2O, filter sterilize, and store at −20 °C in aliquots. 6. Vancomycin (VAN, 50 mg/mL): Dissolve 500 mg in 10 mL ddH2O, filter sterilize, and store at −20 °C in aliquots.

2.3.4 Others

1. Acetosyringone (AS, 0.1 mM): Dissolve 0.0981 g AS in 5 mL DMSO and store at 4 °C for 1 week. 2. Silver thiosulfate [Ag(S2O3)2]3 (STS, 4.65 mM): Dissolve 295 mg de Na2S2O3 in 50 mL ddH2O. Dissolve 79 mg AgNO3 in 50 mL ddH2O. Add the second solution on the first one mixing continuously, and store at 4 °C.

2.4

Culture Media

2.4.1 For Agrobacterium

1. Liquid Luria-Bertani medium (LB): Dissolve 20 g of LB broth powder (Reference 1231.00, Conda Laboratories) in 800 mL ddH2O. Adjust pH to 7.0 with NaOH, and make up to 1,000 mL final volume with ddH2O sterilizing by autoclaving. Store at room temperature and add antibiotics as necessary to culture Agrobacterium strains containing plasmids of interest.

114

César Petri et al.

2. Solid LB medium: Add 15 g/L Plant Propagation Agar (Conda Laboratories) to LB. Cool down the medium to 45–50 °C. Add antibiotics as necessary. 3. Bacterial simplified induction medium (SIM) [17]: 20 mM sodium citrate, 2 % (w/v) sucrose (pH 5.5) and 500 μM AS. Dissolve in ddH2O sodium citrate and sucrose. Adjust pH to 5.5 with KOH. Sterilize the induction medium by autoclaving. Cool down the medium to 45–50 °C. Add filter-sterilized AS after autoclaving. 2.4.2 For Apricot

1. Shoot multiplication medium (SMM): Mix QL macronutrients and DKW micronutrients, vitamins and organic compounds, 3 % sucrose, and 0.7 % (w/v) Plant Propagation Agar (Conda Laboratories). SMM is supplemented with 3 mM CaCl2, 1.12 μM BA-riboside, 0.05 μM IBA, 2.1 μM meta-topolin, and 29.6 μM adenine. 2. Rooting medium (RM): Consists of the same basal salts than SMM supplemented with 2 % sucrose and 0.7 % (w/v) Plant Propagation Agar (Conda Laboratories). Additionally, the medium is supplemented with 1.5 mM CaCl2, 0.8 mM phloroglucinol, 20 mM IBA, and 29.6 μM adenine. 3. Shoot regeneration medium (SRM): Mix QL macronutrients, DKW micronutrients and vitamins, 3 % (w/v) sucrose, 9 μM TDZ, 4 μM NAA, and 0.7 % (w/v) Plant Propagation Agar (Conda Laboratories), and sterilize by autoclaving. 4. Cocultivation medium: SRM supplemented with 9.05 μM of 2,4-D. Add filter-sterilized 100 μM AS. 5. Selection medium (SM): SRM supplemented with filtersterilized 60 μM STS, 0.63 mM CEF, 0.13 mM VAN, and 20 μM PAR. 6. Bud multiplication medium (BMM): Mix QL salt medium (Duchefa, Haarlem, the Netherlands. Reference Q0251 powder), 3 % (w/v) sucrose, 6.65 μM BA, 0.05 μM IBA, and 0.7 % (w/v) Plant Propagation Agar (Conda Laboratories). Autoclave to sterilize. Cool down the medium to 45–50 °C. Add filter-sterilized 0.63 mM CEF, 0.13 mM VAN, and 40 μM PAR. The pH of all media was adjusted to 5.7 before adding the agar and autoclaving (see Note 4).

3

Methods

3.1 Growing Donor Plants for Leaf Regeneration

1. In vitro apricot shoots from cvs. ‘Helena’ or ‘Canino’ are maintained by subculturing at 3-week intervals on a shoot multiplication medium (SMM), at 22 ± 1 °C under cool white fluorescent tubes (55 μmol/m2/s) with a 16 h photoperiod (Fig. 1a) (see Note 5).

Apricot (Prunus armeniaca L.)

115

Fig. 1 Apricot leaf transformation. The four younger, expanded leaves from apricot micro shoots (a) are detached and cut two or three times perpendicular to the midrib but without fully separating the segments (b). After Agrobacterium infection, coculture and transfer to regeneration medium adventitious buds regenerated from the reactive leaves (c). Regenerated buds have to be rescued as soon as possible for optimal survival and transferred to bud multiplication medium where selection is increased gradually until 100–140 μM kanamycin is reached. Only surviving, green, and healthy buds (d) are then transferred to selective shoot multiplication medium where they elongate in shoots and proliferate (e). Finally elongated shoots can be rooted in selective medium (f) and acclimatized (g). Bar represents 1 cm

3.2 Explants Preparation

1. Collect the first four apical expanding leaves from 3-week-old proliferating shoots, place them in liquid SRM (SRM without agar), and swirl to randomize. 2. Place explants on a sterile filter paper (Fig. 1b) and cut each leaf transversely three or four times across the midrib without fully separating the segments (see Note 6).

3.3 Agrobacterium Culture and Preparation

1. Culture the bacterium overnight in 25 mL LB with the proper antibiotics on a 100 rpm shaker at 28 °C. For EHA105 chromosomal resistance selection we used 100 mg/L rifampicin or 25 mg/L nalidixic acid. For pBin-sgfp or p35SGusint plasmid selection 50 mg/L kanamycin was used. 2. Spin down the bacterium culture (986 × g; 15 min at room temperature). 3. Resuspend the bacteria in 25 mL bacterial SIM. 4. Dilute the bacterial suspension in SIM, containing 500 μM AS, to OD600 = 0.2. 5. Incubate the bacterium from 5 h to overnight in SIM plus AS on a 100 rpm shaker at 25 °C.

116

César Petri et al.

6. Spin down the bacterium (3,000 rpm; 15 min at room temperature). 7. Resuspend the bacterium in liquid SRM and dilute to OD600 = 0.02. 3.4

Coculture

1. Place the leaf explants in the bacterium suspension for 10 min. 2. Dry the explants on a sterile filter paper and place them on the cocultivation medium. 3. Transfer the explants to SRM supplemented with 100 μM AS and 9.05 μM of 2,4-D. Seal the petri dishes and incubate them in the dark at 22 ± 1 °C for 4 days.

3.5 Washing (See Note 7)

1. After coculture, rinse the explants briefly in liquid SRM supplemented with 1.26 mM CEF and 0.26 mM VAN. 2. Dry the explants on sterile filter paper.

3.6 Transgenic Shoot Regeneration

1. Transfer explants on SRM supplemented with 60 μM STS, 0.63 mM CEF, 0.13 mM VAN, and 20 μM PAR in petri plates (see Note 8). 2. After 10 days transfer the explants to the same medium with 40 μM PAR for the remainder of the experiment. 3. Explants are cultivated for 2 weeks in the dark and then they are transferred to light with a 16 h photoperiod and 55 μmol/ m2/s light intensity. 4. Subculture of leaf explants to fresh medium must be done every 4 weeks. 5. After 5–6 weeks, buds start appearing (Fig. 1c). 6. Rescue all regenerated buds the week after they are detected, transferring them onto BMM supplemented with 40 μM KAN (see Note 9), 0.63 mM CEF, and 0.13 mM VAN. 7. All regenerated buds are subcultured every 4 weeks to BMM medium with increasing antibiotic concentration. Every cycle the kanamycin concentration is increased in 20 μM up to the final concentration of 100–140 μM (see Note 10).

3.7 Transgenic Shoot Elongation and Multiplication

1. Transfer only green and healthy buds or meristem aggregates to SMM (Fig. 1d) supplemented with 100–140 μM KAN, 0.63 mM CEF, and 0.13 mM VAN for transgenic shoot elongation and multiplication (see Note 11).

3.8

1. Shoots of 2–4 cm in length, growing in selective SMM (Fig. 1e), are transferred to RM supplemented with 70 μM KAN (see Note 12).

Rooting

Apricot (Prunus armeniaca L.)

3.9

Acclimatization

117

1. Transgenic plants are acclimated following standard procedures. In optimal conditions high-frequency acclimatization (70–80 %) can be obtained. 2. Transfer rooted explants (Fig. 1f) to a 200 cc pots containing a mixture of peat and perlite (2:1). Acclimatization of plants occurs within a tunnel with >85 % relative humidity, achieved by means of intermittent mist. For hardening plants, the plastic covering the tunnel is opened gradually for a few minutes a day until normal greenhouse conditions can be maintained without desiccation of the plants. 3. The acclimatization period is 15 days, and then acclimated plants are transferred to a 2.5 L pot and maintained in the greenhouse (Fig. 1g).

4

Notes 1. As an example in this protocol, sgfp or uidA reporter genes have been used for monitoring the transgenic shoot regeneration. These genes may be substituted for the gene of interest in each case. 2. Dissolving all salts in the same recipient may lead to some salts precipitation. 3. We recommend making fresh stock solution after 4 weeks for all growth regulator stock solutions. 4. Autoclave all media at 121 °C for 20 min. 5. Shoot multiplication medium composition is a key factor for the subsequent successful adventitious bud regeneration [5]. Different apricot cultivars may need a different multiplication medium. 6. Proceed to this step with a few explants at a time to avoid explant dehydration. 7. This step is only necessary if overgrowth of Agrobacterium is observed after coculture; otherwise go to Subheading 3.6. 8. Culture a maximum of seven leaves per petri dish. 9. Paromomycin was the only aminoglycoside antibiotic tested that allowed the production of transgenic buds at the early regeneration stages [10]. However, this antibiotic did not effectively kill the escaped buds once they regenerated and did not produce bleaching. We have found that kanamycin is much more aggressive, producing bleaching and killing nontransgenic buds (Fig. 2).

118

César Petri et al.

Fig. 2 Elimination of escapes and chimeras by culturing buds in multiplication medium with increasing kanamycin concentrations. The differential effect of the antibiotic eliminating escapes and chimeras can be observed in a petri dish (a) but also within a developed bud, where green and healthy meristems are appearing in a bud with bleached leaves and necrotic areas (b)

10. In our experience most of the regenerated buds are chimeras. Maintaining them in a medium that stimulate the production of new meristems and progressively increasing the selection allow the elimination of escapes and chimeras. 11. Still in this step it is possible to detect chimeras, but only uniformly transgenic buds will be able to elongate and proliferate in this antibiotic concentration. Collect only the green and vigorous shoots able to proliferate, and discard chlorotic or non-vigorous shoots; they probably are escapes or chimeras. 12. Rooting of all shoots is not to be expected since it does not happen even in standard conditions. However, rooted shoots should develop a good rooting system with secondary roots (Fig. 1f). References 1. Petri C, Burgos L (2005) Transformation of fruit trees. Useful breeding tool or continued future prospect? Transgenic Res 14:15–26 2. Pérez-Tornero O, Burgos L (2000) Different media requirements for micropropagation of apricot cultivars. Plant Cell Tiss Organ Cult 63:133–141 3. Pérez-Tornero O, Burgos L, Egea J (1999) Introduction and establishment of apricot in vitro through the regeneration of shoots from meristem tips. In Vitro Cell Dev Biol Plant 35:249–253 4. Pérez-Tornero O, Egea J, Vanoostende A, Burgos L (2000) Assessment of factors affecting adventitious shoot regeneration from in

vitro cultured leaves of apricot. Plant Sci 158: 61–70 5. Burgos L, Alburquerque N (2003) Low kanamycin concentration and ethylene inhibitors improve adventitious regeneration from apricot leaves. Plant Cell Rep 21:1167–1174 6. Petri C, Alburquerque N, García-Castillo S, Egea J, Burgos L (2004) Factors affecting gene transfer efficiency to apricot leaves during early Agrobacterium-mediated transformation steps. J Hortic Sci Biotechnol 79:704–712 7. Petri C, Alburquerque N, Pérez-Tornero O, Burgos L (2005) Auxin pulses and a synergistic interaction between polyamines and ethylene inhibitors improve adventitious regeneration

Apricot (Prunus armeniaca L.)

8.

9.

10.

11.

12.

from apricot leaves and Agrobacteriummediated transformation of leaf tissues. Plant Cell Tiss Organ Cult 82:105–111 Petri C, Alburquerque N, Burgos L (2005) The effect of aminoglycoside antibiotics on the adventitious regeneration from apricot leaves and selection of nptII-transformed leaf tissues. Plant Cell Tiss Organ Cult 80:271–276 Petri C, Wang H, Alburquerque N, Faize M, Burgos L (2008) Agrobacterium-mediated transformation of apricot (Prunus armeniaca L.) leaf explants. Plant Cell Rep 27: 1317–1324 Petri C, López-Noguera S, Alburquerque N, Egea J, Burgos L (2008) An antibiotic-based selection strategy to regenerate transformed plants from apricot leaves with high efficiency. Plant Sci 175:777–783 Petri C et al (2012) A chemical-inducible CreLoxP system allows for elimination of selection marker genes in transgenic apricot. Plant Cell Tiss Organ Cult 110:337–346 López-Noguera S, Petri C, Burgos L (2009) Combining a regeneration-promoting gene

13. 14.

15.

16.

17.

119

and site-specific recombination allows a more efficient apricot transformation and the elimination of marker genes. Plant Cell Rep 28: 1781–1790 Chiu C et al (1996) Engineered GFP as a vital reporter in plants. Curr Biol 6:325–330 Vancanneyt G, Schmidt R, O’Connor-Sanchez A, Willmitzer L, Rocha-Sosa M (1990) Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol Gen Genet 220:245–250 Quoirin M, Lepoivre P (1977) Etude de milieux adaptes aux cultures in vitro de Prunus. Acta Hortic 78:437–442 Driver JA, Kuniyuki AH (1984) In vitro propagation of Paradox walnut rootstock. HortScience 19:507–509 Alt-Mörbe J, Kühlmann H, Schröder J (1989) Differences in induction of Ti plasmid virulence genes virG and virD and continued control of virD expression by four external factors. Mol Plant-Microbe Interact 2:301–308

Chapter 11 Blueberry (Vaccinium corymbosum L.) Guo-Qing Song Abstract Vaccinium consists of approximately 450 species, of which highbush blueberry (Vaccinium corymbosum) is one of the three major Vaccinium fruit crops (i.e., blueberry, cranberry, and lingonberry) domesticated in the twentieth century. In blueberry the adventitious shoot regeneration using leaf explants has been the most desirable regeneration system to date; Agrobacterium tumefaciens-mediated transformation is the major gene delivery method and effective selection has been reported using either the neomycin phosphotransferase II gene (nptII) or the bialaphos resistance (bar) gene as selectable markers. The A. tumefaciens-mediated transformation protocol described in this chapter is based on combining the optimal conditions for efficient plant regeneration, reliable gene delivery, and effective selection. The protocol has led to successful regeneration of transgenic plants from leaf explants of four commercially important highbush blueberry cultivars for multiple purposes, providing a powerful approach to supplement conventional breeding methods for blueberry by introducing genes of interest. Key words Agrobacterium tumefaciens, Genetic transformation, Leaf explant, plant regeneration, Transgenic plant

1

Introduction Vaccinium is a genus of terrestrial shrubs in the family Ericaceae (Syn. Heath) [1]. It consists of approximately 450 species, of which three Vaccinium fruit crops (blueberry, cranberry, and lingonberry) have been domesticated since the twentieth century [2]. Vaccinium crops are economically important fruit crops due in part to their exceptional nutritional value and high amounts of antioxidants and anti-inflammatory capacities that benefit human health [3]. Highbush blueberry (Vaccinium corymbosum L.) is by far the most important commercial blueberry (Vaccinium sp.), a highly heterozygous, polyploid crop [4]. To date, all blueberry cultivars have been generated exclusively through the traditional breeding approaches (i.e., controlled hybridization and deliberate selection). In general, it takes over 10 years to produce a finished cultivar through these approaches. A major limitation is that not every

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_11, © Springer Science+Business Media New York 2015

121

122

Guo-Qing Song

desirable trait can be easily found in the natural germplasm pool. In addition, the multiple gene exchanges involved in intra- or interspecific hybridizations lead to uncontrollable transfer of both desirable and undesirable genes to progeny; thus, the unique traits that make a variety special can be hard to regain after hybridization without the simultaneous inclusion of negative traits from the other parent. Genetic transformation can supplement and extend traditional breeding methods through direct and precise manipulation of individual genes of interest for blueberry improvement [5]. To date, we have developed a reliable transformation protocol for blueberry cultivars [6, 7] through which we obtained transgenic blueberry plants and conducted the first field trial of transgenic blueberry with herbicide resistance in 2006 [8, 9]. In 2009, we transformed a blueberry C-repeat binding factor (CBF) gene (GenBank AF234316) into a southern highbush blueberry cultivar Legacy (a more coldsensitive cultivar); transgenic blueberry plants overexpressing the endogenous CBF gene showed promise for increasing freezing tolerance [10]. More recently, we isolated a blueberry FLOWERING LOCUS T (FT)-like gene (VcFT) from the cDNA of a tetraploid northern highbush blueberry cv. Bluecrop. Overexpression of the VcFT is able to reverse the photoperiodic and chilling requirements and drive early and continuous flowering [11]. So far, there was no evidence that the transgenes were unstable in transgenic blueberry plants [12]. These results demonstrate the unique value of genetic transformation for blueberry breeding. As the genome of blueberry has been sequenced and become available, more genes of interest will be identified and isolated. Genetic transformation will be a power tool that allows us to evaluate these genes as to their functions. We established a protocol for transformation of highbush blueberry cultivars by Agrobacterium tumefaciens [6]. Briefly, leaf explants of the cultivars Aurora, Bluecrop, Brigitta, and Legacy are inoculated with strain EHA105 containing the binary vector pBISN1 with the neomycin phosphotransferase gene (nptII) and an intron-interrupted GUS reporter gene (gusA). Cocultivation is for 6 days on modified McCown’s Woody Plant Medium (WPM) [13] containing 100 μM acetosyringone in the dark. Explants are then placed on selection medium [modified WPM plus 1.0 mg/L thidiazuron (TDZ), 0.5 mg/L α-naphthaleneacetic acid (NAA), 10 mg/L kanamycin monosulfate (Km), and 250 mg/L cefotaxime] in the dark for 2 weeks, followed by culture in the light at 30 μE/m2/s at 25 °C. Proliferation of Km-resistant shoots is performed on WPM containing 1.0 mg/L zeatin, 20 mg/L Km, and 250 mg/L cefotaxime. The transformation protocol yields Km-resistant GUS-positive shoots that are also polymerase chain reaction (PCR) positive at frequencies, defined as the percentage of inoculated explants that produced GUS- and PCR-positive shoots, of 15.3 % for Aurora, 5.0 % for Bluecrop, 10.0 % for Brigitta, and 5.6 % for Legacy. Stable integration of gusA

Blueberry (Vaccinium corymbosum L.)

123

was confirmed by Southern hybridization [6]. The A. tumefaciensmediated transformation protocol described in this chapter is routinely used in our laboratory.

2 2.1

Materials Plant Material

1. Starting plant materials: 1-year-old softwood branches of highbush blueberry cvs. Aurora (Michigan State University cv.), Bluecrop, Brigitta, and Legacy, preferably taken from greenhouse-grown plants. 2. Leaf explants are taken from in vitro cultured stock shoots.

2.2 Bacterial Strains and Binary Vector

1. Leaf explants of blueberry cultivars are susceptible to all three A. tumefaciens strains EHA105 [14], LBA4404 [15], and GV3101 [16]. These A. tumefaciens strains are stored in 20 % sterile glycerol (v/v) at −80 °C (see Note 1). 2. Binary vectors contain either the nptII gene conferring Km resistance or the bialaphos resistance (bar) gene (see Note 2).

2.3 Culture Medium and Stock Solutions

Media pH is adjusted with 1 N NaOH or 1 N HCl before adding the agar and autoclaving (see Note 3). Double-distilled water (ddH2O) is used unless otherwise mentioned. All media are autoclaved at 121 °C for 20 min at 105 kPa. Kept at room temperature, the media can be used in a week; otherwise, stored at 4 °C up to 2 weeks. Sterile stock solutions of zeatin, Km, cefotaxime, timentin, and acetosyringone are added to liquid medium with agar cooled to 50–60 °C or to liquid medium at room temperature after autoclaving: 1. Stock culture medium (WPMZ) [17]: 2.3 g/L WPM Basal Salt Mixture, 1 mL 1,000× Murashige and Skoog (MS) [18] vitamin solution, 556 mg/L Ca(NO3)2·4H2O, 4 mg/L zeatin or zeatin riboside, 20 g/L sucrose, 6 g/L Bacto™ agar, pH 5.2. Magenta® GA7/GA7-3 boxes, or 40 mm × 110 mm glass jars with caps are used for shoot cultures. 2. WPM4Z: WPMZ containing 4 mg/L zeatin or zeatin riboside (see Note 4). 3. WPM2Z: WPMZ containing 2 mg/L zeatin or zeatin riboside (see Note 5). 4. McCown’s Woody Plant Medium salts (100×): (A) 40 g NH4NO3, 68.4 g Ca(NO3)2·4H2O; (B) 17 g KH2PO4, 0.62 g H3BO3, 0.025 g Na2MoO4·2H2O; (C) 19 g KNO3; (D) 37 g MgSO4·7H2O, 2.23 g MnSO4·H2O, 0.86 g ZnSO4·7H2O, 0.025 g CuSO4·5H2O; (E) 7.34 g C10H13FeN2NaO8 (ethylenedinitrilotetraacetic acid (EDTA) ferric sodium salt). Make up to 1 L with ddH2O. Store at 4 °C after autoclaving.

124

Guo-Qing Song

5. Modified McCown’s Woody Plant Medium (MWPM): 10 mL 100× McCown’s Woody Plant Medium salts, 1 mL 1,000× MS vitamins, 20 g/L sucrose, 6 g/L Bacto™ agar. 6. Regeneration medium (RM): MWPM containing 1 mg/L TDZ, 0.5 mg/L NAA, pH 5.2 (see Note 6). Alternatively, use commercial WPM Basal Salt Mixture, MS vitamins, 556 mg/L Ca(NO3)2·4H2O, 20 g/L sucrose, 6 g/L Bacto™ agar, pH 5.2 (herein WPMC), 1 mg/L TDZ , and 0.5 mg/L NAA [19] (see Note 7). 7. Cocultivation medium: RM plus 100 μM acetosyringone, 20 g/L sucrose, 6 g/L Bacto™ agar (for solidified medium), pH 5.2. 8. Selection medium: RM containing 250 mg/L cefotaxime (or timentin), 10 mg/L Km (see Note 8) when the nptII gene is the selectable marker, or 0.1 mg/L glufosinate ammonium when the bar gene is the selectable marker. 9. Shoot proliferation medium for transformants: WPM4Z containing 250 mg/L cefotaxime (or timentin), 20 mg/L Km (see Note 9) when the nptII gene is the selectable marker, or 0.5 mg/L glufosinate ammonium when the bar gene is the selectable marker. 10. Agrobacterium culture medium (YEB [20]): 1 g/L Bacto™ Yeast Extract, 5 g/L beef extract, 5 g/L peptone, 0.5 g/L MgSO4·7H2O, 5 g/L sucrose, 15 g/L Bacto™ agar (for solidified medium), pH 7.0 (see Note 10). 11. Stock solution of plant growth regulators: 1 mg/mL TDZ in dimethyl sulfoxide (DMSO) and 1 mg/mL NAA store at 4 °C up to 6 months. Zeatin in solvent 1 N NaOH is diluted to 1 mg/mL with ddH2O, filter-sterilized through 0.22 μm Millex®-GV filters, and stored in aliquots at −20 °C. 12. Antibiotic stock solution: 50 mg/mL Km; 250 mg/mL cefotaxime; 250 mg/mL timentin; the stocks are all dissolved in ddH2O, filter-sterilized through 0.22 μm Millex®-GV filters, and stored in aliquots at −20 °C. 13. Acetosyringone (100 mM): Dissolve 196.2 mg of acetosyringone in 10 mL DMSO, filter-sterilized through 0.22 μm Millex®-LG filters, and stored in aliquots at 4 °C. 14. Planting medium in plastic flats (12 packs × 6 cells/pack): Sphagnum peat moss fully soaked with tap water by autoclaving for 5 min. 15. Nutrient solution for planting medium-grown plants: 0.2 g/L fertilizer (nitrogen/phosphorus/potassium = 21:7: 7) dissolved in tap water. 16. Sterilizing solution: 30 % Clorox® (v/v) containing 1.85 % (w/v) sodium hypochlorite and 0.02 % (v/v) Tween 20.

Blueberry (Vaccinium corymbosum L.)

3

125

Method

3.1 Establishment of Stock Cultures

1. Collect newly formed softwood branches, preferably from greenhouse-grown, healthy plants. 2. Cut off the leaves, wash the branches under running tap water for 10–20 min, and trim the branches to 5–10 cm in length. 3. Soak the branch segments in 70 % ethanol for 1 min in a 50 mL Corning® tube and pour off the ethanol. 4. Surface sterilize the segments in sterilizing solution for 20 min. 5. Rinse the branches five times (2 min per time) with sterile distilled water. 6. Cut the branches into 1–2 cm pieces each with a single bud. 7. Insert branch pieces, three for each dish, into 60 mm × 15 mm Petri dishes each containing about 10 mL WPM4Z. 8. Incubate explants for 2 weeks at 25 °C, 30 μE/m2/s of 16 h/ day from cool white fluorescent tubes. 9. Transfer sterile explants onto 30 mL WPM4Z in 40 mm × 110 mm glass jars and incubate for 4 weeks at 25 °C, 30 μE/m2/s of 16 h/day. 10. Excise 1–5 cm long shoots, place 4–6 shoots horizontally on 30 mL WPM4Z in each 40 mm × 110 mm glass jar for subculture at 6-week intervals.

3.2 Preparation of Leaf Explants

1. Leaves from 4 to 8 cm long newly formed in vitro shoots, excluding the three youngest leaves near the tip for each shoot, are the source of explants. 2. Leaf explants are excised from the distal 2/3 of the blade using stainless steel dissecting scissors (see Note 11). 3. The excised explants are placed on two sheets of liquid RM-soaked sterile filter paper in a Petri dish to keep them moist.

3.3 Infection and Cocultivation

1. Using a sterile inoculating loop, streak the A. tumefaciens strain EHA105 stock culture to a YEB plate containing 50 mg/L Km and 25 mg/L rifampicin. 2. Culture the plate for 3 days at 28 °C. 3. Culture single colonies of the strain EHA105 in 10 mL of liquid YEB containing 50 mg/L Km and 25 mg/L rifampicin in a 50 mL Corning® tube with constant shaking (300 rpm) in an incubator shaker at 28 °C for 48 h. Do not overtighten the cap. 4. Measure the optical density (OD) of the bacterial culture at 600 nm. 5. Collect the bacterial cells by a 2 min centrifugation at 2,500 × g at room temperature.

126

Guo-Qing Song

Fig. 1 Agrobacterium tumefaciens (strain EHA105)-mediated transformation of blueberry cultivar Legacy using a pCAMBIA-derived vector that contains a blueberry C-repeat binding factor (CBF) gene. (a) Leaf explants inoculated with A. tumefaciens strain EHA105 containing the CBF. (b) Leaf explants after 6-day cocultivation. (c) Kanamycin-resistant shoots produced from inoculated leaf disks after 10-week selection. (d) Proliferation of kanamycin-resistant shoots. (e) Transgenic shoots rooting in planting medium. Bars: 1 cm

6. Discard the supernatant and suspend the pellet to an OD600 of 0.5 in liquid cocultivation medium (see Note 12). 7. Transfer the leaf explants to a new 50 mL Corning® tube and pour the Agrobacterium suspension into the tube (Fig. 1a). 8. Inoculate leaf explants at room temperature for 5–10 min. 9. Pour off the bacterial suspension and blot dry the explants on two sheets of sterile Whatman filter paper in a 100 mm × 15 mm Petri dish. 10. Place the explants (80–100/dish) on the sterile filter paper (see Note 13) overlaid on 25 mL cocultivation medium in a 100 mm × 15 mm dish (Fig. 1b). The dishes are sealed using truncated food wrap (2 cm in width) unless otherwise mentioned. 11. Cocultivate leaf explants with Agrobacterium cells at 25 °C for 6 days in the dark (see Note 14).

Blueberry (Vaccinium corymbosum L.)

3.4 Selection and Regeneration

127

1. After cocultivation, transfer the explants to a 50 mL Corning® tube. 2. Wash the explants three times in 50 mL liquid RM with constant shaking by hand. 3. Rinse one time in 50 mL liquid RM containing 500 mg/L cefotaxime (or timentin) (see Note 15). 4. Blot dry the explants on sterile filter paper in a 100 mm × 15 mm Petri dish. 5. Place the leaf explants (20/dish) on selection medium (see Note 16). Ensure that explants are in a good contact with the medium. 6. Culture at 25 °C for 2 weeks in the dark. 7. Transfer the plates to a 30 μE/m2/s of 16 h/day at 25 °C. 8. Subculture the leaf explants on fresh selection medium at 3-week intervals at 25 °C, 30 μE/m2/s of 16 h/day, and discard any dead explants during subcultures (Fig. 1c).

3.5

Regrowth

1. All cultures are maintained at 25 °C, 30 μE/m2/s of 16 h/day from cool white fluorescent tubes. 2. During subcultures, transfer selected Km-resistant shoot clusters individually onto 30 mL of WPM4Z containing 250 mg/L cefotaxime (or timentin) and 50 mg/L Km in a 40 × 100 mm glass jar. 3. After 4 weeks, excise the elongated shoots, place an individual shoot horizontally on 30 mL WPM4Z containing 250 mg/L cefotaxime (or timentin) and 50 mg/L Km in a 40 × 100 mm glass jar, and culture for 4–6 weeks. 4. Subculture the shoots from each jar on WPM4Z or WPM2Z containing 250 mg/L cefotaxime (or timentin) and 50 mg/L Km. 5. Km-resistant shoots from separate leaf explants are labeled as independent transgenic events (Fig. 1d). Different shoots derived from a single transformed leaf explant are also labeled separately, although they could be from the same transgenic event.

3.6

Rooting

1. Autoclave sphagnum peat moss plus tap water at 121 °C for 5 min at 105 kPa to soak the moss. 2. Fill cell trays made of 12 individual 6 packs with the soaked sphagnum moss; thoroughly water the sphagnum peat moss. 3. Excise the shoots (3–5 cm in length). 4. Insert individual shoots directly in sphagnum moss in six packs. 5. Cover the flats with transparent plastic covers, culture for 4–8 weeks at 25 °C and 30 μE/m2/s of 16 h/day, and water the plants at about 4-day intervals. At this stage plants are grown in a plant culture room (Fig. 1e).

128

Guo-Qing Song

6. Progressively open and remove the plastic covers in the first 7 days, water the plants at 2-day intervals, and apply nutrient solution three times per week. The young plants continue growth 3–4 weeks after removing the cover. 3.7

Greenhouse Care

1. Fill 4 inch plastic pots with water-soaked sphagnum peat moss (Fafard Peat Moss Co., Ltd.) and Suremix Perlite planting medium (Michigan Grower Products Inc., Galesburg, MI, USA) (v/v = 1:1). 2. Transplant the plants (10–15 cm in height) from the cell packs into 4 in. pots. 3. Transfer the plants to the greenhouse (21–32 °C/10–21 °C (day/night), 25–65 μE/m2/s on a 10–14 h/day). 4. Water the plants as needed and fertilize weekly using a nutrient solution of 0.2 g/L 21-7-7 fertilizer. 5. Plants can be planted in the field in May in Michigan.

4

Notes 1. Although EHA105 seems more efficient than the other two strains in transient transformation studies [6, 21], leaf explants of blueberry cultivars are also found susceptible to octopine strain LBA4404 and nopaline strain GV3101, and both A. tumefaciens strains may be used for stable transformation. 2. For both selectable marker genes, either the cauliflower mosaic virus 35S (CaMV 35S) promoter or the nopaline synthase (nos) promoter is able to drive an effective selection [9–11]. 3. The change of pH caused by the addition of Km, cefotaxime, and acetosyringone to media is usually not considered. However, addition of zeatin or zeatin riboside to the stock culture medium after autoclaving will increase the pH of the medium due to the solvent (1 N NaOH) in the zeatin stock solution. Thus, to get a final pH = 5.2 for stock culture medium, preliminary experiments should be performed to work out how much (X) the pH will increase after the addition of a certain amount of zeatin or zeatin riboside; then adjust the pH for stock culture medium to 5.2-X prior to autoclaving. X is variable to different stock solutions of zeatin or zeatin riboside. 4. Either zeatin or zeatin riboside works for blueberry proliferation. The difference is that we include the zeatin riboside to our medium prior to autoclaving. 5. WPM2Z is used when you see your blueberry cultures (e.g., cvs. Aurora and Brigitta) give a high shoot-proliferation rate but the tiny leaves on the shoots. The reduced zeatin (or zeatin riboside) amount from 4 to 2 mg/L promotes shoot elongation and leaf expanding.

Blueberry (Vaccinium corymbosum L.)

129

Table 1 Regeneration medium for different blueberry cultivars Regeneration medium

Cultivar

Basal medium (1 L): 10 mL 100× MWPM salts, 1 mL 1,000× MS vitamins, 20 g/L sucrose, 6 g/L Bacto™ agar, pH 5.2 (herein MWPM) Plant growth regulators: 1 mg/L TDZ and 0.5 mg/L NAA

Aurora, Brigitta, Elliott, Legacy, Duke, Bluecrop

Basal medium: MWPM Plant growth regulators: 5.0 mg/L 2ip and 2.0 mg/L zeatin

Bluecrop, Elliott, Legacy

Basal medium: MWPM Plant growth regulators: 4.0 mg/L and 0.5 mg/L NAA

Brigitta, Aurora, Duke, Legacy

Basal medium: MWPM Plant growth regulators: 0.22 mg/L TDZ

Duke

Basal medium (1 L): 2.3 g/L WPM salts, 1 mL 1,000× MS vitamins, 556 mg/L Ca(NO3)2·4H2O, 20 g/L sucrose, 6 g/L Bacto™ agar, pH 5.2 (herein WPMC) Plant growth regulators: 1 mg/L TDZ and 0.5 mg/L NAA

Jewel, Jubilee, Aurora, Legacy

Basal medium: WPMC Plant growth regulators: 4 mg/L zeatin riboside

Biloxi, Emerald

6. Regeneration medium (RM) that enables efficient shoot regeneration from leaf explants is the key for successful transformation of blueberry. The optimal RM for blueberry regeneration is genotype dependent (Table 1) [6, 10]. The RM used here has led to efficient regeneration of several highbush blueberry cultivars tested although the shoot regeneration efficiencies and patterns vary among the cultivars [6]. 7. This medium has been tested and worked for cvs. Aurora and Legacy and could work for other cultivars (Table 1). 8. 20 mg/L Km enables more effective selection. 9. 50 mg/L Km also works at this stage. 10. Alternatively, yeast extract peptone (YEP) medium and LuriaBertani (LB) medium work as well as the YEB. 11. Using small dissecting scissors was found to be very effective for excising leaf explants; a quick cutting, thus, can shorten the exposure of the leaf explants in the airflow of the sterile cabinet. 12. This step is used to remove the liquid YEB. The Km 50 mg/L in YEB is toxic to leaf explants. 13. The filter paper is used to prevent Agrobacterium overgrowth. 14. Blueberry leaf explants are not hypersensitive to A. tumefaciens. After 6-day cocultivation, there is little tissue necrosis.

130

Guo-Qing Song

15. After washes, most of the agrobacterial cells on the explant surfaces are removed; thus, these washes make it possible to use a lower concentration (250 mg/L) of cefotaxime or timentin for successful inhibition of bacterial growth in the following selection steps. 16. Leaf explants of blueberry cultivars are very sensitive not only to Km [6, 22] but also to glufosinate ammonium. In our recent transformation studies using the bar gene as selectable marker, 0.1 mg/L glufosinate ammonium in RM was found to inhibit shoot regeneration from non-transformed leaf explants, and transgenic plants have been obtained after selection with 0.1 mg/L glufosinate ammonium plus 250 mg/L timentin. The high level of sensitivity of leaf explants of blueberry indicates that dose experiments should be performed when other selectable markers are proposed. Compared with cefotaxime, timentin is less expensive. When timentin is used for stable transformation in our recent researches, transgenic plants can also be regenerated. References 1. Vander Kloet SP (1988) The genus Vaccinium in North America. Canadian Govt Publ Centre, Ottawa, ON 2. Luby JJ, Ballington JR, Draper AD et al (1991) Blueberries and cranberries (Vaccinium). In: Moore JN, Ballington JR (eds) Genetic resources of temperate fruit and nut crops. International Society for Horticultural Science, Wageningen, Netherlands, pp 391–456 3. Prior RL, Cao G, Martin A et al (1998) Antioxidant capacity is influenced by total phenolic and anthocyanin content, maturity, and variety of vaccinium species. J Agric Food Chem 46:2686–2693 4. Song G-Q, Hancock JF (2011) Vaccinium. In: Kole C (ed) Wealth of wild crop relatives: genetic, genomic & breeding resource. Springer, Berlin, pp 197–222 5. Song G-Q, Hancock JF (2012) Recent advances in blueberry transformation. Int J Fruit Sci 12:316–332 6. Song G-Q, Sink KC (2004) Agrobacterium tumefaciens-mediated transformation of blueberry (Vaccinium corymbosum L.). Plant Cell Rep 23:475–484 7. Song G-Q, Sink KC (2006) Blueberry (Vaccinium corymbosum L.). In: Wang K (ed) Agrobacterium protocols: methods in molecular biology 344, 2nd edn. Humana, Totowa, pp 37–44

8. Song G-Q, Roggers RA, Sink KC et al (2007) Production of herbicide-resistant highbush blueberry ‘Legacy’ by Agrobacteriummediated transformation of the Bar gene. Acta Hortic 738:397–407 9. Song G-Q, Sink KC, Callow PW et al (2008) Evaluation of different promoters for production of herbicide-resistant blueberry plants. J Am Soc Hortic Sci 133:605–611 10. Walworth AE, Rowland LJ, Polashock JJ et al (2012) Overexpression of a blueberry-derived CBF enhances cold tolerance in a southern highbush blueberry cultivar. Mol Breed 30: 1313–1323 11. Song G-Q, Walworth AE, Zhao D et al (2013) The Vaccinium corymbosum FLOWERING LOCUS T-like gene (VcFT): a flowering activator reverses the photoperiodic and chilling requirements and enables early and continuous flowering in blueberry. Plant Cell Rep 32:1759–1769 12. Song G-Q, Walworth AE, Hancock JF (2012) Stability of transgenes in blueberry. Int J Fruit Sci 12:333–341 13. Lloyd G, McCain B (1980) Commercially feasible micropropagation of mountain laurel, Kalmia latifolia, by use of shoot tip culture. Proc Int Plant Prop Soc 30:421–427 14. Hood EE, Gelvin SB, Melchers LS et al (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–218

Blueberry (Vaccinium corymbosum L.) 15. Hoekema A, Hirsch PR, Hooykaas PJJ et al (1983) A binary plant vector strategy based on separation of Vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303:179–180 16. Koncz C, Schell J (1986) The promoter of Ti-DNA gene controls the tissue-specific expression of chimeric genes by a novel type of Agrobacterium binary vector. Mol Gen Genet 204:383–396 17. Reed BM, Abdelnour-Esquivel A (1991) The use of zeatin to initiate in vitro cultures of Vaccinium species and cvs. HortiScience 26: 1320–1322 18. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497

131

19. Liu C, Callow P, Rowland LJ et al (2010) Adventitious shoot regeneration from leaf explants of southern highbush blueberry cultivars. Plant Cell Tiss Org Cult 103: 137–144 20. Vervliet G, Holsters M, Teuchy H et al (1975) Characterization of different plaque-forming and defective temperate phages in Agrobacterium strains. J Gen Virol 26:33–48 21. Cao X, Liu Q, Rowland LJ et al (1998) GUS expression in blueberry (Vaccinium spp.): factors influencing Agrobacterium-mediated gene transfer efficiency. Plant Cell Rep 18: 266–270 22. Graham J, Greig K, McNicol RJ (1996) Transformation of blueberry without antibiotic selection. Ann Appl Biol 128:557–564

Chapter 12 Cherry Guo-Qing Song Abstract Agrobacterium tumefaciens-mediated transformation of sour cherry (Prunus cerasus L.) “Montmorency” and sweet cherry rootstocks “Gisela 6” and “Gisela 7” (P. cerasus × P. canescens) is described. Briefly, leaf explants from in vitro shoots are cocultivated with A. tumefaciens either directly (for “Gisela 6” and “Gisela 7”) or after pretreatment (for “Montmorency”) on cocultivation medium; selection and regeneration of transformed shoots are carried out on selection medium containing 50 mg/L kanamycin (Km) and 250 mg/L timentin (or cefotaxime) for 3–5 months. In this protocol, the optimal media for shoot proliferation and shoot regeneration from leaf explants are genotype dependent. Key words Agrobacterium tumefaciens, Cherry, genetic transformation, Leaf explant, plant regeneration, Transgenic plant

1

Introduction Stone fruits (i.e., almonds, apricots, cherries, nectarines, peaches, and plums) are a group of fruits in the genus Prunus. The “true” cherries are derived from the genus Prunus, subgenus Cerasus, family Rosaceae [1]. Sweet cherry (Prunus avium) and sour cherry (Prunus cerasus) are the major eating cherries that have become recognized for potential benefits to human health and are favorite fruits of many people. Traditional approaches for cherry breeding, such as hybridization, clone selection, and mutagenesis, are generally difficult and long-term processes due to heterozygosity, polyploidy, length of field trials, and the interval between generations [2]. Thus, transformation of cherries offers an attractive approach to complement these breeding methods by efficiently introducing single or multiple desired traits such as improved fruit quality and resistance to insects and diseases. Prunus spp. are not amenable for plant tissue culture and genetic transformation. To date, genetic transformation has been reported only for a few commercially important cherry species,

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_12, © Springer Science+Business Media New York 2015

133

134

Guo-Qing Song

including sour cherry (P. cerasus L.), chokecherry (P. virginiana L.), black cherry (Prunus serotina Ehrh.), and the cherry rootstocks “Rosa” (P. subhirtella autumno), “Gisela 6” (P. cerasus × P. canescens), “Colt” (P. avium × P. pseudocerasus), “Inmil” (P. incisa × P. serrula), and “Damil” (P. dawyckensis) [3–11]. In general, a reliable transformation system depends on an efficient plant regeneration system, which is usually genotype dependent. The Agrobacterium tumefaciens-mediated transformation protocol described here is based on our optimized conditions for shoot regeneration from leaf explants, gene delivery using A. tumefaciens, and selection of transgenic shoots using the neomycin phosphotransferase II (nptII) as the selectable marker gene [8–10]. This protocol has resulted in successful transformation of a major sour cherry “Montmorency” and two sweet cherry rootstocks “Gisela 6” and “Gisela 7” [9, 12].

2 2.1

Materials Plant Material

1. Starting plant materials: The newly formed softwood branches of sour cherry “Montmorency” and two sweet cherry rootstocks “Gisela 6” and “Gisela 7,” preferably taken from greenhouse-grown plants. Alternatively, 1-year-old twigs with fully chilled leaf buds. 2. Sterilizing solution: 30 % Clorox® (v/v) containing 1.85 % (w/v) sodium hypochlorite and 0.02 % (v/v) Tween 20 for newly formed softwood branches. 50 % Clorox® (v/v) containing 3 % (w/v) sodium hypochlorite and 0.02 % (v/v) Tween 20 for 1-year-old bud woods with dormant leaf buds. 3. Leaf explants are taken from in vitro cultured stock shoots cultured on shoot proliferation medium at 25 °C under a 16 h photoperiod of 30–40 μmol/m2/s from cool white fluorescent tubes.

2.2 Bacterial Strains and Binary Vector

1. Leaf explants of cherry cultivars are susceptible to all three A. tumefaciens strains EHA105 [13], LBA4404 [14], and GV3101 [15] (see Note 1). These A. tumefaciens strains are stored in 20 % sterile glycerol (v/v) at −80 °C. 2. Binary vectors contain the nptII gene conferring kanamycin (Km) resistance.

2.3 Culture Medium and Stock Solutions

Media pH is adjusted with 1 N NaOH or 1 N HCl before adding the agar and autoclaving. Double-distilled water (ddH2O) is used unless otherwise mentioned. All media are autoclaved at 121 °C for 20 min at 105 kPa and kept at room temperature if they can be used in a week; otherwise, stored at 4 °C up to 2 weeks. Stock sterile solutions of thidiazuron (TDZ), Km, cefotaxime, timentin, and acetosyringone are added to liquid medium with agar cooled to

Cherry

135

50–60 °C or to liquid medium at room temperature after autoclaving: 1. Shoot culture medium 1 (SCM1) for sweet cherry rootstock: Murashige and Skoog (MS) medium [16] containing 20 g/L sucrose, 6 g/L Bacto™ agar, 1.0 mg/L benzylaminopurine (BAP), 0.1 mg/L indole-3-butyric acid (IBA), and pH 5.6. This medium is for sweet cherry rootstocks “Gisela 6” and “Gisela 7” (see Note 2). 2. Shoot culture medium 2 (SCM2) for sour cherry: Quoirin and Lepoivre (QL) salts [17], vitamins (1 mg/L nicotinic acid, 1 mg/L pyridoxine HCl, 1 mg/L thiamine HCl, and 100 mg/L myo-inositol) (see Note 3), 20 g/L sucrose, 6 g/L Bacto™ agar, 0.5 mg/L BAP, 0.05 mg/L IBA, and pH 5.2. This medium is for sour cherry “Montmorency” (see Note 2). 3. Regeneration medium for cherry rootstocks “Gisela 6” and “Gisela 7” (RM-G): Lloyd and McCown medium (WPM) [18] salts and MS vitamins supplemented with 30 g/L sucrose, 6 g/L Bacto™ agar, 2.0 mg/L BAP, 1.0 mg/L IBA, pH 5.6. 4. Pretreatment medium for sour cherry “Montmorency” (MST): MS medium containing 30 g/L sucrose, 6 g/L Bacto™ agar, 0.1 mg/L thidiazuron (TDZ), pH 5.2. 5. Regeneration medium for “Montmorency” (RM-M): QL salts, vitamins (1 mg/L nicotinic acid, 1 mg/L pyridoxine HCl, 1 mg/L thiamine HCl, and 100 mg/L myo-inositol), 40 g/L sucrose, 6 g/L Bacto™ agar, 3.0 mg/L BAP, 0.5 mg/L naphthaleneacetic acid (NAA), pH 5.2. 6. Cocultivation medium: RM-G for “Gisela 6” and “Gisela 7” and MST for “Montmorency”, each supplemented with 100 μM acetosyringone. 7. Selection medium: RM-G for “Gisela 6” and “Gisela 7” and MST for “Montmorency”, each supplemented with 250 mg/L timentin (or cefotaxime) and 50 mg/L Km when the neomycin phosphotransferase II gene (nptII) is the selectable marker. 8. Agrobacterium culture medium (yeast extract peptone (YEP) medium): 10 g/L Bacto™ peptone, 10 g/L yeast extract, 5 g/L NaCl, pH 7.0. After autoclave, add 25 mg/L rifampicin (for A. tumefaciens strains EHA105, LBA4404, and GV3101) and 50 mg/L Km (see Note 4). 9. Stock solution of plant growth regulators: 1 mg/mL TDZ in dimethyl sulfoxide (DMSO), filter-sterilize through 0.22 μm Millex®-LG filters (Millipore Corporation), and store in aliquots at 4 °C. 1 mg/mL BAP, 1 mg/L IBA, and 1 mg/L NAA dissolved in 2–3 mL 1 N NaOH, diluted to 1 mg/mL with ddH2O, and stored at 4 °C. 10. Antibiotic stock solution: 50 mg/mL Km; 250 mg/mL timentin; 250 mg/mL cefotaxime; the stocks are all dissolved in ddH2O,

136

Guo-Qing Song

filter-sterilized through 0.22 μm Millex®-GV filters (Millipore Corporation), and stored in aliquots at −20 °C. 11. 100 mM acetosyringone: 1.96 g acetosyringone in 100 mL DMSO is filter-sterilized through 0.22 μm Millex®-LG filters (Millipore Corporation) and stored in aliquots at 4 °C. 12. Planting medium in plastic flats (12 packs × 6 cells/pack): Suremix Perlite planting medium (Michigan Grower Products Inc.) fully soaked with tap water by autoclaving for 5 min. 13. Nutrient solution for planting medium grown plants: 0.62 g/L fertilizer (nitrogen/phosphorus/potassium = 20:20:20) dissolved in tap water.

3

Method All cultures are maintained at 25 °C, 30–40 μmol/m2/s of 16 h/day from cool white fluorescent tubes unless as otherwise mentioned.

3.1 Establishment of Stock Cultures

1. Collect the newly formed branches, greenhouse-grown, healthy plants.

preferably

from

3.1.1 Newly Formed, Year-Old Softwood Branches

2. Cut off the leaves, wash the branches under running tap water for 20 min, and then trim the branches to 5–10 cm in length. 3. Soak the branch segments in 70 % ethanol for 1 min in a 50 mL Corning® tube (Corning Inc.) and then pour off the ethanol. 4. Surface sterilize the segments in sterilizing solution for 20 min. 5. Rinse the branches five times (2 min per time) with sterile distilled water. 6. Cut the branches into 1–2 cm pieces each with a single bud using sterile dissecting scissors. 7. Place branch pieces horizontally, three for each dish, onto 10 mL SCM in 60 mm × 15 mm Petri dishes. 8. Check the dishes every other day. If any visible contamination buds are observed, transfer the sterile ones to fresh medium in Petri dishes. 9. After incubating explants for 2 weeks, excise sterile shoots and insert them into fresh SCM in Magenta® GA7 boxes. 10. Subculture the shoots and stem nodes, ten per glass jars, every 4–6 weeks.

3.1.2 One-Year-Old Bud Woods with Dormant Leaf Buds

1. Twigs with non-breaking buds are collected in plastic bags in March or April in Michigan. 2. Store the collected twigs at 4 °C in a refrigerator. 3. Prior to surface sterilization, immerse one end of the twigs in water and incubate them at room temperature (about 25 °C)

Cherry

137

for 1–3 days. The buds showing green tips (about 5–10 % of bud size) are ready for surface sterilizing and bud dissecting. 4. Trim the twigs to 5–10 cm in length using a pruner. 5. Wash the trimmed twigs with liquid soap followed by thorough washing for 20 min under running tap water. 6. Make single bud cuts, 1–2 cm in length, slightly below and above the buds, using a pruner. 7. Soak the buds in 70 % ethanol for 1 min in a 50 mL Corning® tube (Corning Inc.) and pour off the ethanol. 8. Surface sterilize the buds in sterilizing solution (50 % Clorox® and 0.02 % Tween 20) for 20 min and pour off the solution. 9. Rinse the buds five times (2 min per time) with sterile distilled water. 10. Transfer the buds to sterile Petri dishes. 11. Three sets of forceps and two scalpel handles, one with a #10 blade and another with a #11 blades, are sterilized using flame. 12. With forceps #1 transfer a node into a Petri dish. 13. Hold bud near the base with forceps #1 and peel off the bud scales and the outer leaves using blade #10. Leave a small green cluster of leaves that join at the bottom with the meristem inside (see Note 5). 14. Move the bud to a new unused area of the Petri dish using forceps #1. 15. Hold the bud with forceps # 2 and with blade #11 cut near the base to release the meristem. 16. Using forceps #3, move the meristem to a Petri dish (60 × 15 mm) with about 10 mL SCM medium (see the attached recipe). Place three meristems per dish and space them out in the dish. 17. Dip instruments in 70 % ethanol and flame for the next bud. 18. Put the dishes under a 16 h photoperiod of 40 μmol/m2/s at 25 °C. 19. Check the dishes every other day. If any visible contamination buds are observed, transfer the sterile ones to fresh medium. 20. After incubating explants for 2 weeks, excise sterile shoots and insert them into fresh SCM in Magenta® GA7 boxes. 21. Subculture the shoots or stem nodes, ten per glass gars, every 4–6 weeks. 3.2 Preparation of Leaf Explants

1. Leaves from 6-week-old stock cultures. 2. Expanding leaves with the midribs 1.0–2.5 cm in length are excised from the distal 3/4 of the blade using dissecting scissors.

138

Guo-Qing Song

3. The explants are cut partially transverse and equidistant two times through the midrib from the leaf tip using a scalpel with a #10 blade. 4. For cherry rootstocks “Gisela 6” and “Gisela 7,” the excised explants are placed on two sheets of liquid RM-soaked sterile filter paper in a Petri dish to keep them moist; alternatively, transfer the explants to a 50 mL Corning® tube (Corning Inc.) containing about 0.5 mL (see Note 6) cocultivation medium and put the lid on to keep the moisture inside the tube. 5. For the excised explants of sour cherry “Montmorency,” 20 explants per Petri dish are placed on 25 mL pretreatment medium MST. The pretreatment is conducted at 25 °C in the dark for 4 days. 3.3 Infection and Cocultivation

1. Using a sterile inoculating loop, streak the A. tumefaciens strain EHA105 stock culture to a YEP plate (see Note 7) containing 50 mg/L Km and 25 mg/L rifampicin. 2. Culture the plate for 3 days at 28 °C. 3. Culture single colonies of the strain EHA105 in 10 mL of liquid YEP containing 50 mg/L Km and 25 mg/L rifampicin in a 50 mL Corning® tube with constant shaking (300 rpm) in an incubator shaker at 28 °C for 48 h. Do not overtighten the cap. 4. Measure the optical density (OD) of the bacterial culture at 600 nm. 5. Collect the bacterial cells by a 2 min centrifugation at 2,500 × g at room temperature. 6. Discard the supernatant and suspend the pellet to an OD600 of 0.5 in liquid cocultivation medium (see Note 8). 7. Pour the Agrobacterium suspension into 50 mL Corning® tubes containing either newly prepared or pretreated leaf explants. 8. Inoculate leaf explants at room temperature for 5 min (see Note 9). 9. Pour off the bacterial suspension and blot dry the explants on two sheets of sterile filter paper in a 100 mm × 15 mm Petri dish. 10. Place the explants (30–40/dish) on the sterile filter paper (see Note 10) overlaid on 25 mL cocultivation medium in a 100 mm × 15 mm dish. The dishes are sealed using truncated food wrap (3 cm in width) or Parafilm. 11. Cocultivate leaf explants with Agrobacterium cells at 25 °C for 4 days in the dark.

Cherry

3.4 Selection and Regeneration

139

1. After cocultivation, transfer the explants to a 50 mL Corning tube. 2. Wash the explants three times (1–2 min/time) in 50 mL liquid RM with constant shaking by hand. 3. Rinse one time in 50 mL liquid RM containing 500 mg/L timentin (or cefotaxime) (see Note 11). 4. Blot dry the explants on sterile filter paper in a Petri dish. 5. Place the leaf explants (10/dish) abaxial side up on selection medium containing 50 mg/L Km (see Note 12) and 250 mg/L timentin (or cefotaxime). Ensure that explants are in a good contact with the medium. 6. Culture at 25 °C for 2 weeks in the dark. 7. Transfer the plates to a 40 μmol/m2/s of 16 h/day at 25 °C. 8. Subculture the leaf explants on fresh selection medium every 3 weeks and discard any dead explants during subcultures (Fig. 1a).

3.5

Regrowth

1. During selection and subcultures, transfer Km-resistant shoot clusters individually onto 50 mL of selection medium in Magenta® GA7-3 boxes. 2. After 4 weeks, excise the elongated shoots and place an individual shoot on 50 mL of selection (50 mg/L Km plus 250 mg/L timentin or cefotaxime) SCM1 (for “Gisela 6” and “Gisela 7”) or selection SCM2 (for “Montmorency”) in Magenta® GA7-3 boxes. 3. Km-resistant shoots from separate leaf explants are labeled as independent transgenic events (Fig. 1b). Different shoots derived from a single transformed leaf explants are also labeled separately, although they could be from the same transgenic event. 4. Subculture the Km-resistant shoots of each transgenic event on selection SCM to increase the shoot number.

3.6

Rooting

1. Excise the shoots (3–5 cm in length) and remove the leaves at the basal end. 2. Insert individual shoots directly in water-soaked planting medium in plastic flats (12 packs × 6 cells/pack). 3. Cover the flats with transparent plastic covers, culture for 4–8 weeks at 25 °C and 40 μmol/m2/s of 16 h/day, and water the plants at about 4-day intervals. At this stage plants are grown in a plant culture room. 4. Progressively open and remove the plastic covers in the first 7 days, water the plants at 2-day intervals. The young plants continue growth 3–4 weeks after removing the cover (Fig. 1c). 5. Apply nutrient solution once a week.

140

Guo-Qing Song

Fig. 1 Agrobacterium tumefaciens (strain EHA105)-mediated transformation of sweet cherry rootstock “Gisela 6” using a pART27-derived RNAi vector for silencing Prunus necrotic ring spot virus. (a) Kanamycin-resistant shoots produced from inoculated leaf disks after 10-week selection. (b) Proliferation of kanamycin-resistant shoots. (c) Transgenic shoots rooting in planting medium. (d) Transgenic plants growing in the greenhouse 3.7

Greenhouse Care

1. Fill 1 gallon plastic pots with water-soaked Suremix Perlite planting medium. 2. Transplant the plants (about 10 cm in height) from the cell packs into 1 gallon pots. 3. Transfer the plants to the greenhouse (21–32 °C/10–21 °C (day/night), 25–65 μmol/m2/s on a 10–14 h/day) (Fig. 1d). 4. Water the plants as needed and fertilize weekly using a nutrient solution of 0.62 g/L fertilizer.

4

Notes 1. In our transient transformation studies, three opine-type strains EHA105, GV3101, and LBA4404 showed no significant difference in gene delivery [8].

Cherry

141

2. All in vitro cherry shoot cultures are maintained in either 85 × 100 mm glass jars containing 100 mL medium or Magenta® GA7 boxes each containing 50 mL medium. The bottom parts of glass Petri dishes (100 mm × 20 mm) are used as the lids of the glass jars. The lids of the containers are sealed with either plastic food wrap (about 3 cm in width) or Parafilm®. 3. We make 1 mg/mL stock solutions for nicotinic acid, pyridoxine HCl, and thiamine HCl, separately. 4. GV3101 has resistance to rifampicin (chromosomal marker) and gentamicin (Ti plasmid marker); EHA105 is resistant to rifampicin and chloramphenicol (both are chromosomal marker); LBA4404 has resistance to rifampicin, chloramphenicol, streptomycin, and pectinomycin [17]. 5. If the bud is cut too low, it will fall apart and must be discarded. 6. Do not soak the explants by using too much medium. 7. Alternatively, Luria-Bertani (LB) medium and yeast extract broth (YEB) medium work as well. 8. This step is used to remove the liquid YEP. The Km 50 mg/L in YEP is toxic to leaf explants. 9. Do not soak the explants in cocultivation medium for more than 5 min to prevent reduced shoot regeneration from inoculated explants. 10. The filter paper is used to prevent Agrobacterium overgrowth. 11. After washes, most of the agrobacterial cells on the explant surfaces are removed; thus, these washes make it possible to use a lower concentration (250 mg/L) of timentin or cefotaxime for successful inhibition of bacterial growth in the following selection steps. 12. Alternatively, use 25 mg/L Km for the first 3 weeks followed by using 50 mg/L Km. This helps to improve transformation frequency by minimizing necrosis of inoculated explants [10]. References 1. Webster AD (1996) The taxonomic classification of sweet and sour cherries and a brief history of their cultivation. In: Webster AD, Looney NE (eds) Cherries: crop physiology, production and uses. CAB International Wallingford, UK, pp 3–24 2. Song G-Q, Lang G, Dolgov SV et al (2008) Cherries. In: Kole C, Hall TC (eds) A compendium of transgenic crop plants. WileyBlackwell, London, pp 161–188 3. Da Cämara Machado A, Puschmann M, Pühringer H et al (1995) Somatic embryogenesis of Prunus subhirtella autumno rosa and regeneration of transgenic plants after

Agrobacterium-mediated transformation. Plant Cell Rep 14:335–340 4. Druart PH, Delporte F, Brazda M et al (1998) Genetic transformation of cherry trees. Acta Hortic 468:71–76 5. Gutièrrez-Pesce P, Taylor K, Muleo R et al (1998) Somatic embryogenesis and shoot regeneration from transgenic roots of cherry rootstock Colt (Prunus avium x P. pseudocerasus) mediated by pRi1855 T-DNA of Agrobacterium rhizogenes. Plant Cell Rep 17: 574–580 6. Gutièrrez-Pesce P, Rugini E (2004) Influence of plant growth regulators, carbon sources and

142

7.

8.

9.

10.

11.

Guo-Qing Song iron on the cyclic secondary somatic embryogenesis and plant regeneration of transgenic cherry rootstock ‘Colt’ (Prunus avium x P. pseudocerasus). Plant Cell Tiss Org Cult 79: 223–232 Dai W, Magnusson V, Johnson C (2007) Agrobacterium-mediated transformation of chokecherry (Prunus virginiana L.). HortScience 41:140–142 Song G-Q, Sink KC (2005) Optimizing shoot regeneration and transient expression factors for Agrobacterium tumefaciens transformation of sour cherry (Prunus cerasus L.) cultivar Montmorency. Sci Hortic 106:60–69 Song G-Q, Sink KC (2006) Transformation of Montmorency sour cherry (Prunus cerasus L.) and Gisela 6 (P. cerasus × P. canescens) cherry rootstock mediated by Agrobacterium tumefaciens. Plant Cell Rep 25:117–123 Song G-Q, Sink KC (2007) Transformation of cherry: Prunus cerasus L. ‘Montmorency’ and Prunus cerasus x P. canescen ‘Gisela 6’ mediated by Agrobacterium tumefaciens and a two-step selection system. Acta Hortic 738:683–689 Liu X, Pijut PM (2008) Plant regeneration from in vitro leaves of mature black cherry (Prunus serotina). Plant Cell Tiss Org Cult 94: 113–123

12. Song G-Q, Sink KC, Walworth AE et al (2013) Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing. Plant Biotechnol J 11:702–708 13. Hood EE, Gelvin SB, Melchers LS et al (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–218 14. Hoekema A, Hirsch PR, Hooykaas PJJ et al (1983) A binary plant vector strategy based on separation of Vir- and T-region of the Agrobacterium tumefaciens Ti-plasmid. Nature 303:179–180 15. Koncz C, Schell J (1986) The promoter of Ti-DNA gene controls the tissue-specific expression of chimaric genes by a novel type of Agrobacterium binary vector. Mol Gen Genet 204:383–396 16. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 17. Quoirin M, Lepoivre P (1977) Improved media for in vitro culture of Prunus sp. Acta Hortic 78:437–442 18. Lloyd G, McCain B (1980) Commercially feasible micropropagation of mountain laurel, Kalmia latifolia, by use of shoot tip culture. Proc Int Plant Prop Soc 30:421–427

Chapter 13 Chestnut, American (Castanea dentata (Marsh.) Borkh.) Charles A. Maynard, Linda D. McGuigan, Allison D. Oakes, Bo Zhang, Andrew E. Newhouse, Lilibeth C. Northern, Allison M. Chartrand, Logan R. Will, Kathleen M. Baier, and William A. Powell Abstract The key to successful transformation of American chestnut is having the correct combination of explant tissue, selectable markers, a very robust DNA delivery system, and a reliable regeneration system. The most important components of this transformation protocol for American chestnut are the following: starting out with rapidly dividing somatic embryos, treating the embryos gently throughout the Agrobacterium inoculation and cocultivation steps, doing the cocultivation step in desiccation plates, and finally transferring the embryos into temporary-immersion bioreactors for selection. None of these departures from standard Agrobacterium transformation protocols is sufficient by itself to achieve transgenic American chestnut, but each component makes a difference, resulting in a highly robust protocol. The average transformation efficiency that can be expected using the described protocol is approximately 170 stable embryogenic transformation events per gram of somatic embryo tissue, a considerable improvement over the 20 transformation events per gram we reported in 2006 (Maynard et al. American chestnut (Castanea dentata (Marsh.) Borkh.) Agrobacterium protocols, 2nd ed., 2006). We have regenerated nearly 100 of these events, containing 23 different gene constructs, into whole plants. As of the fall of 2013, we had a total of 1,275 transgenic chestnut trees planted at eight locations in New York State and one in Virginia. Based on a combination of field-trial inoculations, greenhouse small-stem inoculations, and detached-leaf assays, we have identified three transgenes that produce stronger resistance to chestnut blight than non-transgenic American chestnut. Depending on the transgene and the event, this resistance can be either intermediate between American chestnut and Chinese chestnut, approximately equal to or even higher than the resistance naturally found in Chinese chestnut. Key words bar, Bioreactor, Cocultivation, Desiccation, nptII, Oxalate oxidase, Paromomycin, Periodic immersion, Somatic embryogenesis

1

Introduction The American chestnut was one of the most important deciduous tree species in the eastern United States. Towering over most other trees, it often made up 25 % or more of the overstory [1]. In 1904, the disease that later became known as chestnut blight was discovered in the Bronx Zoological Park [2] by the zoo’s chief forester,

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_13, © Springer Science+Business Media New York 2015

143

144

Charles A. Maynard et al.

Hermann Merkel. Caused by the fungal pathogen Cryphonectria parasitica (Murr.) Barr, chestnut blight has reduced this once magnificent species to little more than an understory shrub [3]. One means of restoring the American chestnut would be to transform putative resistance-enhancing genes into the chestnut’s genome. Supporting research needed for a transformation system was carried out with both American and European chestnut (Castanea sativa Mill) throughout the 1980s and 1990s. Publications have been written about somatic embryogenesis [4–7], detecting transformation events using polymerase chain reaction (PCR) [8], testing marker genes [9, 10], and micropropagation [11–19]. Further refinements were made to somatic embryo regeneration procedures for American chestnut by adding powdered activated charcoal to the medium and including a chilling step [20]. Asparagine was also found to improve embryo conversion efficiency [21, 22]. The first report of successful Agrobacterium-mediated transformation of a Castanea species described the regeneration of transgenic shoots from European chestnut cotyledons in 1998 [23]. This was followed in 2004 by a report of the transformation of somatic embryos of European chestnut that were subsequently regenerated into whole plants through a combination of germination and micropropagation [24]. Using the version of the protocol described in Chapter 22 of the second edition of this book [25], we were able to transform somatic American chestnut embryos and regenerate them into whole plants [26]. On June 7, 2006, we collaborated with the New York chapter of The American Chestnut Foundation to plant two transgenic American chestnut trees in Syracuse, New York (Fig. 1). One promptly died, but as of the spring of 2014, the other is still alive. To the best of our knowledge, this was the first time any transgenic American chestnut tree had been planted outside the laboratory. This tiny planting was followed in subsequent years by plantings of several hundred more trees on eight different sites within NY State, including the New York Botanical Garden in the Bronx, NY. This site was symbolic because “The Garden,” as it is called, is directly across the street from the Bronx Zoo where the blight was discovered in 1904. Dr. Scott Merkle at the University of Georgia has also been working on somatic embryo culture transformation and regeneration for many years and has shared his knowledge freely with us. The explanting of immature zygotic embryos is based on a protocol he developed and the regeneration media (E1–E4) were adapted from his publications and personal communication. His lab group has also successfully transformed American chestnut somatic embryos [27] and regenerated whole plants. He likewise uses Agrobacterium-mediated transformation of somatic embryos, but his system differs in many details from the protocol described

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

145

Fig. 1 The first of two transgenic American chestnut trees were planted in the field on June 7, 2006, by Charles Maynard (left) and Linda McGuigan (right)

in this chapter [28]. We recommend that anyone interested in transforming American chestnut should contact Dr. Merkle and inquire about his protocol. The development of a reliable Agrobacterium-mediated transformation system allowed us to introduce an oxalate oxidase (OxO) gene from wheat (Triticum aestivum) into the American chestnut [29]. Based on small-stem inoculation assays [30] and excised-leaf assays [31], this gene, when driven by a tissue-specific promoter, can convey blight resistance intermediate between wild-type American chestnut and Chinese chestnut [32]. When driven by the stronger CaMV 35S constitutive promoter, the expression of OxO is many times higher, and some of these high-expressing lines may be even more blight resistant than the Chinese chestnut we use as a control [33]. Since the earlier description of a chestnut transformation protocol [25], we have made several major changes and even more minor ones. In addition to transformation with a single vector, which is still our preferred technique and the method detailed in Subheading 3, we adapted a process called co-transformation [34]. This process makes use of two plasmids, one with selectable and/or scorable marker genes and the second with the gene(s) of interest (GOI) and a separate selectable marker. The original description of co-transformation used a single strain of Agrobacterium containing both plasmids to transform tobacco (Nicotiana tabacum L.) and

146

Charles A. Maynard et al.

Fig. 2 (a) Periodic immersion bioreactors (RITA®) used to select transformed somatic embryos of American chestnut; (b) a closer view of American chestnut somatic embryos being selected for the bar marker gene

rice (Oryza sativa L.) [34]. We have found that co-transformation also works in chestnut if the plasmids are carried in separate Agrobacterium strains. The two strains are grown separately and mixed together in a 5:1 ratio (GOI plasmid/marker plasmid) immediately before use [29, 32]. Another change that made a major difference in transformation efficiency (fewer non-transgenic “escapes,” shorter time to obtain completely transgenic events, and a higher number of transformed events per gram of embryo tissue) is the use of periodic immersion bioreactors for the selection stage (Fig. 2) [35]. Bioreactors are typically used to grow plant tissue by temporarily flooding the culture with a nutrient solution. During transformation, they are used to temporarily flood the tissue with a nutrient solution containing an antibiotic that will kill any nontransformed cells. These bioreactors also result in more efficient antibiotic selection of transformed tissue, which has allowed us to forgo the visual scorable marker (GFP) we had been using (Fig. 3). Without the need for a scorable marker, we went back to using a single Agrobacterium strain. One key factor described in the 2006 version of the transformation protocol for American chestnut and is still an important part of this protocol is the use of desiccation plates [36] rather than semisolid medium during the cocultivation step. Desiccation is not a common part of most Agrobacterium transformation protocols, but we found that a 2- or 3-day desiccation treatment increased the recovery of transgenic events by at least tenfold in chestnut [26]. In the plantlet acclimatization phase, we found that a small plastic bag placed over the plant and fastened with a rubber band will maintain nearly 100 % relative humidity (Fig. 4). The bag can

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

147

Fig. 3 (a) A GFP-positive root emerging from a transgenic American chestnut shoot; (b) the same shoot under white light; (c) a GFP-positive radical emerging from a nut from a F1 cross between a transgenic × a wild-type American chestnut; (d) the same radical under white light. The scale bars are 1.0 mm

be cut open gradually, allowing the plants to adjust to ambient relative humidity. The protocol described here has been used successfully by at least 50 people, including three undergraduate plant tissue culture classes; therefore, we consider it to be quite robust. Optimizations since our previous publication have also made the process much faster and more efficient, reducing the total procedure (embryo to whole plant) from nearly 3 years to just over 1 year. However, a researcher attempting this protocol should still expect to spend 6 months to a year establishing suitable embryogenic cell lines in culture; approximately 6 months transforming, recovering, and testing transformation events; and an additional 2–4 months regenerating whole plants from the transformed cell lines. This protocol assumes that the user is familiar with somatic embryogenesis, has experience in Agrobacterium-mediated transformation with a model species such as petunia or hybrid poplar, and has suitable Agrobacterium strains.

148

Charles A. Maynard et al.

Fig. 4 American chestnut plantlets transplanted to potting mix and topped with small plastic bags to maintain high relative humidity (a). The pots are maintained in a specially modified high-humidity growth chamber (b)

2

Materials

2.1 Specialized Equipment and Supplies

1. Spectrophotometer (equipped for sidearm flasks, below). 2. Nephelo Flasks (VWR Scientific, Rochester, NY) (see Note 1). 3. Desiccation plates: This can be made from 60 × 15 mm sterile disposable Petri plates along with autoclaved and dried 55 mm filter paper discs. Immediately before use, aseptically place one disc in a sterile Petri plate and moisten with 200 μL of sterile distilled water. 4. Bioreactors: Plant tissue culture system periodic immersion vessels (RITA®) (Sigma-Aldrich, St. Louis, MO). 5. Microshoot stand: A workable stand that will hold up to ten shoots can be made from the plastic inner part of a 200 μL pipette tip box, cut to approximately 3 × 4 cm by 0.5 cm high. Autoclave, cool, and store until needed.

2.2 Solutions and Media

All solutions should be made with sterile distilled water unless otherwise noted. Media containing Phytagel® are dispensed into three

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

149

different containers, Magenta GA-7 vessels (polycarbonate “cubes” with polypropylene lids) and two sizes of presterilized plastic disposable Petri plates, “small” 60 × 15 mm and “large” 100 × 15 mm. Media that will go into cubes can be dispensed before autoclaving. Media destined for Petri plates should be autoclaved in bulk in glass bottles and then cooled in a water bath to approximately 55 °C. The media should be brought into a hood, where antibiotics and any other heat-labile ingredients can be added, then poured into sterile Petri plates, and cooled until the media solidifies. If the plates will be stored, they should be sealed individually with sealing cling film or Parafilm®, returned to the plastic sleeve they came from, and refrigerated: 1. Tween 20 solution: 1 % (v/v) Tween 20. Make fresh, do not autoclave. 2. Bleach solution: 50 % (v/v) unscented household bleach (5–6 % sodium hypochlorite) in distilled water, two drops Tween 20 per 100 mL. Make fresh, do not autoclave. 3. Agrobacterium growth medium Luria-Bertani broth (LB), Miller modification with antibiotics): LBA 37 g/L LBA, 100 mg/L kanamycin, pH 7.5. Autoclave, cool to 55 °C, add heat-sensitive components, and pour into large Petri plates in a hood. 4. Agrobacterium growth medium Luria-Bertani broth (LB), Miller modification with antibiotics): 25 g/L LB broth, pH 7.5. Pour into Nephelo sidearm flasks (50 mL each), autoclave, cool, and add 50 mg/L kanamycin. 5. Virulence (Vir) induction medium: 2.3 g/L Woody Plant Medium (WPM) (full-strength basal salts), 10 g/L sucrose, and 9.75 g/L 2-(N-morpholino)ethanesulfonic acid (MES), pH 5.5. Autoclave, cool, add 50 μL of a 19.6 g/L (100 mM) filter-sterilized acetosyringone stock solution per 50 mL immediately before use. 6. Embryo initiation medium (E1): 2.3 g/L WPM salts, 109 mg/L Nitsch and Nitsch vitamins, 1 g/L casein hydrolysate, 1.8 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D) (1.0 μM), 1.1 mg/L 6-benzylaminopurine (BA) (1.0 μM), 30 g/L sucrose, pH 5.5, 3 g/L Phytagel. Autoclave, cool to 55 °C, and pour into small Petri plates in hood. 7. Agrobacterium kill medium (Agro Kill): E1 with 50 mg/L cefotaxime and 333 mg/L (~500 μM) timentin. Autoclave, cool to ~55 °C, add antibiotics, and pour into small Petri plates in hood. 8. Solid selection medium: E1 with 50 mg/L cefotaxime, 333 mg/L (~500 μM) timentin, and 143 mg/L paromomycin. Autoclave, cool to ~55 °C, and pour into small Petri plates in hood.

150

Charles A. Maynard et al.

9. Liquid selection medium: E1 (without Phytagel) with 50 mg/L cefotaxime, 200 mg/L cefotaxime, and 143 mg/L paromomycin. Autoclave, cool, add antibiotics, and dispense into RITA® bioreactors (150 mL each). 10. Embryo initiation medium with paromomycin (E1-P): E1 with 143 mg/L paromomycin. Autoclave, cool to 55 °C, add antibiotics, and pour into small Petri plates in hood. 11. Embryo development medium (E2): 2.3 g/L WPM salts, 1 g/L casein hydrolysate, 0.5 g/L L-glutamine, 60 g/L sucrose, pH 5.5, 3.5 g/L Phytagel. Autoclave, cool to 55 °C, and pour into small Petri plates in hood. 12. Embryo maturation medium (E3): 3.08 g/L Gamborg Basal Salt Mixture (B-5 salts), 2.2 mg/L (0.5 μM) BA, 2.6 mg/L (0.5 μM) α-naphthaleneacetic acid (NAA), 60 g/L sucrose, pH 5.5, 3.5 g/L Phytagel. Autoclave, cool to ~55 °C, and pour into small Petri plates in hood. 13. Embryo germination medium (E4): 2.3 g/L WPM salts, 500 mg/L MES, 500 mg/L polyvinylpyrrolidone (PVP-40), 30 g/L sucrose, pH 5.5, 3.5 g/L Phytagel. Dispense into Magenta cubes, autoclave, and cool. 14. Pre-rooting medium (PR low BA): 2.3 g/L WPM salts, 109 mg/L Nitsch and Nitsch vitamins, 500 mg/L MES, 500 mg/L PVP-40, 1.0 mg/L (0.22 μM) BA, 30 g/L sucrose, pH 5.5, 3.5 g/L Phytagel. Dispense into Magenta cubes, autoclave, and cool. 15. IBA quick-dip solution: 2.03 g/L (10 mM) indole-3-butyric acid (IBA). Autoclave the water, cool to ~55 °C, and filtersterilized immediately before use. 16. Rooting medium: 2.15 g/L Murashige and Skoog (MS) salts, 30 g/L sucrose, pH 5.5, 3.5 g/L Phytage. Dispense into Magenta cubes, autoclave, and cool (see Note 2). 17. Bt soil drench: 4.9 cc (1.0 tsp.) Bacillus thuringiensis (Bt) granules (Gnatrol®, Water Dispersible Granules (WDG) Biological Larvicide, Valent BioSciences Corporation, Libertyville, IL) per liter of room temperature tap water. Make immediately before use. Do not autoclave. 18. Hoagland solution (modified) [37]: 5.09 g/L KNO3, 5.94 g/L Ca(NO3)2, 2.4 g/L MgSO4, 0.68 g/L KH2PO4, 0.8 g/L NH4NO3, 1.125 g/L Sequestrene 330®, 28.6 mg/L H3BO3, 1.81 mg/L MnCl2, 0.22 mg/L ZnSO4, 0.06 mg/L CuSO4, 0.12 mg/L NaMoO4. Do not autoclave. 2.3

Plant Material

Immature burs of American chestnut collected approximately 1 month post-anthesis (see Note 3).

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

2.4 Agrobacterium Strains and Vectors

3

151

Agrobacterium strain EHA105 [38] carrying the binary vector pVspB-OxO [26] (see Note 4) was used for all initial transformation studies until 2011 when we switched to Agrobacterium strain AGL1. The AGL1 gave us higher numbers of transformants per gram of tissue than EHA105.

Methods

3.1 Somatic Embryo Establishment

1. Collect immature burs approximately 1 month post-anthesis (see Note 3). 2. Wearing heavy gloves and using a scalpel, remove the spines from the burs. 3. Cut a slice of bur tissue from the top to expose the seed chamber. 4. Using a combination of scalpel cuts and hand peeling, remove the sides of the bur until the nuts (usually 3 per bur) are fully exposed. Then, break or cut them from the base of the bur (see Note 5) and place 15–20 nuts in a 100 mL wide-mouth bottle with a screw cap. 5. In a laminar flow hood, cover the nuts with 70 % ethanol, cap the bottle, and shake for 20 s. Decant the alcohol into a waste beaker. 6. Pour enough of the 1 % Tween 20 solution to cover the nuts, recap the bottle, and shake vigorously for a few seconds. Shake the bottle every 20–30 s for 3 min. Decant the Tween 20 solution. 7. Add sufficient 50 % bleach solution (~30 to 50 mL) to cover the nuts and allow them to float freely. Shake vigorously for approximately 10 s and then every 20–30 s for 5 min. Decant the bleach solution. 8. Pour in sterile distilled water and shake for approximately 10 s and then every 20–30 s for 5 min. Decant the water. 9. Repeat the sterile water rinses two additional times for a total of three 5-min rinses. 10. Place one nut in a sterile Petri plate. 11. Holding the nut by the pointy end with sterile fine-point forceps, use a sterile scalpel to cut off the base of the nut approximately 1/4 to 1/3 of the way up the nut (see Note 6) from where it’s attached to the bur. 12. Set the nut on the cut end and then slice vertically down both sides. 13. Holding the nut with the scalpel, use the forceps to break the nut into two halves along the suture line between the two cotyledons.

152

Charles A. Maynard et al.

14. Examine the ovules (see Note 7). 15. Using the forceps, pin one of the nut halves to the Petri plate, and using the side of the scalpel as a scoop, transfer the whiteor cream-colored ovules to Petri plates containing E1 medium. Cover and incubate in the dark at approximately 22–23 °C. 16. For the first 2 or 3 weeks, check the plates every other day for contamination. Rescue the clean ovules from a contaminated plate by moving them to fresh E1 Medium (see Note 8). 17. After discarding the ovules with fast-growing contaminants, decrease the frequency of checking to once every 7–10 days (see Note 9). 18. After all contaminated ovules have been eliminated, decrease the transfer frequency to once every 2–3 weeks. 19. Usually after 4–6 weeks (two or three transfers), enough tissue will have emerged from the ovules to require subdividing. For the first few subculture cycles, keep all healthy tissues. Place all of the clumps from one ovule in a single Petri plate (see Note 10). 20. After two or three subculture cycles, there should be 10–12 pieces of tissue from each cell line to choose from. Discard all cell lines that are producing only non-embryogenic callus. Even in the cell lines that are producing somatic embryos, many of the clumps will be callus. Discard these clumps. Many of the remaining clumps will contain both callus and embryos, gently cut off, and transfer only the somatic embryo clumps, discarding the callus. 21. After three or four more subculture cycles, the remaining cell lines will have developed identifiable characteristics. Some will produce over 90 % callus in each clump with very few new embryos. Discard these cell lines; in our experience they will not get any better. Some cell lines will produce mostly embryos with 50 % or less of each clump becoming callus. Keep subculturing these lines, retaining only the best embryos from the best clumps for each cycle. A small fraction of the cell lines will produce clumps that appear to be all embryos. These cell lines are ready to multiply for transformation (see Notes 11 and 12). 3.2 Agrobacterium Inoculum Preparation

1. Streak the Agrobacterium strain containing the plasmid with the gene(s) of interest (from a previous plate or from −80 °C freezer stocks) onto a fresh Petri plate of semisolid Agrobacterium growth medium with antibiotics. Incubate for 48–72 h in the dark at 28 °C. 2. Prepare fresh Agrobacterium growth medium (broth) and dispense 50 mL into sidearm flasks (one flask for each Agrobacterium strain and one extra to be used as a blank to zero the spectrophotometer).

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

153

3. Autoclave, cool, and add antibiotics. 4. Inoculate one sidearm flask with each Agrobacterium strain you will be using. 5. Incubate flask(s) overnight at 28 °C on a shaker at 200 RPM. 6. When the OD650 reading is between 0.8 and 1.2, transfer the Agrobacterium to sterile 50 mL centrifuge tubes. 7. Centrifuge at 1,699 × g for 15 min. 8. Gently pour out the supernatant (do not pour out the pellet). 9. Add 15 mL of Vir induction medium and vortex until the pellet disappears. Transfer to a dry sterile flask (sidearm is not necessary). 10. Add an additional 35 mL of Vir induction medium to the Agrobacterium in each flask. 11. Incubate at 20–22 °C on the shaker (approximately 75 RPM— just enough to form a wave) for 3–4 h (see Note 13). 3.3 Somatic Embryo Transformation

1. Starting with vigorously growing embryo clumps, 1–2 weeks since their last subculture, transfer approximately 20 clumps to a sterile empty 14 mL Falcon tube. 2. Add enough Agrobacterium inoculum from step 11 of Subheading 3.2 to the tube to cover the clumps (4–5 mL). Make sure the clumps are completely wet with inoculum and that the cap is on tight. 3. Incubate for 1 h at room temperature on a 360° rotating shaker (Labquake or equivalent, approx. 30–40 RPM). 4. Remove the inoculum with a pipettor or transfer pipette until the embryos are mostly dry. 5. Prepare desiccation plates by adding 200 μL of sterile distilled water to the center of the filter paper just before use. 6. Transfer the embryo clumps to desiccation plates. They should be placed in ~5 mm diameter piles with approximately 1 cm between the piles. Incubate in the dark at 23–25 °C for 2 days. 7. Transfer the embryo clumps to Agro Kill Medium (in large Petri plates). The clumps should be spread out over the surface in a thin layer so that each clump makes contact with the medium. Incubate in the dark at 23–25 °C for 1 week. 8. After 1 week, add liquid selection medium to a sterile bioreactor. Transfer the embryo clumps to the bioreactor (the air pump timer should be set to go on for 2 min every 4 h). Incubate in the dark at 23–25 °C. 9. Change the medium every 2 weeks by pouring out the old liquid selection medium and adding the new liquid selection medium.

154

Charles A. Maynard et al.

10. After 6–8 weeks, transfer living tissue to solid selection medium. Keep all events separate. Incubate in the dark at 23–25 °C. 11. Multiply each transformation event on selection medium, transferring to fresh medium every 2 weeks. After 4 weeks, begin using E1-P instead of solid selection medium. Incubate in the dark at 23–25 °C. 12. Once there is enough tissue (with three or four extra clumps), use PCR to check [33] for the gene(s) of interest (see Note 14). 3.4 Conversion of Somatic Embryos into Multiplying Shoot Cultures

1. Starting with healthy, vigorously growing (a maximum of 3 weeks since the last transfer) antibiotic-resistant chestnut somatic embryo cultures on E1 medium with 143 mg/L paromomycin, transfer clumps onto Petri plates containing E2 medium. Incubate the embryo clumps in the dark at 23–25 °C for 3 weeks. 2. Transfer all of the embryo clumps to Petri plates containing E3 medium (see Note 15). Incubate the embryos in the dark at 23–25 °C for 7 days. 3. Transfer all of the embryo clumps to a Magenta cube containing E4 medium. Incubate in the light (75 μmol/m2/s, 16 h photoperiod) at 23–25 °C. 4. Subculture the embryos to fresh E4 medium every 2 weeks (see Note 16). 5. Watch the embryo masses for new shoot formation (the shoots should begin to develop in 4–6 weeks). Transfer shoots to PR low BA medium as they appear (see Note 17). 6. Multiply the transgenic shoots by cutting off the callus at the bottom of the shoot, removing the leaves, and cutting the shoots at their internodes in approximately 5 mm segments (see Note 18). 7. Place the new cuttings in PR low BA medium. Incubate in the light (75 μmol/m2/s, 16 h photoperiod) at 23–25 °C.

3.5 Rooting and Acclimatization of Chestnut Microshoots

1. Starting with healthy and vigorously growing chestnut shoot cultures, transfer the shoots to fresh PR low BA medium every 3 weeks until the majority of the shoots are between 3 and 5 cm in length with at least six well-formed leaves. 2. Cut off any callus that may have formed on the base of the elongating shoots. Carefully make a slice up the basal end of the shoots between 1 and 2 mm long or cut the basal end at a 45° angle to increase surface area (move quickly so shoot tips don’t desiccate). 3. Dip the cut end in a freshly prepared IBA quick-dip solution. Approximately 10 mL in a 60 mm Petri plate will provide the appropriate depth (see Note 19).

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

155

4. Immediately after dipping the shoots, transfer them to Magenta cubes containing rooting medium and culture for 4 days in complete darkness. 5. Transfer the shoots to PR low BA medium and culture until roots are visible (2 weeks maximum). Incubate in the light (75 μmol/m2/s, 16 h photoperiod) at 23–25 °C (see Note 20). Once roots begin to form, it is time to pot the plantlets. 6. Prepare a slightly moistened fine potting mixture (such as Fafard® Super-Fine Germinating Mix) (see Note 21). Fill 7″ cylindrical pots to within 2 cm of the top. Using a dibble or a finger, poke a hole in the center of the potting mix approximately 3 cm deep. 7. Rooted plantlets should be removed carefully from the gelled medium, to minimize damage to newly formed roots. Take care to wash the roots free of all gelled medium (see Note 22). Remove and plant one plantlet at a time to reduce transpiration stress. 8. Place one plant in each pot, gently spreading out the root system so that none of the roots are wrapped around the stem or bent at odd angles, and tamp down the potting mix around the roots. 9. Water the plantlet with 30 mL of room temperature tap water. 10. Place a 1-pint sandwich bag over the plantlet and attach it to the pot with a rubber band. 11. Place the plants in a controlled-environment growth chamber with a 16-h photoperiod at 90–150 μmol/m2/s light intensity and 25 °C day temperature. Relative humidity inside the growth chamber should be maintained at a minimum of 85 %. Inside the plastic “tent,” the relative humidity will be very close to 100 % (see Note 23). 12. After 2 weeks, begin acclimatizing the plantlets to ambient humidity by cutting a small (1–2 cm) corner off of the “tent.” If wilting occurs, tape the corner shut and wait a day or two until plants regain turgidity and then cut another corner or remove the tape. After the tents are completely open, plants should be watered approximately twice a week (or as necessary to keep potting mix uniformly damp). Alternate watering with Hoagland liquid fertilizer solution [37] and Bt soil drench (see Note 24). Monitor the plants for wilting. 13. After another 4–8 weeks of exposure to ambient relative humidity in the growth chamber, the acclimatized plantlets can be moved to a shaded greenhouse (see Note 25). 14. In the greenhouse, the developing plants will begin forming larger leaves and should grow rapidly (see Note 26).

156

4

Charles A. Maynard et al.

Notes 1. Nephelo sidearm flasks can be inserted directly into a spectrophotometer equipped with a suitable adapter, allowing for a quick nondestructive determination of optical density. The attached flask sticks up too far to close the spectrophotometer lid but a thick, dark-colored cloth can be draped over the flask to prevent ambient light from interfering with spectrophotometer readings. 2. As an option, 2 g/L of activated charcoal can be added to the rooting medium instead of the 4-day dark treatment. If charcoal is to be used, it should be autoclaved separately with 1/2 the final volume of distilled water. The autoclaved and partially cooled (~55 °C) rooting medium made up at 2× the final volume should then be added to the containers in a laminar flow hood, swirled briefly to mix, and allowed to cool. Alternatively, when we have several hundred shoots to root, we use sterile disposable plastic “clamshell” fast-food containers. Purchased by the case (500/case), these cost ~7 cents each. They will hold ~200 mL of rooting medium with ~20 to 30 shoots per case. 3. Collect only from chestnut trees in flowering groups. Castanea is almost completely self-sterile so ovules from isolated trees will abort. Expect to see large tree-to-tree differences in contamination rates and ease of establishment of cell lines; therefore, it is better to collect a few burs (perhaps 10–15) from many different trees rather than a lot of burs from a few trees. Burs can be kept at 4 °C in sealed plastic bags for a week or longer, but if the spines turn brown, the ovules inside are probably brown too, meaning they are dying. 4. The original pVspB-OxO vector carries three genes: a selectable marker (bar), a scorable marker (gfp), and a putative blight resistance gene (OxO). The bar gene codes for a phosphinothricin acetyltransferase [39] and is controlled by a potato ubiquitin (Ubi3) promoter and terminator [40]. This gene conveys resistance to glufosinate-ammonium. The gfp gene codes for a modified green fluorescent protein (mgfp5-ER). It is driven by a CaMV 35S promoter and terminator [41]. The OxO gene codes for a wheat germin-like oxalate oxidase gene [42]. It is driven by a soybean vegetative storage protein (VspB4) promoter [43] and has an actin 2 (Act2) terminator. Details of the construction of pVspB-OxO are in [26]. When we used this vector alone, we included 30.27 µM glufosinate-ammonium in the selection medium. When we did co-transformations with two plasmids, one plasmid had the gfp and bar genes while the second had an nptII gene and the gene of interest. We included both glufosinate-ammonium and Paromomycin in the original three selection media (Solid, Liquid and Embryo Initiation + Par).

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

157

In 2013, when we stopped doing co-transformations, we eliminated the plasmid containing the bar gene and with it the need to include glufosinate-ammonium. 5. Be careful not to cut into the nut or else the bleach solution will kill the ovules. Treat only as many nuts as can be processed in 1 day. With practice, it is possible to extract and plate out ovules from approximately 15 to 20 nuts in 1 h, but it is tiring because of the tough seed coats. We found that one person could work for approximately 3 h at a sitting. 6. In immature chestnuts, all the ovules are in a little cluster at the pointy end of the nut. 7. Castanea nuts are polyembryonic with 12 or more ovules in each nut. Soon after fertilization, all the ovules begin to grow, but within 6 weeks, one will have expanded to fill the nut while the rest will have aborted. The optimum stage of development for establishing somatic embryo cell lines is when the cluster of ovules has begun to develop, but the dominant ovule is still less than three times the size of the other ovules in the group. If the largest ovule in the cluster is too big and the others are brown or black, discard the nut. 8. Expect a high contamination rate. Also expect some trees to have higher contamination than others. 9. There is usually a burst of initial contamination from fastgrowing fungi and bacteria, but slow-growing bacteria can show up after a month or more. If apparently “clean” ovules are repeatedly “rescued,” these slow-growing contaminants may not be discovered for many weeks. 10. A broad range of tissue types will emerge from the ovules. The key is being able to distinguish between callus and somatic embryos. Somatic embryos look like clusters of balloons or grapes. They are smooth and regular in shape. Callus is more rough-surfaced and irregular in shape than the somatic embryos. 11. It requires a large number of nuts, preferably collected from a number of different trees, to eventually end up with a small number of vigorous somatic cell lines. In 2004, our lab received burs from 18 trees, explanted more than 3,000 ovules, and 6 months later had five cell lines suitable for transformation studies. 12. If cell cultures are stressed due to infrequent transfers to fresh medium, transformation efficiency will plummet. 13. The purpose of this step is to induce the VIR genes, not to grow more bacteria. 14. Screening transformation events for correct DNA integration is an important follow-up for the transformation process, but requires equipment and expertise well beyond that available in most tissue culture laboratories. The simplest screen is to use

158

Charles A. Maynard et al.

PCR; however, this technique cannot be used to determine gene copy number in a transformation event. Southern hybridization assays require considerably more time, expertise, and tissue for extracting DNA but can be used to distinguish unique events and determine copy number. Quantitative (realtime) PCR (qPCR) is a recent alternative that is quicker and easier than Southern hybridization, yet can still be used to estimate copy number. 15. Many of the embryos may be abnormal (normal embryos will have two cotyledons). They may have only one cotyledon, the cotyledons may be fused, or there may be more than two cotyledons. Transfer all of them, as this does not seem to affect the subsequent regeneration process. 16. The embryos will grow into unrecognizable lumpy green masses, 1–2 cm in size. Don’t be overly concerned. Some will eventually form morphologically normal shoots. 17. Agrobacterium transforms hundreds of cells in each clump of embryos. The gene(s) of interest will incorporate in a different place on different chromosomes in each cell, so they often have a wide range of expression. It is necessary to sort out all of the events so that each cell line can be traced back to a single cell. Sometimes what appears to be a single transformation event is actually a mixture of two or more events. In theory, it is possible to have an embryo form from several cells rather than just one. All embryogenic tissue would be chimeric from that point on. In practice we have never observed chimeric events in somatic embryo cultures of American chestnut, but we have observed a modest percentage of mixed events. Where several embryos located close together were isolated from the rest of the untransformed tissues but were multiplied as mixed cultures and even regenerated into mixed shoot cultures. One way to make sure that each cell line traces back to a single event is to transfer one and only one shoot from each putative event to PR low BA medium. That way even if the embryo culture was actually a mix of several events, only one will move forward as a shoot culture. 18. Once a transgenic cell line has been regenerated into a stable shoot culture, it can be maintained for years by subculturing every 4–6 weeks onto fresh PR low BA medium in Magenta cubes. 19. A microshoot stand will allow the operator to dip a batch of shoots together. Keep the shoots moist by placing the stand in a sterile Petri plate with approximately 5 mm of sterile water. Place up to ten shoots in a presterilized rack and then transfer the whole stand to a Petri plate containing the IBA quick-dip solution.

Chestnut, American (Castanea dentata (Marsh.) Borkh.)

159

20. Transfer all shoots, even those not rooted, to the PR low BA. More shoots will produce roots during this step. Shoots that are still not rooted at the end of this step can also be potted; they may produce ex vitro roots. This will also allow time for shoots with tip dieback to begin elongating an axillary bud. During this stage, it is normal to witness shoot-tip dieback. In some cases, it can be as severe as 50 % of the total shoot height. 21. Even though the soil mix is not sterile, it is important to maintain a high degree of cleanliness in this step. Estimate 500 mL of potting mixture per 7″ tube. Many potting mixes have fertilizer incorporated in the mix; however, Fafard® Super-Fine Germinating Mix does not. We add Scotts Micromax Granular Micronutrients at the rate of 1.0 g/L of dry potting mix. After thoroughly incorporating the dry components, we add ~1 L of tap water per liter of potting soil and then mix again until uniformly moistened. 22. The roots will be very fragile. It is helpful to break up the solid medium with forceps before removing the plantlets. This stage is the beginning of non-sterile conditions, which is why all of the tissue culture medium must be removed from the roots. Any medium left on the roots will promote fungal growth. As an additional precaution, plantlets can be dipped in a fungicide solution. 23. The plastic bag functions much like the “sweat tent” used in horticulture to propagate cuttings. It is important to begin increasing the light level at this stage. 24. The Bt treatments start 2 weeks after the bags are clipped and alternate with the fertilization of Hoagland solution. 25. Many commercial potting mixes that contain peat moss also harbor viable fungus gnat eggs. These hatch into fungus gnat larvae, which have insatiable appetites for plant roots. We routinely treat all acclimatizing plantlets every 2 weeks with a Bt soil drench. 26. For the combined rooting and acclimatization process, expect to see an overall survival rate of 50 %. In the greenhouse and subsequent field planting, we have found that micropropagated plantlets lag behind seedlings of the same age for the first growing season.

Acknowledgments Financial support was provided by the Forest Health Initiative, the Monsanto Fund, the American Chestnut Foundation (New York chapter and National), USDA-Biotechnology Risk Assessment Grant program (BRAG), the Consortium for Plant Biotechnology Research (CPBR), and ArborGen LLC.

160

Charles A. Maynard et al.

Photography: Greg Boyd Fig. 1; Linda McGuigan Figs. 2, 3a, b; Andy Newhouse Figs. 3c, d; William Powell Fig. 4. The following individuals have also contributed biological materials, time, and financial support or, in some other way, have contributed to this publication and to the American Chestnut Research and Restoration Project: Stanley and Arlene Wirsig, Herbert and Jane Darling, Dick Radel, Dale Travis, Bryan Burhans, John Dougherty, Joyce Fry, Mary Lou Rath, Dawn Parks, Maud Hinchee, James Donowick, John Ellis, Scott Merkle, Zizhuo Xing, Sharon and Seth LaPierre, Mike Satchwell, Haiying Liang, Katie Damico, and Kristen Russell. References 1. Russell EWB (1987) Pre-blight distribution of Castanea dentata (Marsh.) Borkh. Bull Torrey Bot Club 114(2):183–190 2. Murrill WA (1906) A serious chestnut disease. J NY Bot Garden 7(8):143–153 3. Diller JD, Clapper RB (1965) A progress report on attempts to bring back the chestnut tree in the eastern United States, 1954-1964. J Forestry 63(3):186–188 4. Gonzales ML, Vieitez AM, Vieitez E (1985) Somatic embryogenesis from chestnut cotyledon tissue cultured in vitro. Sci Hortic 27:97–103 5. Piagnani C, Eccher T (1990) Somatic embryogenesis in chestnut. Acta Hortic 280:159–161 6. Vieitez FJ, San Jose MC, Ballester A, Vieitez AM (1990) Somatic embryogenesis in cultured immature zygotic embryos in chestnut. J Plant Physiol 136:253–256 7. Merkle SA, Wiecko AT, Watson-Pauley BA (1991) Somatic embryogenesis in American chestnut. Can J For Res 21:1698–1701 8. Maynard CA (1991) Using PCR to confirm Agrobacterium transformation of American chestnut (Castanea dentata). Abstract No. 927. In: Program and abstracts of the third international congress of plant molecular biology: molecular biology of plant growth and development. Tucson, Arizona. 6–11 Oct 1991 9. Merkle S, Carraway DT, Watson-Pauley BA, Wilde HD (1992) Somatic embryogenesis and gene transfer in American chestnut. Proceedings of the international chestnut conference, Morgantown, West Virginia, 10–14 July 1992. West Virginal University Press, Morgantown, W.Va 10. Carraway DT, Wilde HD, Merkle SA (1994) Somatic embryogenesis and gene transfer in American chestnut. J Am Chest Found 8(1): 29–33

11. Vieitez AM, Ballester A, Vieitez ML, Vieitez E (1983) In vitro plantlet regeneration of mature chestnut. J Hortic Sci 58:457–463 12. Vieitez AM, Vieitez ML (1983) Castanea sativa plantlets proliferated from axillary buds cultivated in vitro. Sci Hortic 18:343–351 13. Chauvin JE, Salesses G (1988) Advances in chestnut micropropagation (Castanea sp.). Acta Hortic 227:340–345 14. Chevre AM, Salesses G (1987) Choice of explants for chestnut micropropagation. Acta Hortic 212:517–523 15. Mullins KV (1987) Micropropagation of chestnut (Castanea sativa Mill.). Acta Hortic 212:525–530 16. Piagnani C, Eccher T (1988) Factors affecting the proliferation and rooting of chestnut in vitro. Acta Hortic 227:384–386 17. Strullu DG, Grellier B, Marciniak D, Letouze R (1986) Micropropagation of chestnut and conditions of mycorrhizal synthesis in vitro. New Phytol 102:95–101 18. Vieitez AM, Ballester A, Vieitez E (1987) Vitrification in chestnut shoots regenerated in vitro. Acta Hortic 212:231–234 19. Maynard C, Satchwell M, Rieckermann H (1993) Micropropagation of American chestnut (Castanea dentata (Marsh.) Borkh.): rooting and acclimatization. In: Proceedings of the second northern forest genetics association conference, 29–30 July 1993, St. Paul, Minnesota. pp 161–170 20. Merkle S, Andrade G, Pettis S, Johnson S, Kormanik T, Le H, Maner L (2008) Recent advances in American chestnut in vitro propagation. J Am Chest Found 22:23–30 21. Carraway DT, Merkle SA (1997) Plantlet regeneration from somatic embryos of American chestnut. Can J For Res 27:1805–1812

Chestnut, American (Castanea dentata (Marsh.) Borkh.) 22. Robichaud RL, Lessard VC, Merkle SA (2004) Treatments affecting maturation and germination of American chestnut somatic embryos. J Plant Physiol 161:957–969 23. Seabra RC, Pais MS (1998) Genetic transformation of European chestnut. Plant Cell Rep 17:177–182 24. Corredoira E, Montenegro D, San-Jose MC, Vieitez AM, Ballester A (2004) Agrobacteriummediated transformation of European chestnut embryogenic cultures. Plant Cell Rep 23: 311–318 25. Maynard CA, Polin LD, LaPierre S, Rothrock RE, Powell WA (2006) American chestnut (Castanea dentata (Marsh.) Borkh.) (Chapter 22). In: Wang K (ed) Agrobacterium protocols, 2nd edn. Humana, Totowa, pp 239–251 26. Polin LD, Liang H, Rothrock R, Nishii M, Diehl D, Newhouse A, Nairn J, Powell WA, Maynard CA (2006) Transformation of American chestnut (Castanea dentata (Marsh.) Borkh.) somatic embryos. Plant Cell Tiss Org Cult 84:69–78 27. Gisele M, Campbell A, Nairn J, Huong TL, Merkle SA (2009) Sexually mature transgenic American chestnut trees via embryogenic suspension-based transformation. Plant Cell Rep 28:1385–1397 28. Kong L, Holtz CT, Nairn CJ, Houke H, Powell WA, Baier K, Merkle SA (2013) Application of airlift bioreactors to accelerate genetic transformation in American chestnut. Plant Cell Tiss Org Cult (PCTOC) 117:39–50 29. Zhang B, Newhouse AE, McGuigan LD, Maynard CA, Powell WA (2011) Agrobacterium-mediated co-transformation of American chestnut (Castanea dentata) somatic embryos with a wheat oxalate oxidase gene. (Extended abstract for the IUFRO meeting in 2011). BioMed Central (BMC) Proc 5(Suppl 7):43 30. Powell WA, Morley P, King M, Maynard CA (2007) Small stem chestnut blight resistance assay. J Am Chest Found 21(2):34–38 31. Newhouse AE, Spitzer JE, Maynard CA, Powell WA (2014) Leaf inoculation assay as a rapid predictor of chestnut blight susceptibility. Plant Dis 98(1) 32. Zhang B, Oakes AD, Newhouse AE, Baier KM, Maynard CA, Powell WA (2013) A threshold level of oxalate oxidase transgene expression reduces Cryphonectria parasitica— induced necrosis in a transgenic American chestnut (Castanea dentata) leaf bioassay. Transgenic Res 22(5):973–982, http://link.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

161

springer.com/article/10.1007%2Fs11248013-9708-5# Newhouse AE, Zhang B, Northern L, Maynard CA, Powell WA (2010) Analysis of transgenic American chestnut. Phytopathology 100:S89 Komari T, Hiei Y, Saito Y, Murai N, Kumashiro T (1996) Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J 10:165–174 McGuigan L, Northern LC, Stewart KE, Powell WA, Maynard CA (2012) Transforming American chestnut somatic embryos using a temporary-immersion bioreactor system. Poster presented at the Fifth International Chestnut Symposium, 4–8 Sep 2012, National Conservation Training Center, Shepherdstown, WV Cheng M, Hu T, Layton J, Liu C, Fry JE (2003) Desiccation of plant tissues postAgrobacterium infection enhances T-DNA delivery and increases stable transformation efficiency in wheat. In Vitro Cell Dev Biol Plant 39:595–604 Hoagland DR, Arnon DI (1950) The waterculture method for growing plants without soil, vol Circ. 347. Univ. of Calif. Agric. Exp. Station, Berkley Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2: 208–218 White J, Chang SY, Bibb MJ (1990) A cassette containing the bar gene of Streptomyces hygroscopicus: a selectable marker for plant transformation. Nucleic Acids Res 18:1062 Garbino JE, Belknap WR (1994) Isolation of a ubiquitin-ribosomal protein gene (ubi3) from potato and expression of its promoter in transgenic plants. Plant Mol Biol 24:119–127 Haseloff J, Siemering KR (1998) The uses of GFP in plants. In: Chalfie M, Kain S (eds) Green fluorescent protein: properties, applications, and protocols. Wiley-Liss, New York, pp 191–220 Dratewka-Kos E, Rahman S, Grzekzak ZF, Kennedy TD, Murray RK, Lane G (1989) The polypeptide structure of germin as deduced from cDNA sequencing. J Biol Chem 264: 4896–4900 Mason HS, DeWald DB, Mullet JE (1993) Identification of a methyl jasmonate-responsive domain in the soybean vspB promoter. Plant Cell 5:241–251

Chapter 14 Chestnut, European (Castanea sativa) Elena Corredoira, Silvia Valladares, Ana M. Vieitez, and Antonio Ballester Abstract Development of a system for direct transfer of antifungal candidate genes into European chestnut (Castanea sativa) would provide an alternative approach to conventional breeding for production of chestnut trees that are tolerant to ink disease caused by Phytophthora spp. Overexpression of genes encoding PR proteins (such as thaumatin-like proteins), which display antifungal activity, may represent an important advance in control of the disease. We have used a chestnut thaumatin-like protein gene (CsTL1) isolated from European chestnut cotyledons and have achieved overexpression of the gene in chestnut somatic embryogenic lines used as target material. We have also acclimatized the transgenic plants and grown them on in the greenhouse. Here, we describe the various steps of the process, from the induction of somatic embryogenesis to the production of transgenic plants. Key words Agrobacterium tumefaciens, Castanea sativa, Forest biotechnology, Genetic transformation, gfp, Somatic embryogenesis, Thaumatin-like protein

1

Introduction European chestnut (Castanea sativa Mill.) is a tree of great historical, ecological, and economic significance, and it is distributed within 25 European countries, covering an area of over two million hectares [1]. Chestnuts, which have been cultivated for centuries, were used as a staple food [2], and chestnut wood was used to make house frames and furniture, for tannin production and as source of renewable energy. Ink disease, mainly caused by Phytophthora cinnamomi Rand and P. cambivora (Petri) Buis, is one of the most destructive diseases affecting European chestnut [3]. The species is also threatened by the ascomycete fungus Cryphonectria parasitica (Murr.), which causes blight or canker disease. However, the trees partially recover from this disease as a result of the natural occurrence of hypovirulence [4], which causes nonlethal, superficial (healing) cankers that are restricted to the outer parts of the bark.

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_14, © Springer Science+Business Media New York 2015

163

164

Elena Corredoira et al.

Production of ink-resistant trees by conventional breeding is based on the Asian species C. mollissima Blume and C. crenata Sieb. and Zucc., both of which exhibit natural tolerance/resistance to the disease. Programs have been designed to produce interspecific hybrids with European chestnut [5], and a large number of first-generation hybrids that are tolerant to ink disease have been selected and used in Europe. Conventional breeding approaches have been hampered by the long reproduction cycle of the species, which extends the backcross processes used to diminish the Asian genetic background in the hybrids. Selection of trees exhibiting natural resistance is a complementary approach used in the European chestnut tree improvement program [6]. To maintain the resistance, the selected trees should by propagated vegetatively, which makes chestnut an ideal target for genetic improvement via transgenic approaches involving clonal propagation. Specific genes for resistance to chestnut diseases have not yet been identified, but the use of pathogenesis-related (PR) proteins, which play a major role in natural defense against pests and pathogens, is of interest. Both biolistic and Agrobacterium-mediated transformation were initially evaluated to transform European chestnut and American chestnut (C. dentata (Marsh.) Borkh), but no stable transformation events were achieved. The main causes of the failure, as extensively reviewed [7], may be ascribed to the target material used in the experiments: hypocotyl segments from in vitro germinated seedlings, stem segments from in vitro grown shoots, leaf discs, and axillary nodes of cotyledons. In our experience, plant regeneration systems based on adventitious bud induction have not proved reliable in chestnut, and this is probably the cause of the failure to achieve genetic transformation with the above mentioned types of target material. In all these cases, transgenic events were observed, but no transgenic plants were recovered. The first report of successful Agrobacterium-mediated transformation of a species of the genus Castanea described regeneration of transgenic plants from European chestnut by using somatic embryos as the target material [8, 9]. In these studies, marker genes were used and an improved protocol was defined after evaluation of the different parameters involved in the process: effect of the genotype, type (size) of initial explants, coculture period, effect of antibiotics and of antioxidants, etc. As the ultimate goal for the genetic transformation of chestnut should be the production of plants that are resistant/tolerant to certain fungal diseases, we have recently developed a new protocol to overexpress a native thaumatin-like protein gene in embryogenic cultures of European chestnut [10]. Overexpression of this protein, isolated from seeds of European chestnut, provides a means of producing cisgenic plants [11], which should be linked to the regulatory systems designed to manage the risks of genetic modified organisms and to respond to public concern. To develop a protocol for genetic transformation of

Chestnut, European (Castanea sativa)

165

chestnut, a consistent and reproducible somatic embryogenesis (SE) system is essential. In European chestnut, immature zygotic embryos or leaves collected from in vitro axillary shoot cultures can be used as initial explants to induce SE [12]. The use of leaf explants offers the following advantages over the use of zygotic embryo tissues: clonal material is a suitable source of explants for inducing somatic embryogenesis from selected mature genotypes, no sterilization procedure is required, and experiments can be programmed all year around. Moreover, in vitro establishment of chestnut axillary shoot cultures, multiplication, rooting, and plantlet regeneration are well-defined processes [13]. In this chapter, we describe the Agrobacterium-mediated European chestnut transformation protocol routinely used in our laboratory [10]. In this protocol, A. tumefaciens strain EHA 105 containing a plasmid construct with an nptII gene is used as selectable marker and a gfp gene as a scorable marker. The chestnut gene encoding a thaumatin-like protein, designated CsTL1, is also cloned in the vector under the CaMV35S promoter. The efficiency of transformation varied from 7.1 to 32.1 % and was clearly genotype dependent. Currently, the conversion of somatic embryos into plantlets is a limiting step for chestnut embryogenic systems [12, 14]; the same applies to transgenic embryos, for which low conversion frequencies are obtained (3.3–20 %, depending on the genotype) [10]. However, all the embryogenic lines tested also produced a number of embryos that developed only shoots during culture on germination medium, while root growth remained blocked. These shoots may be excised and used to establish axillary shoot cultures that can be multiplied by axillary branching and then rooted using established protocols [13], allowing the production of a large number of transgenic plants.

2 2.1

Materials Plant Material

1. Immature nuts of European chestnut collected during the 10–11 weeks post-anthesis (approx. last week of August and the first week of September in Santiago de Compostela, NW Spain, 42°52′50″N, 8°32′40″W). 2. Leaf and shoot apex explants from stock shoot multiplication cultures (see Note 1). The protocols for induction of somatic embryos are described in Subheadings 3.1 and 3.2, according to Corredoira et al. [12].

2.2 Agrobacterium tumefaciens Strain and Vector

1. A. tumefaciens strain EHA 105 [15] carrying the vector pK7WG2D-TAU [10] is used (see Note 2 and Fig. 1). This vector contains the CsTL1 gene [16], encoding a thaumatinlike protein, under the CaMV35S promoter. The vector also includes a green fluorescence protein (gfp) reporter gene

166

Elena Corredoira et al. RB

LB

T-nos

npt II

Pro-nos

T-S

CsTL1

Pro-S Pro-rolD

egfpER

T-S

Fig. 1 Structure of T-DNA region of the binary vector pK7WG2D-TAU [10]. T-nos, Pro-nos, terminator, and promoter of nopaline synthase gene, respectively; nptII, neomycin phosphotransferase marker gene; T-35S, Pro-35S, terminator, and promoter of CaMV 35S RNA gene, respectively; CsTL1 gene encoding a thaumatinlike protein, Pro-rolD the rol root loci D (rolD) promoter, egfpER enhanced green fluorescence protein gene with endoplasmic reticulum-targeting signal, RB, LB T-DNA right and left border, respectively

driven by the rol root loci D (rolD) promoter (see Note 3) and a neomycin phosphotransferase (nptII) selectable marker gene driven by the nopaline synthase (nos) promoter. 2.3

Stock Solutions

1. For surface sterilization of nuts: 70 % ethanol and sterilizing solution defined as sodium hypochlorite in distilled water (Millipore® Chlorine Tablets, 4 % active chlorine) with two or three drops Tween® 80 per liter. Make fresh. 2. For plant acclimatization: Hoagland’s solution [17]. 3. Stock solution of N6-benzyladenine (BA): weigh 10 mg BA and dissolve in water on heat. When dissolved, bring up to 100 mL final volume with water. Stock solution in aliquots is stored at −20 °C. 4. Stock solutions of auxins: naphthaleneacetic acid (NAA), 3-indole-butyric acid (IBA), and 2,4-dichlorophenoxyacetic acid (2,4-D); weigh 10 mg auxin and dissolve in 0.8 mL ethanol. When dissolved, bring up to 100 mL final volume with water. Stock solutions are stored at 4 °C for 1 month. 5. Stock solutions of antibiotics: kanamycin and nalidixic acid, 10 mg/mL, prepared by dissolving the antibiotics in water, filtered through 0.22 μm sterile filters, and stored at −20 °C.

2.4

Culture Media

2.4.1 For Agrobacterium

2.4.2 For Chestnut

1. Agrobacterium growth medium (Luria Bertani (LB) [18] + antibiotics): 10 g/L Bacto-tryptone, 5 g/L Bacto yeast extract, 10 g/L NaCl, kanamycin (50 mg/L), nalidixic acid (50 mg/L), and pH 7. Add Bacto Agar (1.5 %) to prepare solid LB medium. Antibiotics are added after autoclaving when medium is cooled. 1. Axillary shoot proliferation medium: Gresshoff and Doy (GD) medium [19] (Duchefa, Netherlands), BA (0.44 μM), sucrose (3 %) and Bacto Agar (0.7 %) (Table 1). 2. Somatic embryo induction medium for zygotic embryos (M1Z): Murashige and Skoog (MS) medium [20], sucrose (3 %), agar (0.6 %), casein hydrolysate (500 mg/L), 2,4-D (4.52 μM), and BA (0.88 μM) (Table 1).

MS

–

500

2.22 or 4.44

5.37 or 21.48

–

–

30

–

–

6

Basal medium

Glutamine (mg/L)

Casein hydrolysate (mg/L)

BA (μM)

NAA (μM)

IBA (μM)

2,4-D (μM)

Sucrose (g/L)

Maltose (g/L)

Bacto agar (g/L)

Sigma agar (g/L)

6

–

30

4.52

–

–

0.88

500

MS

SE induction in ZE (M1-Z)

7

–

–

30

–

–

0.54

0.44

–

438

½ MS

SE proliferation

7

–

30

–

–

–

–

–

–

–

½ MS

SE maturation

7

–

–

30

–

0.49

–

0.44

–

200

½ MS

SE germination

–

7

–

30

–

–

–

0.44

–

–

GD

Axillary shoot proliferation

–

6.5

–

30

–

122.5

–

–

–

–

1/3GD

Shoot rootinga

BA 6-benzyladenine, 2,4-D 2,4-dichlorophenoxyacetic acid, GD Gresshoff and Doy, 1/3 GD GD with 1/3 macronutrients, IBA indole-3-butyric acid, MS Murashige and Skoog, ½ MS MS half-strength macronutrients, NAA naphthaleneacetic acid, SE somatic embryos, ZE zygotic embryos a After 24–48 h in rooting medium, shoots were transferred to the same medium without AIB for 4 weeks

SE induction in leaves/apex (M1-L)

Components

Table 1 Culture media used in the different steps of somatic embryogenesis in European chestnut

Chestnut, European (Castanea sativa) 167

168

Elena Corredoira et al.

3. Somatic embryo induction medium for leaf and apex explants (M1-L): MS medium supplemented with sucrose (3 %), agar (0.6 %), casein hydrolysate (500 mg/L), 5.37 μM NAA and 4.44 μM BA or 21.48 μM NAA and 2.22 μM BA (Table 1). 4. Expression medium I (M2): MS medium supplemented with sucrose (3 %), agar (0.6 %), casein hydrolysate (500 mg/L), NAA (0.54 μM), and BA (0.44 μM). 5. Expression medium II (M3): MS medium supplemented with sucrose (3 %), agar (0.6 %), and casein hydrolysate (500 mg/L). 6. Proliferation medium: MS medium, glutamine (438 mg/L; Sigma), NAA (0.54 μM), BA (0.44 μM), sucrose (3 %), and Sigma agar (0.7 %) (Table 1). 7. Infection medium: MS liquid medium plus sucrose (5 %). 8. Isolation medium: proliferation medium (Table 1) without plant growth regulators (PGR). 9. Selection medium: proliferation medium (Table 1) supplemented with 300 mg/L carbenicillin, 200 mg/L cefotaxime, and 150 mg/L kanamycin. Antibiotics are added after autoclaving when medium is cooled. 10. Maturation medium: consisting of MS (half-strength macronutrients) medium supplemented with maltose (3 %) and Sigma agar (0.7 %) (Table 1). 11. Pregermination medium: MS (half-strength macronutrients) medium with sucrose (3 %) and Sigma agar (0.8 %). 12. Germination medium: MS medium (half-strength macronutrients), glutamine (200 mg/L), BA (0.44 μM), IBA (0.49 μM), sucrose (3 %), and Sigma agar (0.7 %) (Table 1). 13. Shoot rooting medium: GD (1/3 strength macronutrients) medium supplemented with IBA (122.5 μM) (Table 1). The above mentioned media were adjusted to pH 5.6–5.7 prior to autoclaving at 115 °C for 20 min. 2.5 Specialized Equipment and Supplies

1. Incubator and environmentally controlled shaker for A. tumefaciens growth. 2. Spectrophotometer to determine the bacterial optical density at 600 nm (OD600). 3. Horizontal and vertical laminar flow cabinet, stereomicroscope, centrifuge, autoclave, and pH meter. 4. Epi-fluorescence stereomicroscope (Zeiss SV11) equipped with a light source consisting of a 100 W mercury bulb and an FITC/GFP filter set with a 480 nm excitation filter and a 515 nm long-pass emission filter (Chroma Technology Corp., USA, or equivalent) (see Note 3).

Chestnut, European (Castanea sativa)

169

5. For Agrobacterium culture: Eppendorf tubes, plastic tubes (18 × 12 mm, 15 mL), micropipettes, pipette tips, Bunsen burner, inoculating loops, racks, beakers (50 mL), Erlenmeyer flasks (0.5 and 2 L), sterile disposable Petri dishes (90 mm, 25 mL), and Parafilm. 6. For chestnut culture: forceps, scalpel, glass bed sterilizer, test tubes (20 × 150 mm, 16.5 mL/tube), glass jars (85 × 80 mm, 300 mL), sterile filter paper, sterile disposable Petri dishes (90 mm, 25 mL), and Parafilm. 7. For plantlet acclimatization: plastic pots (90 × 100 mm, 0.5 L) and sterile peat to perlite (3:1, v/v).

3

Methods

3.1 Induction of Somatic Embryogenesis from Zygotic Embryos

1. Ideally, harvest immature burs during the 10–11 weeks post-anthesis. 2. Remove the spines from the burs with the aid of a scalpel, open the burs, and isolate the nuts (usually 3 nuts/bur). 3. Remove the external seed coat of the nuts, leaving the inner coat intact, and surface sterilize by successive immersion in 70 % (v/v) ethanol for 30 s and a sterilizing solution for 10 min (stir gently). 4. Drain off the chlorine solution and rinse the de-coated seeds three times in sterile distilled water; the first rinse should last a few seconds and the other two rinses, 10 min each. The seeds are then transferred to a water bath pending the next step. 5. Place a nut on sterile filter paper, excise the zygotic embryo with the aid of a scalpel, and dissect into cotyledon segment and embryonic axis explants. 6. Place the explants in tubes filled with 16.5 mL of M1-Z medium (Table 1). 7. Maintain the cultures in darkness at 25 °C for 6 weeks and then transfer the explants to M2 medium; maintain in darkness for further 30 days. 8. At the end of this period, transfer the zygotic embryo explants, at monthly intervals, to glass jar containing 50 mL of M3 medium and kept them under a 16-h photoperiod (50– 60 μmol/m2/s) at 25 °C light/20 °C darkness (standard conditions). 9. Calculate the somatic embryogenesis induction frequency by counting the number of explants producing somatic embryos in relation to the total number of explants used. Generally, somatic embryos appeared in this medium on the surface of a callus 3–5 months after initiation of the culture (see Note 4).

170

Elena Corredoira et al.

3.2 Induction of Somatic Embryogenesis from Leaf and Shoot Apex Explants

1. Isolate the 1–3 uppermost unfurled expanding leaves and shoot apex (1.0–1.5 mm in length) from shoot cultures following 4 weeks of the last subculture cycle (see Note 5, Fig. 2a, b). 2. Place the leaves (abaxial side down) on sterile Petri dishes filled with 25 mL of M1-L medium (Table 1).

Fig. 2 Different steps in the production of transgenic plants of European chestnut. (a) Chestnut shoot multiplication cultures from which apex and leaf explants (b) are isolated for induction of somatic embryogenesis. (c) Somatic embryos initiated from leaf explant. (d) Cluster of putatively transformed somatic embryos isolated after 8 weeks in selection medium. (e) Transformed cluster of somatic embryos observed under white light. (f) The same cluster of somatic embryos observed under blue light showing green fluorescence. (g) The gfp expression on shoot apex of transgenic plant visualized with an epi-fluorescence stereomicroscope. (h) Transgenic plants after 6 weeks acclimatization in the growth chamber. Scale bars in c–e, 1 mm

Chestnut, European (Castanea sativa)

171

3. Maintain the cultures in darkness at 25 °C for 6 weeks and then transfer the explants to the M2 medium and maintain in darkness for further 30 days. 4. Transfer the explants, at monthly intervals, to M3 medium and maintain them under standard conditions. 5. Calculate the somatic embryogenesis induction frequency by counting the number of explants producing somatic embryos in relation to the total number of explants used (Fig. 2c). Somatic embryos usually appear in this medium on the surface of a callus 3–6 months after culture initiation (see Note 6). 3.3 Proliferation and Maintenance of Somatic Embryos

1. Isolate somatic embryos initiated from both zygotic embryos and leaf/apex explants, and multiply them by secondary embryogenesis (see Note 7). 2. For embryo proliferation, place groups of 3–5 somatic on embryo proliferation medium (Table 1) with subculture at 6-week intervals under standard conditions.

3.4 Preparation of Agrobacterium Inoculum for Infection

1. Store Agrobacterium tumefaciens strain EHA105 transformed with the vector pK7WG2D-TAU in −80 °C glycerol stocks. 2. To initiate a chestnut transformation experiment, scratch the surface of the glycerol stock using a cooled inoculating loop and streak cells across the Agrobacterium growth solid medium. 3. Incubate the inoculated plate upside down for 2–3 days at 28 °C in darkness until single colonies are developed. 4. Pick up an isolate single colony from the plate with a sterile inoculating loop and place it in 2 mL of Agrobacterium growth liquid medium. Incubate this culture overnight at 28 °C with shaking (200 rpm) in darkness. 5. Pipette 1 mL of this bacterial suspension and inoculate it into Erlenmeyer flasks (2 L) containing 600 mL of Agrobacterium growth liquid medium, and then incubate this bacterial suspension at 28 °C in darkness with shaking (100 rpm) until an OD600 = 0.6 is reached. 6. Centrifuge the bacterial culture at 6,250 × g for 10 min at 10 °C. 7. Discard the supernatant and resuspend the pellet in 200 mL of infection medium. Incubate this culture 10 min at 28 °C with shaking (100 rpm) in darkness.

3.5 Infection and Cocultivation of Somatic Embryos

1. Use embryogenic cultures 4 weeks after the last subculture and dissect, under stereomicroscope, explants consisting of small clumps (4–7 mg) of 2–3 somatic embryos, at globular or earlytorpedo stages.

172

Elena Corredoira et al.

2. Use at least 100 embryogenic clumps for each embryogenic line and transformation experiment (see Note 8). Also use at least 20 non-inoculated embryo clumps (wild type) and culture them on proliferation medium with and without antibiotics (negative and positive controls). 3. Preculture the clumps in Petri dishes containing 25 mL isolation medium for 1 day. 4. Immerse the precultured clumps into beakers with 20 mL of A. tumefaciens suspension, as obtained in step 7 of subheading 3.4 for 30 min. 5. Remove the inoculum with the aid of sterile forceps, blot-dry the clumps on sterile filter paper, and transfer them to Petri dishes (ten explants per dish) with 25 mL of proliferation medium (see Table 1). 6. Cocultivate the embryo clumps for 5 days in the dark at 25 °C (see Note 9). 7. Wash the explants in beakers containing 25 mL sterilized water plus 500 mg/L cefotaxime for 30 min, blot-dry them on sterile filter paper, and then transfer them to Petri dishes (ten explants per dish) containing selection medium. Incubate the cultures under standard conditions (see Note 10). 8. Determine the number of kanamycin-resistant explants per Petri dish after culture for 2, 4, 6, and 8 weeks in selection medium. 9. At the end of this 8-week culture period, transfer the kanamycinresistant embryos to fresh selection medium for a further 4-week period (Fig. 2d, e). 10. At the end of the 12-week period, evaluate putative transformants by using gfp-specific fluorescence (gfp+) and calculate the transformation efficiency (Fig. 2f). The transformation efficiency is defined as the percentage of initial explants that developed gfp+ embryogenic cultures. 11. Isolate cotyledonary-stage embryos from gfp+ explants and subculture them on selection medium to proliferate and to establish different embryogenic transgenic lines (see Note 11). Maintain the cultures under standard growth conditions. Maintain the cultures by secondary embryogenesis with sequential subcultures at 6-week intervals according to the conditions previously defined in steps 1 and 2, Subheading 3.3 [8, 9]. 12. Evaluate the proliferation ability of different embryogenic lines by determining the number of somatic embryos produced per explant. Compare these results with those of the corresponding nontransformed (control) embryogenic line.

Chestnut, European (Castanea sativa)

3.6 Plantlet Regeneration

173

1. Isolate cotyledonary somatic embryos (4–6 mm) from transgenic cultures and transfer them to Petri dishes containing 25 mL maturation medium for 4 weeks. 2. At the end of this culture period, transfer the somatic embryos to Petri dishes containing 25 mL pregermination medium and store the Petri dishes at 4 °C for 2 months. 3. The transgenic somatic embryos must then be cultured for 8 weeks on Petri dishes containing 25 mL germination medium (Table 1). 4. At the end of this period, determine both the number of germinating embryos showing signs of plant conversion (with development of both root and shoot) as well as those embryos exhibiting only shoot development (see Note 12). 5. Excise the shoots from germinating embryos showing only shoot development and subculture them on shoot proliferation medium, according to the previously defined procedure [13]. 6. Elongated shoots (15–20 mm) were cultured in glass jars containing 30 mL shoot rooting medium for 24–48 h and subsequently transfer to an auxin-free medium (Table 1) [13]. 7. After 4 weeks under standard growth conditions, record the percentage of rooting obtained in both transgenic and control (wild-type) shoots. 8. Confirm the transgenic nature of the regenerated plantlets by molecular analyses. Fluorescence in different tissues (shoots, leaves, roots) should also be observed (Fig. 2g). 9. Isolate the rooted shoots from the glass jars, avoiding damage to the roots, which should be washed with tap water. Transplant the rooted plantlets in pots (with drainage holes) containing sterilized peat to perlite (3:1) and acclimatize them in a phytotron or growth chamber at 25 ± 1 °C and 90 % relative humidity under a 16-h photoperiod (100 μmol/m2/s) for 6–8 weeks or until resumption of shoot growth is evident (Fig. 2h). 10. Transfer the plants to a greenhouse for further growth. Irrigate the plants once a week with Hoagland’s solution and then with tap water when necessary.

4

Notes 1. Currently European chestnut can be micropropagated from both juvenile and mature material through axillary shoot proliferation method. Efforts have focused on regeneration systems that enable clonal propagation of selected mature chestnut trees. Large-scale propagation is often challenging, as the protocols require optimization for a specific cultivar.

174

Elena Corredoira et al.

Commercial production of European chestnuts is now possible. Protocols for the different micropropagation steps from in vitro establishment up to plantlet regeneration of European chestnut are defined [13]. 2. Specific genes for resistance to European chestnut ink disease have not yet been identified, but the use of pathogenesisrelated (PR) proteins such as thaumatin-like proteins would be an interesting alternative approach when the production of ink disease-tolerant/disease-resistant plants is the final objective. Specific details for the construction of pK7WG2D-TAU used in this work are reported elsewhere [10]. Any other binary vector containing antifungal genes can also be used with the protocol defined in the present work. 3. When possible, the gfp should be used as a visual marker gene in the vector, as this simplifies and improves evaluation of transformation events in real time. Selection of whole fluorescent embryos facilitates the proliferation of transgenic embryos, limiting the subculturing of possible escape tissues, as occurs when GUS expression is used as a selection marker. Although there is some evidence that gfp may occasionally be cytotoxic to plant cells, the data obtained to date suggest that gfp is not cytotoxic for European chestnut material [10]. 4. The frequency of SE induction from immature zygotic embryo explants is higher than that obtained from leaf explants, ranging from 2.2 to 10 %. The induction rate was clearly affected by both genotype and year of seed collection. Between 1 and 20 somatic embryos at different stages of development can be obtained from a single explant [12]. 5. Stock shoot multiplication cultures of C. sativa should be maintained by sequential subculture of shoot tips and nodal segments every 4–5 weeks [13]. Only apical leaves from healthy and vigorous shoots should be used as explants to initiate the embryogenic process. 6. When somatic embryos are originated from leaf tissues of C. sativa, the explants initially respond by enlargement followed by a small callus formation, which is mainly differentiated on the cut leaf surfaces. A greenish callus subsequently arises from the midvein, spreading to the rest of the explant. In some cases, translucent globular structures and somatic embryos begin to grow from this callus tissue. The process is not synchronized, and embryos at various developmental stages will be present in the embryogenic explants. The SE induction frequency in leaf explants is generally lower (around 1 %) than that obtained when zygotic embryos are used as initial explants. Furthermore, the time required for the appearance of the first somatic embryos is longer (3–6 months) in leaf explants [12].

Chestnut, European (Castanea sativa)

175

7. In chestnut, the multiplication and maintenance of embryogenic capacity can be carried out by either of two methods: (1) secondary or repetitive embryogenesis from isolated somatic embryos at torpedo-cotyledonary stages which develop secondary embryos from the root-hypocotyl zone and (2) subculture of nodular embryogenic masses or proembryogenic masses (PEMs) [21]. PEMs are produced from the surface of somatic embryos. Despite the low induction rates from original explants, chestnut embryogenic cultures show a high capacity for secondary embryogenesis, which ensures the maintenance of embryogenic competence. 8. As the induction of somatic embryogenesis, the transformation efficiency is clearly genotype dependent [9, 10], and the use of different genotypes is highly recommended for these purposes. 9. The coculture period is clearly genotype dependent and should be evaluated with the specific target material used, although in our experience with European chestnut, 4–5 days of coculture is sufficient for all the genotypes tested [8–10]. 10. The concentration of kanamycin was selected on the basis of previous results, but should be reevaluated for a specific chestnut material. The original creamy-yellowish color of the embryo clumps became brownish/blackish after 2–3 weeks of culture in selection medium. However, the addition of antioxidants such as cysteine, ascorbic acid, or acetosyringone in either cocultivation or selective media is not necessary in European chestnut and even may be detrimental for the transformation efficiency [8, 10]. 11. Each transformation event should be taken as the start of a putative transgenic line. Each transgenic embryogenic line should be derived from one somatic embryo to confirm that the line is the consequence of a unique transformation event. The line should be routinely maintained by secondary embryogenesis separated from the other transgenic lines produced. 12. Regardless of the genotype, the rate of embryo conversion (shoot + root development) is very low for both European and American chestnut. The limited number of plantlets produced makes subsequent analyses that should be carried out with these plants difficult. However, some of the embryos cultured on germination medium develop only a shoot as a “partial” germination response, and this provides an opportunity to multiply and root these shoots to obtain an unlimited number of transgenic European chestnut plants by proliferation of axillary shoot cultures. Efforts should obviously be made to increase plantlet conversion from transgenic somatic embryos; however, at present this method (axillary shoot proliferation) is the only realistic alternative. At this stage, the plants may be used for both molecular analyses and/or for testing the resistance to fungal attacks.

176

Elena Corredoira et al.

References 1. Conedera M, Manetti MC, Giudici F et al (2004) Distribution and economic potential of the sweet chestnut (Castanea sativa Mill.) in Europe. Ecol Mediter 30:47–61 2. Bellini E (2005) The chestnut and its resources: images and considerations. Acta Hort 693: 85–96 3. Vannini A, Natili G, Anselmi NA et al (2010) Distribution and gradient analysis of ink disease in chestnut forests. For Pathol 40:73–86 4. Heiniger U, Rigling D (1994) Biological control of chestnut blight in Europe. Annu Rev Phytopathol 32:581–599 5. Vieitez E, Vieitez ML, Vieitez FJ (1996) El castaño. Edilesa, León 6. Rodríguez L, Cuenca B, López CA et al (2005) Selection of Castanea sativa Mill. genotypes resistant to ink disease in Galicia (Spain). Acta Hort 693:645–651 7. Maynard CA, Powell WA, Polin-McGuigan LD et al (2008) Chestnut. In: Kole C, Hall TC (eds) Compendium of transgenic crop plants: transgenic forest tree species. Blackwell, Chichester, pp 169–192 8. Corredoira E, Montenegro D, San-José MC et al (2004) Agrobacterium-mediated transformation of European chestnut embryogenic cultures. Plant Cell Rep 23:311–318 9. Corredoira E, San-José MC, Vieitez AM et al (2007) Improving genetic transformation of European chestnut and cryopreservation of transgenic lines. Plant Cell Tiss Org Cult 91: 281–288 10. Corredoira E, Valladares S, Allona I et al (2012) Genetic transformation of European chestnut somatic embryos with a native thaumatin-like protein (CsTL1) gene isolated from Castanea sativa seeds. Tree Physiol 32:1389–1402 11. Vanblaere T, Szankowski I, Schaart J (2011) The development of a cisgenic apple plant. J Biotechnol 154:304–311

12. Corredoira E, Ballester A, Vieitez FJ et al (2006) Somatic embryogenesis in chestnut. In: Mujib A, Samaj J (eds) Plant cell monographs, vol 2, Somatic Embryogenesis. Springer, Berlin, pp 177–199 13. Vieitez AM, Sánchez C, García-Nimo ML et al (2007) Protocol for micropropagation of Castanea sativa. In: Jain SM, Häggaman H (eds) Protocols for micropropagation of woody trees and fruits. Springer, Heidelberg, pp 299–312 14. Corredoira E, Valladares S, Vieitez AM et al (2008) Improved germination of somatic embryos and plant recovery of European chestnut. In Vitro Cell Dev Biol Plant 44:307–315 15. Hood EE, Gelvin SB, Melchers LS et al (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–218 16. García-Casado G, Collada C, Allona I et al (2000) Characterization of an apoplastic basic thaumatin-like protein from recalcitrant chestnut seeds. Physiol Plant 110:172–180 17. Hoagland DR, Arnon DI (1941) The water culture method for growing plants without soil. Miscellaneous publications N° 3514. Circular of the California Agricultural Experimental Station 18. Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 19. Gresshoff PM, Doy CH (1972) Development and differentiation of haploid Lycopersicon esculentum. Planta 107:161–170 20. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15: 473–497 21. Vieitez FJ, Merkle SA (2005) Castanea spp. chestnut. In: Litz RE (ed) Biotechnology of fruit and nut crops. CAB International, Wallingford, pp 265–296

Chapter 15 Grapevine (Vitis vinifera L.) Laurent Torregrosa, Sandrine Vialet, Angélique Adivèze, Pat Iocco-Corena, and Mark R. Thomas Abstract Grapevine (Vitis) is considered to be one of the major fruit crops in the world based on hectares cultivated and economic value. Grapes are used not only for wine but also for fresh fruit, dried fruit, and juice production. Wine is by far the major product of grapes, and the focus of this chapter is on wine grape cultivars. Grapevine cultivars of Vitis vinifera L. have a reputation for producing premium quality wines. These premium quality wines are produced from a small number of cultivars that enjoy a high level of consumer acceptance and are firmly entrenched in the market place because of varietal name branding and the association of certain wine styles and regions with specific cultivars. In light of this situation, grapevine improvement by a transgenic approach is attractive when compared to a classical breeding approach. The transfer of individual traits as single genes with a minimum disruption to the original genome would leave the traditional characteristics of the cultivar intact. However, a reliable transformation system is required for a successful transgenic approach to grapevine improvement. There are three criteria for achieving an efficient Agrobacterium-mediated transformation system: (1) the production of highly regenerative transformable tissue, (2) optimal cocultivation conditions for both grapevine tissue and Agrobacterium, and (3) an efficient selection regime for transgenic plant regeneration. In this chapter, we describe a grapevine transformation system that meets these criteria. We also describe a protocol for the production of transformed roots suitable for functional gene studies and for the production of semi-transgenic grafted plants. Key words Agrobacterium, Antibiotic sensitivity, Embryogenic callus, Grapevine, Hairy roots, Reporter genes, Plant regeneration, Semi-transgenic grafted plants, Selectable markers, Transformation efficiency, Transgenic, Vitis

1

Introduction Most of the known grapevine wine varieties have been vegetatively propagated for several centuries. The reasons for the persistence of traditional European grapevine (Vitis vinifera L.) cultivars for wine production are many with both plant and human factors involved [1]. All V. vinifera cultivars are highly heterozygous and do not breed true from seed. The combination of genes in a heterozygous genome responsible for wine quality is conserved by vegetative propagation. Thus, classical breeding programs, particularly those

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_15, © Springer Science+Business Media New York 2015

177

178

Laurent Torregrosa et al.

that have attempted to improve disease resistance and maintain wine quality, have had limited success in the past. Consumer pressure for the same cultivars and the specie’s lack of amenability to classical breeding has focused research attention on producing improved transgenic plants of established cultivars as the approach causes minimum disturbance to the original heterozygous genome [2]. Moreover, the ability to produce transgenic plants is also an invaluable tool for understanding gene function and biological processes in grapevine [3]. A reliable transformation system is required for a successful transgenic approach to grapevine improvement especially for disease and stress resistance or tolerance [4]. There are several prerequisites for achieving an efficient Agrobacteriummediated transformation system. First, the production of highly regenerative transformable tissue is critical. Since the first report of successful grapevine transformation [5], the methods for the production of transgenic grape plants have been based on the use of embryogenic cultures [6]. Previously, the lack of success in combining Agrobacteriummediated transformation with direct shoot organogenesis from leaf explants was explained by the fact that the cells competent for regeneration were not competent for transformation [7]. However, recent work indicates that techniques based on regeneration by organogenesis can be efficient [8]. The explant source, type, and quality of embryogenic cultures are a key factor in successful transformation, and improved conditions for initiation and maintenance of cultures suitable for genetic transformation have been defined [9]. Second, it is important to optimize cocultivation conditions for both Agrobacterium strains and grapevine tissue. The infection of cells with any given Agrobacterium strain and successful T-DNA integration is affected by several factors, such as strain, bacterial culture conditions, bacterial density, cocultivation time, and media used. Finally, one needs an efficient selection regime for transgenic plant regeneration. The use of the selectable marker gene nptII that induces resistance to kanamycin has been widely reported in transformation experiments in Vitis. As an alternative to the nptII gene, the hpt gene has also been used efficiently with hygromycin as the selective agent [10–13]. The bar (pat) gene encoding phosphinothricin acetyltransferase (PAT) has also been used with the herbicide Basta® as the selective agent [11], but its efficiency is debated [14, 15]. In addition initial attempts to use the phosphomannose isomerase (pmi) gene as an alternate selectable marker have been reported as disappointing [14, 16]. The transformation procedure described below uses embryogenic cultures obtained from immature anthers. This tissue type is widely used to induce somatic embryogenesis in grapevine [11, 17, 18]. Transformation can also be used with embryogenic cultures obtained from other tissues such as ovaries, nucelli, embryos, hypocotyls, or young leaves from in vitro plantlets. Maintenance of embryogenic cultures in a state suitable for transformation appears

Grapevine (Vitis vinifera L.)

179

dependent on the interaction of genotype and culture medium and in many cases represents a greater challenge than the initiation step [2]. Most importantly, two distinct types of embryogenic cultures are usually obtained on semisolid media: a culture designated type I which consists mostly of small globular embryos and undifferentiated calli and a type II culture which often develops from type I calli and consists entirely of somatic embryos at various stages of development from heart shape to torpedo stage, which proliferate by secondary embryogenesis [12]. When the response of different culture types to Agrobacterium tumefaciens transformation was examined, it was found that culture type did not have a major effect on initial rates of transformation. This can be determined by the level of green fluorescent protein (GFP) in cell clusters after cocultivation (Fig. 1c) and measured by

Fig. 1 Successive stages of the plant transformation procedure in grapevine. (a) Inflorescence with immature flower buds produced on cutting and ready for anther culture (bar = 5 mm). (b) Embryogenic calli grown on GS1CA prior to cocultivation (bar = 1 mm). (c) Bright clusters of gfp-expressing cells observed 5 weeks after cocultivation (bar = 50 μm). (d) Clusters of kanamycin-resistant embryogenic cells visually selected among dead tissue 2 months after cocultivation (bar = 1 mm). (e) Germination of a kanamycin-resistant embryo on MG1 medium (bar = 5 mm). (f) Well-developed embryo before trimming of cotyledons and roots (bar = 5 mm). (g) Growth and axillary branching of the embryo apical meristem on BFe2 medium with 50 μg/mL kanamycin (bar = 5 mm). (h) Rooted transformed plantlets on micropropagation medium. Both plants from the left are transformed by VlmybA1-2 gene that activates anthocyanidin pigmentation in all vegetative organs, both plants from the right being untransformed controls

180

Laurent Torregrosa et al.

the number of positive units recorded per plate [19]. However, different culture types have a significant effect on the recovery of transgenic plants, with more plants recovered from type I cultures [12]. The reasons for the difference in recovery rate are complex. In V. vinifera, the data for optimal transformation and selection conditions are conflicting as they may not only result from differences in genotypes and selection strategies, but also from the embryogenic state of the cultures at the time of transformation. The number of transgenic plants that can be recovered from an experiment is important when evaluating transgene expression. Aberrant expression patterns of a transgene under the control of a constitutive promoter such as CAMV35S can reach a frequency of 35 % in transgenic plants evaluated [18] and need to be taken into account when seeking to introduce a trait which has commercial potential or for gene function analysis. With the procedure described below, the number of embryos growing and rooting on germination medium under kanamycin selection and showing uidA or gfp expression is variable, depending on the cultivar and the A. tumefaciens strain. From 1 g of cocultivated embryogenic calli, it may range from 10 to 100 or more embryos. A bottleneck in the transformation procedure still remains at the stage of shoot and plantlet development. The percentage of transgenic plantlets regenerated from transgenic embryos using this procedure ranges from 10 to 33 %, depending on the cultivar. Among these transgenic plants, those regenerated from independent transformation events, as determined by Southern blot analysis, range from 77 to 100 %. The final transformation efficiency obtained with the procedure described below can range from 1 to 33 or more independent transgenic lines obtained from 1 g of embryogenic calli. For wine grape cultivars, some of them such as Chardonnay are easy to transform [18]. Others such as Pinot Noir are more recalcitrant despite it being a parent of Chardonnay [20]. More recently, this protocol has been successfully applied to the microvine model using hygromycin for selection of transformed plantlets suitable for rapid forward and reverse genetic studies in small controlled environments due to the plant’s small stature and rapid flowering phenotypes [13]. An alternative to stable grapevine transformation for gene function analysis is the production of transformed hairy root cultures by co-transformation with A. tumefaciens and A. rhizogenes. Transgenic hairy roots are quicker and easier to regenerate from stems and petioles than transgenic plantlets from embryogenic callus and therefore a more suitable system when the regeneration of transgenic plants or a reproductive organ evaluation is not necessary. Hairy roots are obtained by the inoculation of in vitro plantlets with non-disarmed A. rhizogenes strains. The oncogenes are located on the pRI plasmid inducing the formation of adventitious root,

Grapevine (Vitis vinifera L.)

181

which can be propagated in axenic cultures [21]. To avoid the tedious construction of co-integrated vectors, a system based on the co-inoculation with A. rhizogenes and A. tumefaciens was proposed [21]. Recombinant binary plasmids can also be introduced into wild-type A. rhizogenes strains where pRi virulence genes act in trans with T-DNA binary plasmid. A large number of genotypes of Vitis vinifera cultivars were found suitable for hairy root induction, with the cultivar “Maccabeu” being one of the most appropriate. Microvines were also found suitable for hairy root experiments, with some lines such as 04C023V0002 and 04C023V0007 obtained from the cross Picovine 00C001V008 × Grenache, being found the most suitable [13]. Thus, the use of A. rhizogenes as part of the grapevine root transformation system provides an easy and efficient way to generate large amounts of transformed roots within a few weeks. This approach has proved very useful for gene function studies with the grapevine [22]. Furthermore, gene function studies involving the grafting of transgenic hairy roots onto scions of choice is now a possibility [21].

2 2.1

Materials Plant Material

Somatic embryogenic cultures are initiated from immature anthers from many grapevine cultivars including Sultana, Portan, Shiraz, Chardonnay, Cabernet Sauvignon, Riesling, and Sauvignon Blanc.

2.2 Agrobacterium Strains

The A. tumefaciens strain EHA101 [23] and its derivative EHA105 that contain a binary plasmid are used for transformation. They are more efficient for grapevine transformation than the widely used strain LBA4404 and other strains [19]. The A. rhizogenes strain A4 is very efficient for hairy root induction [24]. No antibiotic selection is required because pRi from the strain is co-transformed with the T-DNA from the binary vector [21, 25].

2.3 Culture Media for A. tumefaciens and A. rhizogenes

Media are sterilized by autoclaving for 30 min at 110 °C. 1. Modified MG/L medium [26]: 5 g/L of mannitol, 1 g/L of L-glutamate, 5 g/L of tryptone, 2.5 mL/L of Fe-ethylenediamine tetracetic acid (EDTA) stock solution, 5 g/L of NaCl, 150 mg/L of KH2PO4, 100 mg/L of MgSO4 · 7H2O, 2.5 g/L yeast extract, 20 μg/L of biotin, and antibiotics depending on the bacterial strain and binary vector (100 μg/mL kanamycin and 25 μg/mL rifampicin for EHA105/ pBINm-gfp5-ER). Adjust to pH 7.0 with NaOH. 2. Induction medium for A. tumefaciens: ABB salts [27] (20 g/L of NH4Cl, 12.3 g/L of MgSO4 · 7H2O, 3.0 g/L of KCl, 0.265 g/L of CaCl2 · 2H2O, 0.5 g/L of FeSO4 · 7H2O, 5 μg/L

182

Laurent Torregrosa et al.

of biotin), 2 mM NaH2PO4 at pH 5.6, 40 mM 2-(N-morpholino) ethanesulfonic acid (MES), 0.5 % glucose, and 100 μM acetosyringone. 2.4 Stock Solutions and Other Supplies

All stock solutions were sterilized through a 0.2 μm filter and stored at 4 °C unless otherwise stated. 1. Half-strength Murashige and Skoog (MS) macroelements (10×, [28]): 16.5 g/L of NH4NO3, 4.4 g/L of CaCl2 · 2H2O, 3.7 g/L of MgSO4 · 7H2O, 19.7 g/L of KNO3, and 1.7 g/L of KH2PO4. 2. NN macroelements (10×, [29]): 7.2 g/L of NH4NO3, 9.5 g/L of KNO3, 4.4 g/L of CaCl2 · 2H2O, 3.7 g/ L of MgSO4 · 7H2O, and 1.7 g/L of KH2PO4. 3. GNBC macroelements (10×, [30]): 10 g/L of KNO3, 5 g/L of Ca(NO3)2 · 4H2O, 1.6 g/L of NH4NO3, 1.25 g/L of MgSO4 · 7H2O, and 1.25 g/L of KH2PO4. 4. MS microelements (1,000×, [28]): 6.2 g/L of H3BO3, 22.3 g/L of MnSO4 · 4H2O, 8.6 g/L of ZnSO4 · 7H2O, 0.83 g/L of KI, 0.25 g/L of Na2MoO4 · 2H2O, 25 mg/L of CuSO4 · 5H2O, and 25 mg/L of CoCl2 · 6H2O. 5. GNBC microelements (1,000×, [30]): 460 mg/L of MnSO4 · 4H2O, 250 mg/L of KI, 58 mg/L of ZnSO4 · 7H2O, 25 mg/L of H3BO3, 25 mg/L of CuSO4 · 5H2O, 25 mg/L of NiCl2 · 6H2O, 25 mg/L of CoCl2 · 6H2O, and 25 mg/L of Na2MoO4 · 2H2O. 6. LG0 macroelements [21]: 1.5 g/L KNO3, 150 mg/L (NH4) SO4, 150 mg/L CaCl2 · 2H2O, 250 mg/L MgSO4 · 7H20, 250 mg/L NaH2PO4 · 2H2O. 7. MS/2 macroelements [21]: 950 mg/L KNO3, 825 mg/L NH4NO3, 220 mg/L CaCl2 · 2H2O, 185 mg/L MgSO4 · 7H2O, 85 mg/L KH2PO4. 8. Fe-EDTA (200×, [28]): Dissolve 7.44 g of Na2EDTA · 2H2O in 900 mL of nanopure water. Heat the solution to almost boiling point and gradually add 1.86 g of FeSO4 · 7H2O. Make up to 1 L with nanopure water. 9. Ferric citrate (200×, [30]): Dissolve 4 g ammonium ferric citrate in 1,000 mL nanopure water. 10. Vitamins T (1,000×, [31]): 50 g/L of mesoinositol, 1 g/L of nicotinic acid, 1 g/L of thiamine HCl, 1 g/L of pyridoxine HCl, 1 g/L of calcium pantothenate, and 0.01 g/L of biotin. 11. Vitamins B5 (1,000×, [32]): 100 g/L of mesoinositol, 10 g/L of thiamine HCl, 10 g/L of nicotinic acid, 1 g/L of pyridoxine HCl.

Grapevine (Vitis vinifera L.)

183

12. Amino acid mix (1,000×, [17]): 100 g/L of glutamine, 10 g/L of phenylalanine, and 2 g/L of glycine. 13. 2,4-Dichlorophenoxyacetic acid (2,4-D, 1 mM): Dissolve 44.2 mg in 1 mL 10 N NaOH. Add nanopure water and heat until completely dissolved. Make up the volume to 200 mL in nanopure water. 14. 6-Benzylaminopurine (BAP, 1 mM): Dissolve 45.04 mg in 1 mL of 10 N NaOH. Add nanopure water to make a volume of 200 mL. 15. Thidiazuron (TDZ, 500 μM): Dissolve 22 mg in 1 mL Dimethyl sulfoxide (DMSO). Add nanopure water to make a volume of 200 mL. 16. 3-Naphthoxyacetic acid (NOA, 1 mM): Dissolve 40.44 mg in 1 mL 10 N NaOH. Add nanopure water to make a volume of 200 mL. 17. Indole-3-acetic acid (IAA, 1 mM): Dissolve 35.0 mg in 1 mL 10 N NaOH. Add nanopure water to make a volume of 200 mL. 18. α-Naphthaleneacetic acid (NAA, 1 mM): Dissolve 37.2 mg in 1 mL 10 N NaOH. Add nanopure water to make a volume of 200 mL. 19. Timentin® (Smith-Kline Beecham, Boronia, Australia). 20. Augmentin: Dissolve in nanopure water at a concentration of 250 mg/mL. Store as aliquots at −20 °C. 21. Claforan or cefotaxime stock solution: Dissolve in nanopure water at a concentration of 250 mg/mL. Store as aliquots at −20 °C. 22. Kanamycin monosulfate: Dissolve in nanopure water at a concentration of 100 mg/mL. Store as aliquots at −20 °C. 23. Hygromycin B: Dissolve in nanopure water at a concentration of 25 mg/mL. 24. Rifampicin: Dissolve in dimethyl sulfoxide (DMSO) at a concentration of 25 mg/mL. Store as aliquots at −20 °C. 25. Acetosyringone: Dissolve in absolute ethanol at a concentration of 100 mM. Store as aliquots at −20 °C. 2.5 Plant Material and Tissue Culture

All the media are sterilized by autoclaving for 30 min at 110 °C. 1. Culture medium for initiation of embryogenic calli from anthers depending on genotype. For PIV medium [12]: NN macroelements, MS microelements, Fe-EDTA, vitamins B5, 4.5 μM 2,4-dichlorophenoxyacetic acid (2,4-D), 8.9 μM BAP, 60 g/L sucrose, and 3 g/L Phytagel® (Sigma) as the gelling agent; adjust pH to 5.7 with 1 M KOH. For Harst medium [18]: NN macroelements, MS microelements, Fe-EDTA, vitamins

184

Laurent Torregrosa et al.

B5, 10 μM 2,4-dichlorophenoxyacetic acid (2,4-D), 5 μM TDZ, 30 g/L sucrose, and 3 g/L Phytagel® as the gelling agent; adjust pH to 5.7 with 1 M KOH. 2. Culture medium for maintenance of embryogenic calli from anthers (C1P, [17]): Half-strength MS macroelements, MS microelements, Fe-EDTA, vitamins T, amino acid mix with 1 g/L casein hydrolysate, 5 μM 2,4-D, 1 μM BAP; 30 g/L sucrose; and 5 g/L Phytagel®; adjust pH to 6.0 with 1 M KOH (see Note 1). 3. Culture medium to stimulate the formation of somatic embryos (GS1CA, [12]): NN macroelements, MS microelements, Fe-EDTA, vitamins B5, 10 μM NOA, 20 μM IAA (can be left out), 1 μM BAP, 60 g/L sucrose, 2.5 g/L activated charcoal, and 10 g/L Bacto Agar; adjust pH to 5.7 with 1 M KOH. 4. Liquid cocultivation medium (LCM): GS1CA medium without growth hormones, Bacto Agar, and activated charcoal with or without 100 μM acetosyringone. 5. Cocultivation medium for A. tumefaciens (CM): GS1CA medium added with 100 μM acetosyringone. 6. Culture medium for the germination of embryos (MG1, [18]: NN macroelements, MS microelements, Fe-EDTA, vitamins B5, 30 g/L sucrose, and 7 g/L Bacto Agar and 2.5 g/L activated charcoal. 7. Culture medium to stimulate the further development and greening of embryos (MG2): MG1 with 2 μM, 5 μM BAP [18] or 10 μM BAP (depending on genotype). 8. Medium to stimulate the axillary branching from caulinar meristems of germinating embryos (BFe2, [33]: Half-strength MS macroelements, MS microelements, Fe-EDTA increased twofold, vitamins T, 4.4 μM or 5 μM BAP, 20 g/L sucrose, and 7 g/L agar; adjust pH to 6.0 with 1 M KOH. 9. Medium to induce and stimulate the rooting of shoots (RIM): Half-strength MS macroelements, MS microelements, Fe-EDTA, vitamins T, 5 μM IAA or 0.5 μM NAA [18], 30 g/L sucrose, and 7 g/L Bacto Agar; adjust pH to 6.0 with 1 M KOH. 10. Medium to micropropagate grapevines by nodal bud culture (GNBC): Macroelements and microelements [30], ferric citrate, vitamins T, 15 g/L sucrose, and 7 g/L Bacto Agar; adjust to pH 6.5. 11. Medium for grafting (MS/2, [21]): MS/2 macroelements, MS microelements, 25 g/L sucrose, 5 g/L Difco Agar. 12. Liquid inoculation medium for A. rhizogenes: MS/2 liquid medium with 100 μM acetosyringone.

Grapevine (Vitis vinifera L.)

185

13. Culture medium to isolate and maintain hairy roots (LG0, [21]): LG0 macroelements, MS microelements, Fe-EDTA, 0.25 g/L casein, 500 mg/L sucrose, vitamins, 5 g/L Phytagel, 250 mg/L Augmentin, 250 mg/L cefotaxime, pH adjusted to 6 with 1 N KOH. 2.6 Other Reagents, Solutions, and Supplies

1. Flower and stem surface disinfectant: 7 % (w/v) calcium hypochlorite filtered solution, corresponding to 5 % active chlorine, and containing 0.1 % (v/v) Tween 20 as wetting agent (see Note 2). 2. 70 % (v/v) ethanol. 3. Soil mixture for the growth of transgenic plants: Peat moss, compost, and sand with a ratio of 1:1:1 (v/v/v). 4. Millipore® 100 μm nylon net filter (St. Quentin-Yveline, France). 5. Corning® 50 mL centrifuge tube (Corning Incorporated, NY). 6. Whatman No. 1 filter paper (Whatman, Springfield Milland, UK). 7. Magenta™ GA7-3 vessels (Life Technologies). 8. Parafilm M®. 9. Tween 20. 10. 55 and 90 mm Petri dishes. 11. Stone wool substrate (4 cm diameter) (http://www.cultilene.nl).

3

Methods

3.1 Plant Transformation 3.1.1 Initiation and Maintenance of Embryogenic Cultures

1. Hardwood cuttings from certified virus-free mother vines are stored at 4 °C until required. Plant cuttings are placed in pots containing perlite in a controlled environment chamber (25 °C, 16 h photoperiod with 50 μE/m2/s) or greenhouse. 2. Immediately after bud burst, gently remove the basal leaves of the primary shoots with small forceps to promote the retention and growth of the inflorescences [34]. Collect these inflorescences when they bear small (2–3 mm) unpollinated flower buds (Fig. 1a, see Note 3). 3. Store the inflorescences in Petri dishes with moist cotton wool for 3 days at 4 °C in the dark (see Note 4). 4. Immerse flower buds for 30 s in 70 % ethanol and further for 10 min in surface disinfectant. Rinse three times with sterile distilled water. 5. Dissect the flower buds under a stereo microscope in a laminar flow hood. Separate the calyptra from the peduncle with sharp glass rods or forceps and needles. Gently remove the anthers with their filaments (see Note 5).

186

Laurent Torregrosa et al.

6. Place about 30 anthers (six flower buds) in 55 mm Petri dish containing PIV or Harst media, taking care to put the anther with the filament in contact with the medium (see Note 6). Incubate at 28 °C in the dark for 4 weeks. 7. Transfer yellow-white emerging calli to fresh C1P medium. Subculture every 4 weeks selecting visually for friable, off-white calli containing proembryogenic clusters. 8. One month before the transformation experiment, transfer the proembryogenic calli to GS1CA medium (Fig. 1b). 3.1.2 Agrobacterium Culture Preparation

1. Incubate a single colony of Agrobacterium containing a binary vector with a plant selectable marker gene for kanamycin resistance overnight at 28 °C with shaking in 50 mL of modified MG/L medium with rifampicin 25 μg/mL and kanamycin 100 μg/mL, or other appropriate antibiotics according to the plasmid properties. 2. Centrifuge the culture at 2,600 × g for 5 min, resuspend the pellet in 100 mL induction medium, and incubate for a further 2 h, with shaking at 100 rpm. 3. Centrifuge the culture as above and resuspend the pellet in LCM medium and adjust the concentration of the bacterial suspension to an OD550 of 0.4 (approximately 106 cfu/mL).

3.1.3 Cocultivation of Embryogenic Callus with Agrobacterium

1. Add 20 mL of the bacterial suspension to each gram of embryogenic calli in a 50 mL Corning centrifuge tube and then shake vigorously for 1–2 s. 2. After a 10-min incubation at 25 °C, separate the calli with gentle shaking from the liquid phase with a 100 μm 3 M nylon net filter. 3. Briefly blot on sterile Whatman filter paper and transfer onto a 90 mm Petri dish containing CM medium (see Note 7). Seal the Petri dishes with Parafilm® to prevent the culture from drying out and incubate in the dark at 22 °C for 48 h. 4. After cocultivation, wash the embryogenic calli in a 50 mL Corning tube with 20 mL LCM medium plus 1,000 μg/mL Timentin®. 5. Retrieve the calli with a 100 μm nylon net and blot briefly on filter paper. Gently fragment the calli with forceps and distribute evenly onto 55 mm Petri dishes containing GS1CA medium with 1,000 μg/mL Timentin. Incubate cultures in the dark at 28 °C for 2 weeks (see Note 8).

3.1.4 Selection of Transgenic Embryos and Regeneration of Transgenic Plants

1. Transfer calli onto 55 mm Petri dishes containing GS1CA medium with 1,000 μg/mL Timentin and 100 μg/mL kanamycin (see Note 9). Transformation efficiency can be evaluated by examining the callus for GFP reporter gene expression (Fig. 1c).

Grapevine (Vitis vinifera L.)

187

2. Subculture the calli onto fresh selective medium every 4 weeks and gradually increase the kanamycin concentration to 150 μg/ mL (see Note 10). Take care to remove dead tissue from the live clusters of kanamycin-resistant embryogenic cells while subculturing (Fig. 1d). 3. After 30 days post inoculation, spread the calli thinly onto 90 mm plates containing MG1 medium plus 150 μg/mL kanamycin and 1,000 μg/mL Timentin. Incubate plates at 28 °C in the dark. 4. Transfer torpedo stage rooting embryos (Fig. 1e) to MG2 medium and incubate under light (45–60 μE/m2/s) for further root and shoot development. 5. Remove any roots from embryos to encourage the caulogenesis after 4 weeks. Laterally excise cotyledons 3–5 mm from their base and the shoot apical meristem. Place this trimmed embryo onto BFe2 medium plus 50 μg/mL kanamycin to stimulate growth of the shoot from the shoot meristem. Incubate at 25 °C under attenuated light (approximately 15 μE/m2/s) (Fig. 1f). 6. Subculture emerging shoots 2–3 times on the same medium and the same conditions to encourage axillary branching of the caulinar meristem (Fig. 1g). 7. Regenerate whole plants by transferring shoots onto root induction medium (RIM) in Magenta™ GA7-3 vessels. 8. Select against chimeric plantlets by transferring nodal bud micro cuttings of putative transformants onto GNBC medium with 50 μg/mL kanamycin (Fig. 1h). Generally, two subcultures are enough to discard any chimeric plantlets. 9. Test for the presence of the transgene by polymerase chain reaction (PCR) in well-rooted kanamycin-resistant plantlets. 10. Subculture transgenic plantlets onto GNBC medium without kanamycin for in vitro conservation (5 plants/line) and acclimatization. 3.1.5 Transplanting and Greenhouse Care

1. Transfer the resulting healthy well-rooted plantlets into individual, water-saturated 4 cm diameter stone wool blocks. Place the blocks in a plastic box containing few mm of water at the bottom. Cover the boxes with plastic film and maintain under in vitro culture conditions. 2. During this period, maintain water saturation of the blocks irrigating with MS/2 liquid medium without sugar until and progressively open plastic film. 3. After 2–4 weeks, when the roots arise from the blocks, transfer the block and the plant in 10 cm diameter plastic containing compost and incubate in same culture conditions for 2 or 3

188

Laurent Torregrosa et al.

weeks (irrigating with the same solution as mentioned above). Transfer to the greenhouse and progressively open to acclimatize the plants to low hygrometric conditions. Transfer to stone wool substrate (see Note 11). 4. Transfer the pots to the greenhouse and progressively for further acclimatization. The average rate for successful transplanting and acclimatization depends on the variety but is generally higher than 90 %. 5. When the transgenic plants are successfully transplanted and well growing in the greenhouse, confirm the integration of the gene of interest in the plant genome by Southern blot analysis and its expression of the gene RT-qPCR or other assays. 3.2 Hairy Root Transformation 3.2.1 Production of In Vitro Plantlets for A. rhizogenes Inoculation

1. Young stem sections (10–50 cm from the tip) are taken from actively growing plants from the greenhouse or the field. Leaves and tendrils are sectioned 1 cm from their base and maintained in a cold room (2–4 °C) until use. 2. Stem explants are sectioned into short fragments composed of a node with 1 cm of internode above and 5 cm below and immediately sterilized by immersion for 15 min into a solution of filtered 70 g/L calcium hypochlorite with a few drops of Tween 20 (see Note 12). 3. Explants are rinsed three times with sterile distilled water and trimmed with a scalpel (5 mm) to remove injured tissues (see Note 13). The cuttings are then inserted in 200 mm long culture tubes containing 20 mL of MS/2 solid medium and transferred under lower light (approximately 45 μE/m2/s). 4. After 5–8 weeks, shoots arising from axillary buds are extracted and cut into single-node micro cuttings and propagated on the same medium. 5. When plantlets are 8–10 cm high (approx. 3 months time), the stem is sectioned at 1 cm above a node and the two last leaves removed by sectioning 2–3 mm from blade in order to let 0.5–1 cm of petiole attached to the stem (see Note 14). A typical experiment being is based on 12 vitro plantlets (36 inoculation ends).

3.2.2 Agrobacterium Culture Preparation and Inoculation

1. Two or three days prior to the start of the experiment, prepare a streak plate of A. rhizogenes onto modified MG/L medium with rifampicin 25 μg/mL and binary vector-specific bacterial selection antibiotic. 2. In a 50 mL Corning® tube containing 10 mL of MS/2 liquid medium, suspend some bacteria cream and shake vigorously for few seconds to homogenize the solution. Then adjust the concentration of the bacterial suspension to an OD550 of 0.3 (≈106 cfu/mL).

Grapevine (Vitis vinifera L.)

189

3. Immerge forceps in the inoculation solution to keep 5–10 μm of bacteria solution between the ends of the forceps and then gently crush the stem and petiole stubs. 4. Close culture tube and seal the cap with Parafilm M®. Incubate inoculated in vitro plantlets in the same environment as for micropropagation. 3.2.3 Calli and Hairy Root Recovery

1. After 2 weeks, check cultures to ensure that calli are growing from inoculation points. When the calli reach 5 mm in size (Fig. 2a), subculture by sectioning 1–3 mm below and transfer it onto 90 mm Petri dishes containing LG0 medium with 200 μg/mL Timentin® (or Augmentin®) and 200 μg/mL Claforan® (or Cefotaxime®) (see Note 15). Incubate at 25 °C under attenuated light (approximately 15 μE/m2/s). 2. Subculture the calli onto fresh medium every 3–4 weeks. Generally two subcultures are enough to recover all the hairy root single events from an experiment. Subculture when roots are 0.5 cm long onto the same medium (Fig. 2e, see Note 16). 3. Approximately 5–50 hairy roots are recovered from 12 to 36 calli that are obtained from 12 in vitro plantlets for each experiment. Isolated hairy roots grow quite easily and can be subcultured each 4–6 weeks on LG0 medium (Fig. 2f, see Note 17). Transgene presence is confirmed by PCR of established hairy root cultures. The rate for successful insertion of the gene of interest varies with the experiment from 4 % [21] to 70 % [25]. 4. Select 3–5 cm long single roots without hyperhydricity for grafting. Refresh basal end and do a 1 cm long cleft section. Explant a 1 cm long shoot tip from an actively growing in vitro plantlet, quickly remove all leaves, and section the base diagonally. Rapidly, insert the scion into the rootstock cleft section, and insert the grafted plant into MS/2 solid medium in a way that the medium surface is at the graft level. Seal culture tube or Magenta box and cultivate in the same conditions as micropropagation (Fig. 2g, see Note 18).

4

Notes 1. The medium used to induce and maintain embryogenic calli cultures initiated from anthers can be successfully applied to induce and maintain embryogenic calli from leaf explants [31]. 2. Sodium hypochlorite solution with the same percentage of active chlorine can be used in place of calcium hypochlorite. Solutions can be stored overnight but for a maximum of 2 days. 3. This technique can be applied throughout the year with greenhouse material. Alternatively, inflorescences can be collected in the vineyard at about 12–14 days before anthesis.

190

Laurent Torregrosa et al.

Fig. 2 Successive stages of the root transformation procedure in grapevine. (a) Formation of calli from stem and petiole stub 2 weeks after inoculation, ready to be explanted (bar = 5 mm). (b) Induction of non-transformed adventitious roots below the point of inoculation (right). Plant on left has most roots only from callus at site of inoculation (bar = 5 mm). (c) Browning of the callus 3 weeks after inoculation (bar = 2 mm). (d) Hairy roots (big roots) arising from the callus 1 week after callus extraction (red hairy roots expressing the transgene VlmybA1-2, white hairy roots only transformed by pRi oncogenes) (bar = 5 mm). (e) Hairy roots growing on LG0 medium with 200 μg/mL Claforan® and Augmentin®, 2 weeks after extraction (bar = 10 mm). (f) Well-developed hairy roots culture ready for a second round of propagation (bar = 10 mm). (g) Chimeric grapevine plant associating a non-transformed scion grafted on a root system deriving from a hairy root (bar = 10 mm)

4. Chilling the inflorescences was found to improve the formation of embryogenic calli, but the efficiency depends greatly on the genotype of the cultivar. 5. Embryogenic calli develop from anther filament tissue that is attached to the anther and will also develop from the filament

Grapevine (Vitis vinifera L.)

191

scar on the anther if the filament is removed, and this region of the anther is placed in contact with the medium. The developmental stage of the anther has a major effect on embryogenic response. Generally, the higher level of somatic embryogenesis occurs when the anther is at the tetrad or the uninucleate pollen stage, which corresponds to an opalescent color of the anther. Anthers that are translucent or have become yellow should not be used as they are less likely to produce embryogenic calli. 6. Most varieties will initiate embryogenic callus on PIV; however, some like Chardonnay will respond better to Harst medium by producing more proliferating embryogenic calli after subculture [18]. 7. It can be useful to put a disk of Whatman filter paper on CM medium during cocultivation to avoid overgrowth of the bacteria, particularly with the super virulent EHA105 strain. 8. The use of an appropriate antibiotic, which can kill or suppress the growth of Agrobacterium, is very important. Other antibiotics, such as cefotaxime at concentrations varying from 200 to 500 μg/mL [8, 10, 35] or carbenicillin at 500 μg/mL [14, 36, 37], can be used to kill the bacteria after cocultivation. The optimum dose not only varies with the bacterial strain but also with the cultivar and should be such that it inhibits Agrobacterium growth but allows for the normal regeneration of putative transgenic tissue. 9. Paromomycin sulfate (Sigma) can also be used as a selective agent with the nptII gene, at an initial concentration of 5 μg/mL, after cocultivation, and then increased gradually to 30 μg/mL [11, 38]. If the hpt gene is used as the selectable marker, then hygromycin B can be used after cocultivation at a concentration of 7.5, 15, or 25 μg/mL depending on genotype. Frequent subculturing to selective medium is an important step to maintain an optimum concentration of fresh antibiotic and the removal of compounds excreted by the dead cells. 10. This step represents an effective screen for identifying transgenic plantlets prior to potting out. An MS-based medium or any other medium without growth hormones is suitable for the micropropagation of grapevine by nodal bud culture. The GNBC medium is currently used in France to maintain in vitro cultures of several hundreds of cultivars, species, and hybrids in a germplasm repository [39]. This demonstrates its versatility across a large range of grapevine genotypes. 11. A limited amount of information is available on the biological behavior of grapevine plantlets that are extremely sensitive to environmental stress during acclimatization [40]. Acclimatization methods can vary from laboratory to laboratory.

192

Laurent Torregrosa et al.

12. The penetration of calcium hypochlorite depends on the age of stem organs. To prevent further tissue necrosis, it is recommended to either eliminate the major part of the petiole and tendril or to section stem and petiole ends, 2–3 mm beyond necrosis. 13. Both stems and petioles are suitable explants for hairy root induction providing three areas for inoculation. It is important to keep a distance of 0.5 cm between the last node or petiole insertion and inoculation point to facilitate further isolation of the calli formed by A. rhizogenes. 14. For most V. vinifera cultivars, young plantlets (less than 2 months old) are not suitable for A. rhizogenes transformation. It is better to use 3-month-old plantlets or older (up to 5 months old if the medium is not too dry). 15. Callus growth depends on the cultivar, bacterial strain, and associated binary plasmid. In general, after 2 weeks, the callus reaches to appropriate stage for extraction, but in some cases, it can take up to 4 weeks. As soon as the callus is big enough, subculture and transfer onto antibiotic containing LG0 medium to avoid further necrosis (Fig. 2c). To stop bacteria development, callus needs to be inserted in the medium up to half of their volume. 16. Roots emerging directly from the petiole and the stem (Fig. 2b) are not transformed as there result from the diffusion of plant growth regulators. The critical phenotypes to select hairy root are the diameter and the growing rate of the roots. As soon as there emerge from the callus, hairy roots are big (2–3 mm diameter, Fig. 2d), while non-transformed roots are generally thin (less than 1.5 mm diameter). Also, non-transformed roots show a higher diameter decrease from the base to the tip than hairy roots. 17. Cases of tissue chimerism were rarely observed in hairy roots but it is recommended to subculture twice to ensure complete transformation of tissue. It is also recommended to check the presence of transgene after two subcultures. Antibiotic can also be omitted from LG0 medium at this stage, but it is recommended to maintain the same level to avoid bacterial contamination. 18. One to two months after grafting, plants can be acclimatized through standard methods. However, because hairy root systems are not strong enough to support big scions, grafted plants must be attached carefully. References 1. Mullins MG, Bouquet A, Williams LE (1992) Biology of grapevine. Cambridge University Press, Cambridge

2. Kikkert JR, Thomas MR, Reisch BI (2001) Grapevine genetic engineering. In: RoubelakisAngelakis KA (ed) Molecular biology and

Grapevine (Vitis vinifera L.)

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

biotechnology of the grapevine. Kluwer, Dordrecht, pp 393–410 Bouquet A, Chatelet P, Torregrosa L (2003) Grapevine genetic engineering: tool for genome analysis or plant breeding method? Which future for transgenic vines? AgBiotechNet 5 ABN 116:1–10 Colova-Tsolova V, Perl A, Krastanova S, Tsvetkov I, Atanassov A (2001) Genetically engineered grape for disease and stress tolerance. In: Roubelakis-Angelakis KA (ed) Molecular biology and biotechnology of the grapevine. Kluwer, Dordrecht, pp 411–432 Mullins MG, Tang FCA, Facciotti D (1990) Agrobacterium-mediated genetic transformation of grapevines. Transgenic plants of Vitis rupestris Scheele and buds of Vitis vinifera L. Nat Biotechnol 8:1041–1045 Perl A, Colova-Tsolova V, Eshdat Y (2004) Agrobacterium-mediated transformation of grape embryogenic calli. In: Curtis IS (ed) Transgenic crops of the world. Kluwer, Dordrecht, pp 1–14 Colby SM, Juncosa AM, Meredith CP (1991) Cellular differences in Agrobacterium susceptibility and regenerative capacity restrict the development of transgenic grapevines. J Am Soc Hort Sci 116:356–361 Mezzetti B, Pandolfini T, Navacchi O, Landi L (2002) Genetic transformation of Vitis vinifera via organogenesis. BMC Biotechnol 2:18–28 Martinelli L, Gribaudo I (2001) Somatic embryogenesis in grapevine. In: RoubelakisAngelakis KA (ed) Molecular biology and biotechnology of the grapevine. Kluwer, Dordrecht, pp 327–351 Le Gall O, Torregrosa L, Danglot Y, Candresse T, Bouquet A (1994) Agrobacterium-mediated genetic transformation of grapevine somatic embryos and regeneration of transgenic plants expressing the coat protein of grapevine chrome mosaic nepovirus (GCMV). Plant Sci 102:161–170 Perl A, Lotan O, Abu-Abied M, Holland D (1996) Establishment of an Agrobacteriummediated transformation system for grape (Vitis vinifera L.): the role of antioxidants during grape-Agrobacterium interactions. Nat Biotechnol 14:624–628 Franks T, Gang He D, Thomas M (1998) Regeneration of transgenic Vitis vinifera L. Sultana plants: genotypic and phenotypic analysis. Mol Breeding 4:321–333 Chaib J, Torregrosa L, Mackenzie D, Corena P, Bouquet A, Thomas MR (2010) The microvine – a model system for rapid forward and reverse genetics of grapevines. Plant J 61:1083–1092

193

14. Reustle GM, Wallbraun M, Zwiebel M et al (2002) Experience with different selectable marker systems for the genetic engineering of grapevine. Acta Hort 603:485–490 15. Torregrosa L, Péros J-P, Lopez G, Bouquet A (2000) Effect of hygromycin, kanamycin and phosphinothricin on the embryogenic development and axillary micropropagation of Vitis vinifera L. Acta Hort 528:401–406 16. Kieffer F, Triouleyre C, Bertsch C, Farine S, Leva Y, Walter B (2004) Mannose and xylose cannot be used as selectable agents for Vitis vinifera L. Vitis 43:35–39 17. Torregrosa L (1998) A simple and efficient method to obtain stable embryogenic cultures from anthers of Vitis vinifera L. Vitis 37:91–92 18. Iocco P, Franks T, Thomas MR (2001) Genetic transformation of major wine grape cultivars of Vitis vinifera L. Transgenic Res 10:105–112 19. Torregrosa L, Iocco P, Thomas MR (2002) Influence of Agrobacterium strain, culture medium, and cultivar on the transformation efficiency of Vitis vinifera L. Am J Enol Vitic 53:183–190 20. Bowers J, Boursiquot J-M, This P, Chu K, Johansson H, Meredith C (1999) Historical genetics: the parentage of Chardonnay, Gamay and other wine grapes of Northeastern France. Science 285:1562–1565 21. Torregrosa L, Bouquet A (1997) Agrobacterium tumefaciens and A. rhizogenes co-transformation to obtain grapevine hairy roots producing the coat protein of grapevine chrome mosaic nepovirus. Plant Cell Tiss Org Cult 49:53–62 22. Vidal JR, Gomez C, Cutanda MC, Shrestha B, Bouquet A, Thomas MR, Torregrosa L (2010) Use of gene transfer technology for functional studies in grapevine. Aust J Grape Wine Res 16:138–151 23. Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–218 24. Tepfer D (1984) Transformation of several species of higher plants by Agrobacterium rhizogenes: sexual transmission of the transformed genotype and phenotype. Cell 37:959–967 25. Cutanda-Perez MC, Ageorges A, Gomez C, Vialet S, Romieu C, Torregrosa L (2009) Ectopic expression of the VlmybA1 in grapevine activates a narrow set of genes involved in anthocyanin synthesis and transport. Plant Mol Biol 69:633–648 26. Garfinkel DJ, Nester EW (1980) Agrobacterium mutants affected in crown gall tumorigenesis and octopine catabolism. J Bacteriol 144: 732–743

194

Laurent Torregrosa et al.

27. Chilton MD, Currier TC, Farrand SK, Bendish AJ, Gordon MP, Nester EW (1974) Agrobacterium tumefaciens DNA and PS8 bacteriophage DNA not detected in crown gall tumors. Proc Natl Acad Sci U S A 71: 3672–3676 28. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 29. Nitsch J-P, Nitsch C (1969) Haploid plants from pollen grains. Science 165:85–87 30. Galzy R, Haffner V, Compan D (1990) Influence of three factors on the growth and nutrition of grapevine microcuttings. J Exp Bot 41:295–301 31. Torregrosa L, Torres-Viñals M, Bouquet A (1995) Somatic embryogenesis from leaves of Vitis x Muscadinia hybrids. Vitis 34:239–240 32. Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50: 1515–1518 33. Torregrosa L, Bouquet A (1996) Adventitious bud formation and shoot development from in vitro leaves of Vitis x Muscadinia hybrids. Plant Cell Tiss Org Cult 45:245–251 34. Mullins MG (1966) Test-plants for investigations of physiology of fruiting in Vitis vinifera L. Nature 209:419–420

35. Martinelli L, Mandolino G (2001) Transgenic grapes (Vitis species). In: Bajaj YPS (ed) Biotechnology in agriculture and forestry, vol 47, transgenic crops II. Springer, Berlin, pp 325–338 36. Legrand V, Dalmayrac S, Latché A et al (2003) Constitutive expression of Vr-ERE gene in transformed grapevines confers enhanced resistance to eutypine, a toxin from Eutypa lata. Plant Sci 164:809–814 37. Motoike SY, Skirvin RM, Norton MA, Otterbacher AG (2002) Development of methods to genetically transform American grape (Vitis × labruscana L.H. Bailey). J Hort Sci Biotechnol 77:691–696 38. Mauro M-C, Toutain S, Walter B et al (1995) High efficiency regeneration of grapevine plants transformed with the GFLV coat protein gene. Plant Sci 112:97–106 39. Bouquet A, Torregrosa L (2003) Micropropagation of the grapevine. In: Jain SM, Ishii K (eds) Micropropagation of woody trees and fruits. Kluwer, Dordrecht, pp 319–352 40. Torregrosa L, Bouquet A, Goussard PG (2001) In vitro culture and propagation of grapevine. In: Roubelakis-Angelakis KA (ed) Molecular biology and biotechnology of the grapevine. Kluwer, Dordrecht, pp 281–326

Chapter 16 Melon (Cucumis melo) Satoko Nonaka and Hiroshi Ezura Abstract Genetic transformation is an important technique used in plant breeding and to functionally characterize genes of interest. The earliest reports of Agrobacterium-mediated transformation in the melon (Cucumis melo) were from the early 1990s (Fang and Grumet, Plant Cell Rep, 9: 160–164, 1990; Dong et al., Nat Biotechnol 9: 858–863, 1991; Valles and Lasa, Plant Cell Rep 13: 145–148, 1994). These early studies described three problems that decreased the efficiency of transformation: tetraploidy, chimeras, and escape. Using a liquid culture system for somatic embryogenesis, Akasaka-Kenedy et al. (Plant Sci 166: 763–769, 2004) overcame these problems and established an efficient transformation system; the protocol introduced in this chapter is based on this method. Key words Agrobacterium-mediated transformation, Chimera, Escape, Liquid culture, Somatic embryo, Tetraploidy

1

Introduction In addition to being an important horticultural crop, the melon (Cucumis melo L.) is also a useful experimental organism for understanding fruit ripening, as physiological and biochemical changes in flavor development and texture occur during the ripening of the fruit [1]. An understanding of the molecular mechanism underlying melon fruit ripening will require the isolation and functional verification of genes contributing to this trait. Transformation is a technique used to characterize the functions of genes of interest. In the last two decades, several types of genetic transformation techniques have been developed in the melon. Agrobacterium-mediated techniques reported in the early 1990s [2–4] identified three major problems affecting transformation in the melon: the induction of tetraploidy, chimeras, and escape. Embryogenesis via cotyledon explants was later found to reduce the occurrence of tetraploidy [5]. Embryogenesis is a useful regeneration system because the embryos originate from a single cell and the number of chimeric plants regenerated is therefore

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_16, © Springer Science+Business Media New York 2015

195

196

Satoko Nonaka and Hiroshi Ezura

reduced. Problems with escape appear to be caused by the inefficient selection of transformed cells. Because the whole explant is exposed to antibiotics when suspended in liquid media but not when cultured on solid media, the liquid culture system achieves a more effective selection of transformed cells. Akasaka-Kenedy et al. [6] demonstrated that the use of a liquid culture system for Agrobacterium-mediated melon transformation reduced the occurrence of tetraploidy, chimeras, and escape. The protocol introduced in this chapter is based on the method of Akasaka-Kenedy et al. [6]. One mature melon seed was chopped into 12–20 segments for the preparation of explants for genetic transformation. These explants were cultured in liquid embryo induction (EI) medium containing MS salts, MS vitamins, 3 % sucrose, 2 mg/l 2,4-D, and 0.1 mg/l BA for 2 days. After this 2-day pre-culture period, the segments were inoculated with Agrobacterium tumefaciens containing the desired transgene and cocultured on solid EI medium with 0.8 % agar for 4 days in the dark. To select transformed calli and embryos, the inoculated segments were transferred to liquid EI medium containing 25 mg/l kanamycin and 375 mg/l Augmentin and subcultured every 2 weeks. Antibiotic-resistant embryos appeared on the surface of the explants 3–4 months after A. tumefaciens transfection. For regeneration and plant development, the embryos were cultured on solid MS medium containing 50 mg/l kanamycin and 375 mg/l Augmentin without plant growth regulators (PGRs) for 1 month. The transgenic melon plants were acclimated and grown in a greenhouse. Three transgenic lines were obtained from 130 explants that, in theory, could have been derived from 6.5 seeds. Thus, the transformation efficiency of this method was 2.3 % per explant and 46.1 % per seed.

2

Materials

2.1 Agrobacterium tumefaciens Strain and Vector

Agrobacterium tumefaciens GV2260 [7] carrying pIG121-Hm [8] was used in this protocol. This binary vector contains the neomycin phosphotransferase gene (nptII), beta-glucuronidase gene (GUS), and hygromycin phosphotransferase gene (hpt) cassette in T-DNA region. The expression of nptII gene is under control of Nos promoter, and the terminator is Nos terminator. Kanamycin is suitable for selection of transformed cells for melon transformation, so in this protocol, nptII gene and kanamycin were used for selection.

2.2

This protocol is optimized for Cucumis melo L. var cantalupensis ‘Vedrantais’ (Fig. 1). This cultivar was kindly provided by M. Pitrat Inra, Avignon, France, and it has been bred to homozygosity in laboratory and fields (see Note 1).

Plant Material

Melon (Cucumis melo)

197

Fig. 1 Cucumis melo L. var. cantalupensis cv. ‘Vedrantais’

2.3

Stock Solutions

2.3.1 MS salt

1. Stock 1 (50×): 82.5 g of NH4NO3, 95 g of KNO3, 8.5 g of KH2PO4, 310 mg of H3BO3, 1,115 mg of MnSO4·H2O, 430 mg of ZnSO4·7H2O, 41.5 mg of KI, 12.5 mg of Na2MoO4·2H2O, 1.25 mg of CuSO4·5H2O, 1.25 mg of CoCl2·6H2O, per 1,000 ml of distilled water. Store this solution at 4 °C. 2. Stock 2 (100×): 44 g of CaCl2·H2O per 1,000 ml of distilled water. Store this solution at 4 °C. 3. Stock 3 (100×): 37 g of MgSO4·7H2O per 1,000 ml of distilled water. Store this solution at 4 °C. 4. Stock 4 (100×): 2.78 g of FeSO4·7H2O and 3.73 g of Na2EDTA per 1,000 ml of distilled water. Store this solution at 4 °C.

2.3.2 Vitamins and Phytohormones

1. MS Vitamin (200×): Dissolve 10 g of myo-inositol, 50 mg of nicotinic acid 50 mg of pyridoxine hydrochloride, 10 mg of thiamine hydrochloride, and 200 mg of glycine in 900 ml of distilled water and adjust the volume to 1,000 ml. Dispense the solution to 5 ml and store it at −30 °C. 2. 2,4-Dichlorophenozy acetic acid (2,4-D, 10 mg/ml): Dissolve 1 g of 2,4-D in 100 ml of dimethyl sulfoxide (DMSO). Dispense the solution to 1 ml and store it at −30 °C. 3. 6-Benzylaminopurine (BA, 1 mg/ml): Dissolve 0.1 g of BA in 100 ml of DMSO. Dispense the solution to 1 ml and store it at −30 °C.

2.3.3 Antibiotics and Selective Agents

1. Kanamycin (50 mg/ml): Dissolve 2 g of kanamycin in 40 ml of distilled water. And sterilize with a 0.22 μm cellulose acetate filter and store it at −30 °C. 2. Augmentin: Dissolve 1 tablet of Augmentin (GlaxoSmithKline K.K., Uxbridge, UK) in 5 ml of stilled water before using.

198

2.4

Satoko Nonaka and Hiroshi Ezura

Culture Media

2.4.1 For Agrobacterium

1. LB medium (liquid): Dissolve 10 g of sodium chloride, 10 g of Bacto-tryptone, 5 g of yeast extract in 800 ml of distilled water. And adjust the volume to 1,000 ml with distilled water. The adjusted medium was autoclaved at 121 °C for 15 min. After autoclaved, it is cooled less than 60 °C and then antibiotics are added in LB medium. 2. LB medium (solid): 20 g of Bacto Agar were added to LB liquid medium before autoclaved. After autoclave, the medium was cooled at 60 °C and then antibiotics are added.

2.4.2 For Melon

1. Embryo induction (EI) medium: 30 g of sucrose was dissolved in 800 ml of distilled water, and add 20 ml of MS salt stock 1, 10 ml of MS salt stock 2, 10 ml of MS salt stock 3, 10 ml of MS salt stock 4, 5 ml of MS vitamin, 200 μl of 2,4-D (final concentration was 2 mg/l), and 100 μl of BA (final concentration was 0.1 mg/l) mixed well. After the sucrose was dissolved completely, pH was adjusted to 5.8 by sodium hydroxide, and then the volume was 1,000 ml total. The medium was autoclaved at 121 °C for 15 min. After autoclave, the medium was cooler than 60 °C; kanamycin and augmentin were added as necessary. 2. Cocultivation medium: 8 g of agar were added to EI medium just before autoclave. 3. Germination medium: 30 g of sucrose was dissolved in 800 ml of distilled water, and 20 ml of MS salt stock 1, 10 ml of MS salt stock 2, 10 ml of MS salt stock 3, 10 ml of MS salt stock 4, 5 ml of MS vitamin, and 8 g of agar were added to EI medium just before autoclave. The medium was autoclaved at 121 °C for 15 min. After autoclave, the medium was cooler than 60 °C; kanamycin and augmentin were added as necessary.

3

Methods The various steps of the protocol are summarized in Fig. 2 and described in further detail below.

3.1 Growing Donor Plants in Green House

1. Seeds were wrapped with moisten paper towel for 1 week for germination. 2. Germinated seedlings were in soil in 10 cm pot with molding. The seedlings were grown in the greenhouse. The photoperiod and light intensity are natural condition in Tsukuba, Japan (36.0 N°, 140.0 E°). Lowest temperature is 15 °C, and highest temperature is 25 °C (see Note 2). 3. After the three leaves’ appearance, transplant each plant into a 40 cm pot with molding (one plant per pot).

Melon (Cucumis melo)

199

Fig. 2 Schematic of Agrobacterium-mediated transformation via somatic embryogenesis. The time schedule is indicated on the left. EI: MS medium containing 3 % sucrose, 2 mg/l 2,4-D, and 0.1 mg/l BA. Km and Aug indicate kanamycin and Augmentin, respectively

4. One week after transplant, melons were bending brunch by strings hanged by the beam of ceiling. Water was supplied, when the soil is dry. 5. Under ten nodes, axillary buds were cut off. Top pinched after 24 nodes appearance. 6. One month after planting, flowering was started. The female flowers were covered on the evening 1 day before flowering to avoid closing another plant. 7. In early morning (before 8:00 am), the female flowers were uncovered. Removing the petals on the flower, the flower was closed with the male flower on the same plant. If a few melons were fruited on one plant, remove all fruit leaving the best one. 8. About 50 days after pollination, melon fruits were harvested and incubated on dark and cool place for 1 week. Then the seeds were harvested. 9. Seeds were incubated at room temperature, for a week to dry up completely. The seeds were stored at 4 °C until using.

200

3.2

Satoko Nonaka and Hiroshi Ezura

Plant Preparation

1. The seed coats were removed. 2. Seeds were sterilized with 70 % EtOH for 10 s and with 0.02 % hypochlorite with 0.01 % Tween 20 for 15 min (Fig. 3a). 3. Seeds were rinsed three times in distilled water for 5 min. 4. The seeds were soaked in sterile distilled water for 6 h. 5. The sterilized seeds were cut in half lengthwise and sectioned crosswised, producing explants approximately 1–4 mm2 in size (Fig. 3b). Twelve to twenty explants were prepared from each segment. 6. The segments were cultured for 2 days in 10 ml of liquid EI medium with 100 ml volume of Erlenmeyer flask on a rotary incubator shaker (100 rpm) at 25 °C under a 16 h photoperiod (50 μmol/m2/s).

Fig. 3 Plant regeneration and transformation in the melon (C. melo L. var. cantalupensis cv. ‘Vedrantais’). (a) Sterilized melon seeds without seed coats. (b) Sterilized seeds are cut into 1–4 mm2 pieces. (c) Calli formed at the cut surfaces of explants after 3 weeks of culture (bar = 2 mm). (d) Embryos developed in liquid EI medium after 4 weeks of culture (bar = 4 mm). (e) Regenerated plants exhibited severe vitrification in liquid MS medium after 8 weeks of culture. (f) Healthy plantlets growing in 1.0 % agar-solidified MS medium after 8 weeks of culture (bar = 6 mm). (g) A regenerated plant obtained from a somatic embryo after 12 weeks of culture. (h) Blue spots were observed at the cut surfaces of explants 4 days after infection. (i) Strong GUS expression was observed on proliferated calli on the explants grown in liquid EI selection medium 6 weeks after infection. (j) Stable GUS expression was observed throughout the embryo 9 weeks after infection (color figure online)

Melon (Cucumis melo)

3.3 Preparation of Agrobacterium Culture for Infection

201

1. A. tumefaciens was cultured on solid LB medium at 28 °C for 2 days. 2. A single colony was selected and cultured in 2 ml of LB medium at 28 °C and 200 rpm for 2 days until the culture reached the stationary phase. 3. A 15 μl volume of this culture was added to 15 ml of fresh LB medium; this mix was then cultured at 28 °C and 200 rpm for 20 h. 4. When the optical density of the culture reached 0.8–1.0, the cells were centrifuged and the pelleted bacterial cells were resuspended in 30 ml of liquid EI medium. The optical density (OD600) was adjusted to 0.4–0.5.

3.4 AgrobacteriumMediated Transformation

1. Melon explants pre-cultured for 2 days in liquid EI medium were inoculated with A. tumefaciens as described above and incubated for 20 min. 2. The inoculated explants were wiped with distilled filter paper to remove excess bacterial suspension. 3. Inoculated segments were cultured on EI medium with 0.8 % agar (Wako Pure Chemical Industries, Japan) for 4 days in the dark at 25 °C. 4. Melon explants inoculated with A. tumefaciens harboring pIG121-Hm showed GUS staining, indicating successful transformation (Fig. 3h–j).

3.5 Selection for Putative Transgenic Embryos and Calli

1. After cocultivation, the explants were cultured in 10 ml of liquid EI medium containing 25 mg/l kanamycin and 375 mg/l Augmentin with 100 ml volume of Erlenmeyer flask on a rotary incubator shaker (100 rpm) at 25 °C under a 16 h photoperiod with light intensity of 50 μmol/m2/s (see Note 3). 2. The explants were subcultured and washed in water every 2 weeks (see Note 4). 3. After 3–4 months of culture, somatic embryos and calli were observed at the cut surfaces of the explants (Fig. 3c, d, i, and j).

3.6 Regeneration of Transgenic Plants

1. To induce embryo germination and plant development, the explants were transferred to 1.0 % agar-solidified germination medium containing 50 mg/l kanamycin and 375 mg/l Augmentin at 25 °C under a 16 h photoperiod (50 μmol/ m2/s) for 4 weeks (Fig. 3f and g) (see Note 5). 2. The transformation efficiency was approximately 2.3 %, with three transgenic plants obtained from 130 explants that, in theory, could have been derived from 6.5 seeds [6]. Escape was very low with this protocol: only 16.7 % of the kanamycin-resistant embryos were escapes. This protocol

202

Satoko Nonaka and Hiroshi Ezura

also yielded an efficient regeneration of diploids in ‘Vedrantais’: approximately 75.9 % germinated from somatic embryos and greater than 60 % of the plants regenerated from the embryos were diploid. 3.7 Transplanting and Acclimation

1. Rooting shoots were checked polyploidy and select diploid plants. 2. Plants were planted in soil in 10 cm pots and covered over plastic filter for 1 week in culture room. 3. Make the tiny holes on the cover, for acclimation, and grow the plant for 1–2 weeks in culture room. 4. The pots were uncovered and plants were grown in a greenhouse as describe in Subheading 3.1.

4

Notes 1. Melon cultivars: The protocol described is applicable to other melon varieties such as C. melo L. var. reticulatus cv. ‘Earl’s Favourite’. 2. The suitable temperature for melon cultivation is between 15 and 25 °C. And melon grows well in low humidity condition. 3. Escape and chimeras: In this protocol, a liquid culture system was used to select transgenic embryos derived from explants. Because somatic embryos derive from a single cell and because whole embryos are exposed to kanamycin, the occurrence of escape and chimeras was reduced, even though a lower concentration of kanamycin was used than in the standard melon protocol. This result indicates that a liquid culture system is effective for the selection of transformed embryos in the melon. 4. Overgrowth of Agrobacterium: When using a liquid culture selection system, it is difficult to eliminate A. tumefaciens from liquid medium containing sugar during the selection of transgenic embryos. Particular care must therefore be taken to change the liquid EI medium when using this protocol. During the subculture, the explants must be washed in sterilized water and new culture vessels must be used. 5. Vitrification: Melon tissues are sensitive to vitrification. Somatic embryos derived from liquid culture have often been found to exhibit typical vitrification and fail to develop into plantlets [5]. To avoid vitrification, 1.0 % agar-solidified G medium was used for germination in this protocol. Embryos did not grow in 0.4 % Gelrite-solidified medium. Using surgical tape to seal, the culture vessels were also important for keeping the humidity low during plant regeneration.

Melon (Cucumis melo)

203

References 1. Ezura H, Owino WO (2008) Melon, an alternative model plant for elucidating fruit ripening. Plant Sci 175:121–129 2. Fang G, Grumet R (1990) Agrobacterium tumefaciens mediated transformation and regeneration of muskmelon plants. Plant Cell Rep 9:160–164 3. Dong JZ, Yang MZ et al (1991) Transformation of melon (Cucumis melo L.) and expression from the cauliflower mosaic virus 35S promoter in transgenic melon plants. Nat Biotechnol 9:858–863 4. Valles MP, Lasa JM (1994) Agrobacteriummediated transformation of commercial melon (Cucumis melo L., cv. Amarillo Oro). Plant Cell Rep 13:145–148 5. Guis M, Amor MB et al (2000) A reliable system for the transformation of cantaloupe charentais

melon (Cucumis melo L. va. Cantalupensis) leading to a majority of diploid regenerants. Sci Hortic 84:91–99 6. Akasaka-Kenedy Y, Tomita K et al (2004) Efficient plant regeneration and Agrobacteriummediated transformation via somatic embryogenesis in melon (Cucumis melo L.). Plant Sci 166:763–769 7. Deblaere R, Bytebier B, De Greve H, Deboeck F, Schell J, van Montagu M, Leemans J (1985) Efficient octopine Ti plasmid-derived vectors for Agrobacterium-mediated gene transfer to plants. Nucleic Acids Res 13:4777–4788 8. Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6:271–282

Chapter 17 Peach (Prunus persica L.) Silvia Sabbadini, Tiziana Pandolfini, Luca Girolomini, Barbara Molesini, and Oriano Navacchi Abstract Until now, the application of genetic transformation techniques in peach has been limited by the difficulties in developing efficient regeneration and transformation protocols. Here we describe an efficient regeneration protocol for the commercial micropropagation of GF677 rootstock (Prunus persica × Prunus amygdalus). The method is based on the production, via organogenesis, of meristematic bulk tissues characterized by a high competence for shoot regeneration. This protocol has also been used to obtain GF677 plants genetically engineered with an empty hairpin cassette (hereafter indicated as hp-pBin19), through Agrobacterium tumefaciens-mediated transformation. After 7–8 months of selection on media containing kanamycin, we obtained two genetically modified GF677 lines. PCR and Southern blot analyses were performed to confirm the genetic status. Key words Agrobacterium tumefaciens, Fruit trees transformation, GF677 rootstock, Peach, Regeneration via organogenesis

1

Introduction Stone fruits, especially peach (Prunus persica), are among the most important tree species of the Mediterranean basin. Viral diseases represent one of the major problems affecting stone fruit trees and causing significant agronomic and economic losses. Many viruses are difficult to eradicate because antiviral treatments are either not available or not effective; thus, preventing diseases from entering and spreading in the fields is the most efficient and cost-effective method for controlling infections. However, prevention and control tactics are often not effective and associated to environmental sustainability issues and excessive costs for farmers. The genetic transformation of these fruit species provides huge potentiality for the obtainment of cultivars with increased resistance to pathogens and also for the improvement of fruit production and quality. Until now, the main problem in the genetic transformation of peach has been the lack of an efficient in vitro regeneration protocol.

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_17, © Springer Science+Business Media New York 2015

205

206

Silvia Sabbadini et al.

The majority of methods for in vitro regeneration of peach employed juvenile tissues and immature seeds as starting material [1–6]. These protocols are useful for scientific but not agronomic purposes, especially because peach is as highly heterozygous species [7, 8]. Few reports exist, describing regeneration from mature tissues of stone fruit trees. One method, which is based on the regeneration of organogenic calli obtained from the base of stem explants, has been developed and successfully applied for the induction of shoot formation on different peach cultivars and rootstock [8]. A similar regeneration protocol was already developed and exploited for the genetic transformation of Vitis vinifera [9]. This system consists in the formation of a meristematic bulk tissue, obtained from proliferating in vitro shoots, and induction of adventitious shoot regeneration by a gradual increase of benzyl adenine (BA) content in the regeneration medium. In both these organogenetic methods [8, 9], the hormonal treatment, together with endogenous and exogenous cell regulators, induced the formation of new adventitious shoots. In the literature, few examples are present reporting peach genetic transformation principally due to difficulties in the obtainment of stable transformants. There are only two examples of peach stable transformation. In one case, Smigocki and Hammerschlag [10] described the obtainment of several transgenic plants that express the bacterial cytokinin biosynthesis gene (ipt), starting from in vitro regeneration of immature embryo. In the second one, Pérez-Clemente et al. [11] developed several transgenic peach plants stably expressing the GFP reporter gene, starting from in vitro cultured embryo sections. Here we describe a method for in vitro peach regeneration/ transformation of GF677 rootstock via organogenesis, adapted from one previously developed for grape [9]. The regeneration and transformation protocol can be divided into two principal phases: (1) Production of meristematic bulk tissues then used as starting material for the Agrobacterium-mediated genetic transformation and (2) selection procedure for the identification of putative transgenic lines. A. tumefaciens strain GV2260, harboring an empty hairpin cassette (hp-pBin19), was used to genetic engineer meristematic tissues of GF677, and then kanamycin selection was applied for the isolation of putative transgenic lines. The first stable transformed transgenic lines can be obtained 7–8 months after genetic transformation. The selection procedure is the key factor for the achievement of new stable transgenic lines. The transformation trials have been performed on 600 meristematic slices obtained from meristematic bulks of GF677 rootstock. After kanamycin selection and subsequent PCR and Southern blot analysis screening, we identified two stable T0 transgenic lines, which correspond to a transformation efficiency of 0.33 %.

Peach (Prunus persica L.)

207

This protocol represents one of the few examples of in vitro peach regeneration via organogenesis starting from adult tissues, which can be transferred for the regeneration and genetic transformation of other peach rootstocks and cultivars. The use of this protocol permits the production of genetically modified peach plants, and to our knowledge, this is the first example of a successful peach rootstock genetic transformation. The innovative approach and strategy described in this study represent a suitable tool to introduce in peach antiviral hairpin constructs in order to confer resistance to specific virus infections via RNA silencing.

2 2.1

Materials Plant Material

In vitro proliferating explants of the peach rootstock GF677 (P. persica × P. amygdalus) were provided by Vitroplant Italia S.r.l., Cesena, Italy, and used as starting plant material for the genetic transformation trials.

2.3 Stock Solutions and Supplies

1. 6-Benzylaminopurine (BAP, 1 mg/mL): Prepare stock by adding 50 mg of BAP to a 50-mL tube and add a few drops of 1 M KOH until dissolved by stirring. Bring to volume with ultrapure water (Milli-Q system water). Stirring the solution while adding water may be required to keep the material in solution. Store at −20 °C for up to 6 months.

LB

Pro-S

InLAX

HindIII

KpnI

BamHI

The hairpin cassette (hp-pBin19) (Fig. 1) used to genetically transform the rootstock GF677 plants contains the 543-base-long constitutive promoter 35S of the CaMV (Cauliflower mosaic virus), followed by the 115-base-long intron of the LAX1 (InLAX) gene of Medicago truncatula and the 253-base-long terminator sequence of the nopaline synthase (NOS) gene of A. tumefaciens. The hairpin cassette was subcloned in the T-DNA region of a derivative of pBin19 binary vector [12], containing the 984-base-long sequence of the neomycin phosphotransferase II gene (npt II) and its regulatory regions (i.e., the 307-base-long promoter sequence and the 256-baselong terminator sequence of NOS gene) (see Note 1). The recombinant plasmid was inserted into A. tumefaciens strain GV2260.

EcoRI

2.2 Gene Construct, Plasmid Vector, and Agrobacterium Strain

NOS-ter

NOS-Ter/npt II/Pro-NOS RB

Fig. 1 Schematic drawing of the T-DNA region of the hairpin cassette (hp-pBin19). Pro-35S, CaMV 35S promoter; InLax, the intron of the LAX1 (InLAX) gene of Medicago truncatula; NOS-ter, the terminator sequence of the nopaline synthase (NOS) gene of A. tumefaciens; NOS ter/npt II/Pro-NOS, the plant selectable marker gene cassette, neomycin phosphotransferase II gene (npt II ) controlled by the NOS promoter and terminator

208

Silvia Sabbadini et al.

2. Indole-3-butyric acid (IBA, 1 mg/mL): Prepare stock by adding 50 mg of IBA powder to a 50-mL tube and add a few drops of 1 N NaOH to dissolve it by stirring. Once completely dissolved, bring to volume with ultrapure water. Store at −20 °C for up to 6 months. 3. 1-Naphthaleneacetic acid (NAA, 1 mg/mL): Prepare stock by adding 50 mg of NAA powder to a 50-mL tube and add a few drops of 1 N NaOH to dissolve it by stirring. Once completely dissolved, bring to volume with ultrapure water. Store at −20 °C for up to 6 months. 4. Rifampicin (33.3 mg/mL): To prepare, place 330 mg rifampicin powder in 10 mL of dimethyl sulfoxide (DMSO) and allow rifampicin to dissolve by stirring. Filter-sterilize and divide in 1.5-mL Eppendorf tubes. Store at −20 °C for up to 6 months. 5. Streptomycin (100 mg/mL): To prepare stock solution, place 1 g of streptomycin powder in 10 mL of ultrapure water and allow streptomycin to dissolve by stirring. Filter-sterilize and divide into 1.5-mL Eppendorf tubes. Store at −20 °C for up to 6 months. 6. Kanamycin monosulfate (50 mg/mL): To prepare, place 500 mg of kanamycin monosulfate powder in 10 mL of ultrapure water, and allow kanamycin to dissolve by stirring. Filtersterilize and divide into 1.5-mL Eppendorf tubes. Store at −20 °C for up to 6 months. 7. Cefotaxime (100 mg/mL): The commercial product consists of 1 g of cefotaxime powder that has to be dissolved in 10 mL of ultrapure water. Store at −20 °C for up to 6 months. 8. Acetosyringone (20 mg/L): To prepare stock solution, place 100 mg of acetosyringone powder in 5 mL of ethanol absolute, and allow acetosyringone to dissolve by stirring. Filtersterilize and store at −20 °C for up to 6 months. 9. Proline (200 mg/mL): To prepare, place 1 g of proline powder in 5 mL of ultrapure water, and allow proline to dissolve by stirring. Filter-sterilize and store at −20 °C for up to 6 months. 2.4

Media

After pH adjustment, all media should be autoclaved at the temperature of 121 °C and 1 bar for 20 min (see Note 2). 1. YEB medium for A. tumefaciens culture: 5 g/L of yeast extract, 1 g/L of peptone, 5 g/L sucrose, 480 mg MgSO4, 50 mg/L kanamycin, 100 mg/L streptomycin, 100 mg/L rifampicin, and 7.2 g/L agar (for solid medium) adjusted to pH 7.2 with NaOH. 2. Meristematic bulk initiation medium (IM): 1,050 mg/L KNO3, 400 mg/L NH4NO3, 200 mg/L KH2PO4, 400 mg/L MgSO4·7H2O, 750 mg/L CaNO3, 200 mg/L NaH2PO4, MS

Peach (Prunus persica L.)

209

microelements and vitamins [13], 3 % sucrose, 0.7 % commercial agar, and 0.01 mg/L NAA. IM medium was supplemented with increasing concentration of BAP during subsequent subcultures (from 1 mg/L up to 3 mg/L). The medium is adjusted to pH 5.6–5.7 with KOH. 3. Meristematic bulk selection medium (SM): IM medium enriched with 3 mg/L of BAP, increasing concentration of kanamycin monosulfate (from 25 mg/L up to 70 mg/L) and 200 mg/L cefotaxime (see Note 3). 4. Meristematic bulk rooting medium: IM medium supplemented with 1.5 mg/L IBA adjusted to pH 5.6–5.7 with KOH. 5. MS20 medium meristematic bulk infection solution: 4.4 g of MS salts including vitamins, 20 g/L sucrose, adjusted to pH 5.2 with KOH. 6. MSH0 Agrobacterium-plant co-culturing medium: 4.4 g of MS salts including vitamins, 30 g/L sucrose, 7 g/L plant agar, adjusted to pH 5.2 with KOH, 1 μL/mL of proline (200 mg/ mL stock solution), and 1 μL/mL of acetosyringone (20 mg/L stock solution). These last two components are added after sterilization, as they are heat sensitive. The infection solution has to be prepared fresh as required. 2.5 Transgenic Plant Analysis

1. DNA extraction was performed using the commercial kit “Nucleon Phytopure” (Amersham Bioscience). 2. Polymerase chain reaction (PCR)-related solution and buffers. 3. Primers: 35S promoter forward primer (5′CTTCGTCA ACATGGTGGAGCACGACA 3′) and reverse primer (5′TGGAGATATCACATCAATCCACTTG 3′). 4. Southern blot analysis-related solutions and buffer: (a) 1× TBE buffer: 0.089 M Tris base, 0.089 M boric acid, 2 mM EDTA, pH 8.0; (b) depurination solution: 0.2 M HCl; (c) denaturation solution: 1.5 M NaCl, 0.5 M NaOH; (d) neutralization solution: 1.5 M NaCl, 0.5 M Tris–HCl, adjusted to pH 7.4; (e) SCC 20× solution: 3 M NaCl, 0.3 M Sodium Citrate; (f) ULTRA hyb hybridization buffer (Ambion).

3

Methods

3.1 Initiation and Regeneration of Meristematic Bulks

Meristematic bulks (MBs) of the peach rootstock GF677 (P. persica × P. amygdalus) are initiated from shoot tips that are mechanically and chemically treated in order to induce the formation of MBs, which consist of organogenic calli able to efficiently differentiate and regenerate new adventitious shoots.

210

Silvia Sabbadini et al.

Fig. 2 Main steps of the rootstock GF677 regeneration and in vitro propagation: (a) Meristematic bulk obtained after the four subcultures, after the elimination of the apical domes; (b) slice from a meristematic bulk able to regenerate many adventitious shoots; (c) slices obtained from MB (approx. 1 cm2, 2 mm thick) and used for in vitro micropropagation or genetic transformation

1. The production of MBs starts with the elimination of the apical dome from in vitro proliferating shoots, placed on a standard proliferation medium used for GF677 commercial propagation (Fig. 2a). 2. The remaining basal cluster is subcultured on an initiation medium (IM) supplemented with increasing concentrations of BAP (from 1 up to 3 mg/L) for a total of four subcultures (every 4 weeks for the first and second phases, and every 60 and 90 days, for the third and fourth phases). At the beginning of each subculture, the apical domes of the initial proliferating shoots originated from the MBs (Fig. 2b) are eliminated, and the remaining meristematic tissues are cut in small slices (1 cm2, 2 mm thick) that are used to repropagate MBs and also used as starting plant material for the transformation experiments (Fig. 2c). 3. During the first two subcultures, the regenerated MBs are transferred to new media every 4 weeks. The concentration of BAP is increased from 1 mg/L (first subculture) to 2 mg/L (second subculture). 4. During the last two subcultures, the regenerated MBs are transferred to new media, after 60 days for the first one, and after 90 days for the second one. The concentration of BAP is raised from 2 to 3 mg/L. 5. MBs, when initiated, can be maintained on IM medium added with 3 mg/L of BAP for a long period by keeping them proliferating and transplanted, at 24 °C under a photoperiod of 16-h light (70 μmol/m2/s) provided by white fluorescent tubes.

Peach (Prunus persica L.)

3.2 A. tumefaciens Preparation and Plant Tissue Infection

211

1. A. tumefaciens strain GV2260 was transformed with the pBin19 derivative vector containing the hairpin cassette hppBin19 (Fig. 1) through electroporation (see Note 4). Bacteria are grown in YEB solid medium containing 50 mg/L kanamycin, 100 mg/L rifampicin, and 100 mg/L streptomycin for 48 h at 28 °C. For each transformation experiment, one colony is inoculated to a 50-mL Falcon tube containing 10 mL of YEB liquid medium supplemented with 50 mg/L kanamycin, 100 mg/L rifampicin, and 100 mg/L streptomycin and grown overnight at a temperature of 28 °C with shaking (150 rpm). 2. The next morning 1 mL of the Agrobacterium suspension is taken and added to 9 mL of YEB liquid medium (with antibiotics) in a new 50-mL Falcon sterile tube. The suspension is grown at 28 °C with shaking (150 rpm) until OD600 = 0.5–1.0. 3. The bacterial culture is then centrifuged for 15 min at 1,600 × g and resuspended in MS20 liquid medium, a total final resuspension solution of 50 mL is normally sufficient for infecting 25 meristematic slices (1 cm2, 2 mm thick) obtained from MB. MS20 liquid medium is supplemented with 1 μM acetosyringone, 1 μM proline, to induce the virulence (vir) genes of Agrobacterium. When the tubes are prepared, close them with Parafilm and mix the solution, and then put the tubes at 28 °C with shaking (150 rpm), for 5 h. 4. Before infection, plant tissues are prepared by removing the apical domes of the proliferating shoots grown on the MBs (Fig. 1b) and cutting the remaining meristematic tissues in small slices (1 cm2, 2 mm thick). 5. Slices obtained from meristematic bulks are dipped into the bacterial suspension for 15 min, then dried on filter paper, subsequently transferred on MSH0 solid medium where they are incubated at 24 °C in dark for 24 h. 6. Finally the infected plant material is washed with a decontamination solution (sterile water + cefotaxime 500 mg/L) for 5 h at 24 °C with shaking (150 rpm) and then placed in Petri plates containing solid SM medium, enriched with 25 mg/L of kanamycin.

3.3 Regeneration/ Selection and Acclimatization of Putative Transformed Lines

1. The infected plant material is subcultured every 15 days (for a total of 14 subcultures in 7 months) on fresh media containing increasing concentration of kanamycin (Fig. 3a) (from 25 to 50 mg/L and up to 70 mg/L) following the scheme represented in Table 1 (see Notes 5 and 6). The cultures kept at 24 °C under a photoperiod of 16-h light (70 μmol/m2/s) provided by white fluorescent tubes.

212

Silvia Sabbadini et al.

Fig. 3 Main steps of the selective process: (a) regeneration and selection of GF677 at kanamycin concentration of 25 mg/L; (b) rooting of GF677 selected lines; (c) acclimatization of putative transgenic lines

Table 1 Regeneration/selection scheme

Kanamycin concentration

Period of regeneration/selection (each subculture is made every 15 days)

25 mg/L (Petri dish)

2 subcultures-1 month

25 mg/L (pot)

2 subcultures-1 month

50 mg/L (pot)

4 subcultures-2 month

70 mg/L (pot)

4 subcultures-2 month

50 mg/L (pot) rooting

2 subcultures-1 month Total period of 7 months

2. After four subcultures at the final kanamycin concentration of 70 mg/L, regenerated and selected explants are isolated and transferred on the rooting medium supplemented with 50 mg/L of kanamycin for a period of 30 days (Fig. 3b) (see Note 7). 3. In vitro rooted lines are finally transferred to in vivo system and grown in greenhouse (at 25 °C under a photoperiod of 16-h light, 70–1,400 μmol/m2/s light intensity) for the acclimatization in a medium composed of 10 % perlite and 90 % peat (Fig. 3c). Selected lines are then analyzed through molecular tools (PCR and Southern blot) to verify their transgenic state (see Notes 8 and 9).

Peach (Prunus persica L.)

4

213

Notes 1. The neomycin phosphotransferase II gene (npt II), which confers resistance against kanamycin, has been used as selectable marker gene, which is the most commonly used, and it is recommended for the highest efficiency in cleaning transgenic regenerants at the chimeric state and finally in selecting stable transgenic clones. 2. The antibiotics are added to the culture media after sterilization, as they are heat sensitive. 3. Cefotaxime is used to avoid A. tumefaciens contamination in the regeneration/selection medium. 4. The electroporation protocol exploits the use of an electroporator (Bio-Rad) set up on 2.5 kW/cm. Immediately after electroporation, 1 mL of liquid YEB medium is added to the bacterial cells, and then the bacterial suspension is incubated at 28 °C for 1 h and subsequently plated on solid YEB medium containing the selective antibiotics rifampicin (100 mg/L), kanamycin (50 mg/L), and streptomycin (100 mg/L), for 2 days at 28 °C. Finally, the transformation reactions are verified by PCR analysis. 5. At the beginning of each subculture, the regenerating shoots originated from the slices are eliminated, and then the proliferated MBs are fragmented again to expose new regenerating cells to the selective agent. 6. The first two subcultures, at 25 mg/L of kanamycin, which follow the transformation protocol, are made in Petri dishes, while the regenerants are transferred on solid medium contained in glass pots for the all subsequent steps. 7. The regenerants are kept in a plant growth chamber at 24 °C under a 16-h photoperiod for all the selective process and following proliferating and rooting steps. 8. The transformation trials have been performed on a total of 600 meristematic sections of the rootstock GF677 that showed a percentage of bulk regeneration of about 94 % during the first phases of the selective process, which decreased to 86 % during the last steps, with a maximum number of ten adventitious shoots regenerated per slice. After 7–8 months, we obtained the first stable transgenic lines, which correspond to a transformation efficiency of 0.33 %. The regeneration efficiency was very high even on media with increased kanamycin concentration, but the fact that at the end of the selection procedure most of such regenerants were not transformed can be explained by the fact that the cell regeneration events are rarely originated by a single cell but mostly by a larger number of

214

Silvia Sabbadini et al.

initials cells, as generally happens in the organogenesis processes [14], creating as a consequence a high number of chimeric adventitious shoots, then difficult to bring at stable and homogenous transgenic line. As a consequence, they perform as escapes or unstable chimeric lines. Therefore, the selection procedure remains the key factor for the achievement of new stable transgenic lines. 9. For the analysis of putative transgenic lines, the genomic DNA isolation is performed using the commercial kit “Nucleon Phytopure” (GE Healthcare) starting from 1 g of leaves. PCR analysis is performed using a couple of primers specifically designed onto 35S promoter of the genetic construct, placed next to the left border of the T-DNA. For Southern blot analysis, 15 μg of genomic DNA was digested with Hind III, electrophoresed on a 0.7 % agarose gel in 1× TBE buffer, and transferred for capillarity to a nylon membrane (Hybond-N+, GE Healthcare). The DNA probe, corresponding to 540-bp sequence of the NPTII gene, was labelled with [32P] dCTP using “Ready to go DNA labelling beads (-dCTP)” (GE Healthcare). Unincorporated nucleotides were removed with ProbeQuant G-50 micro columns (GE Healthcare). The membrane was hybridized overnight at 42 °C in ULTRAhyb buffer (Ambion). Labelled probe (106 cpm/mL) was added to the hybridization buffer. The membrane was washed twice in 2× SSC containing 0.1 % SDS for 5 min and twice in 0.1× SSC containing 0.1 % SDS for 15 min at 42 °C. Autoradiography was then performed using Kodak X-AR5 film (Fig. 4).

Fig. 4 Southern analysis of GF677 transgenic lines hybridized with a probe designed on NPTII gene: lane 1. line GF1, lane 2. line GF2

Peach (Prunus persica L.)

215

References 1. Meng X, Zhou W (1981) Induction of embryoid ad production of plantlets in vitro from endosperm of peach. Acta Agric Univ Peking 7:95–98 2. Hammerschlag FA, Bauchan G, Scorza R (1985) Regeneration of peach plants from callus derived from immature embryos. Theor Appl Genet 70:248–251 3. Mante S, Scorza R, Cordts JM (1989) Plant regeneration from cotyledons of Prunus persica. Prunus domestica and Prunus cerasus. Plant Cell Tiss Org Cult 19:1–11 4. Scorza R, Morgens PH, Cordts JM, Mante S, Callahan AM (1990) Agrobacterium-mediated transformation of peach Prunus persica L. Batsch leaf segments, immature embryos and long term embryogenic callus. In Vitro Cell Dev Biol 26:829–834 5. Bhansali RR, Driver JA, Durzan DJ (1990) Rapid multiplication of adventitious somatic embryos in peach and nectarine by secondary embryogenesis. Plant Cell Rep 9:280–284 6. Pooler MR, Scorza R (1995) Regeneration of peach Prunus persica L. Batsch rootstock cultivars from cotyledons of mature stored seed. HortSci 30:355–356 7. Zhou HC, Li M, Zhao X, Fan XC, Guo AG (2010) Plant regeneration from in vitro leaves of the peach rootstock ‘Nemaguard’ (Prunus persica x P. davidiana). Plant Cell Tiss Org Cult 101:79–87

8. Pérez-Jiménez M, Carrillo-Navarro A, CosTerrer J (2012) Regeneration of peach (Prunus persica L. Batsch) cultivars and Prunus persica x Prunus dulcis rootstocks via organogenesis. Plant Cell Tissue Organ Cult 108:55–62 9. Mezzetti B, Pandolfini T, Navacchi O, Landi L (2002) Genetic transformation of Vitis vinifera via organogenesis. BMC Biotechnol 2:18 10. Smigocki AC, Freddi A, Hammerschlag A (1991) Regeneration of plants from peach embryo cells infected with a shooty mutant strain of Agrobacterium. J Am Soc HorticSci 116:1092–1097 11. Pérez-Clemente R, Pérez-Sanjuán A, GarcíaFérriz L, Beltrán J-P, Cañas LA (2004) Transgenic peach plants (Prunus persica L.) produced by genetic transformation of embryo sections using the green fluorescent protein (GFP) as an in vivo marker. Mol. Breed 14:419–427 12. Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12:8711–8721 13. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol Plant 15:473–497 14. Compton ME, Gray DJ (1993) Shoot organogenesis and plant regeneration from cotyledons of diploid, triploid, and tetraploid watermelon. J Am Soc HortSci 118:151–157

Chapter 18 Strawberry (Fragaria × ananassa) Roberto Cappelletti, Silvia Sabbadini, and Bruno Mezzetti Abstract Genetic transformation in strawberry (Fragaria spp.) can be achieved by using the Agrobacterium-mediated procedure on leaves from in vitro proliferated shoots. Regardless of the sufficient regeneration levels achieved from leaf explants of some commercial strawberry genotypes, the regeneration of transformed strawberry plants remains difficult and seems to be strongly genotype dependent. In fact, the main factors that play an important role in the success of strawberry genetic transformation are the availability of an efficient regeneration protocol and of an appropriate selection procedure of the putative transgenic shoots. The strawberry genetic transformation protocol herein described relates to three genotypes resulted from our experience with the highest regeneration and transformation efficiency. The study includes two octoploid Fragaria × ananassa cultivars, Sveva and Calypso, and a diploid F. vesca cultivar (Alpina W.O.). All the different steps related to the leaf tissue Agrobacterium infection, coculture, and selection of regenerating adventitious shoots, as well as the following identification of selected lines able to proliferate and root on the selective agent (kanamycin), will be described. Key words Agrobacterium infection, Kanamycin selection, Leaf tissue regeneration, Strawberry

1

Introduction The Agrobacterium tumefaciens-mediated transformation represents one of the most common techniques of recombinant DNA, and it is largely employed to obtain genetically modified plants. Efficient transformation and regeneration methods are a priority for successful application of recombinant DNA technology to vegetative propagated plants such as strawberry. To date, the most resourceful plant differentiation process for recombinant DNA technology in strawberry remains adventitious shoot organogenesis directly from somatic tissue or a previous callus formation. However, detailed developmental and physiological characterization of the whole sequence of the organogenic processes in strawberry somatic tissues is still mainly lacking [1]. The genotype and type of explants represent important factors affecting the regeneration process and consequently the genetic transformation efficiency. For several Fragaria × ananassa genotypes, efficient regeneration

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_18, © Springer Science+Business Media New York 2015

217

218

Roberto Cappelletti et al.

protocols have been identified by using different types of somatic tissues [2–6], although leaf tissue has been the most studied in several regeneration experiments [3, 7, 8] and in most cases it has displayed the highest regeneration efficiency [6]. Leaf explants have also been particularly useful for shoot regeneration and genetic transformation of wild strawberry (F. vesca) [9–16]. The shoot regeneration response of leaf tissue has mainly been related to the genotype and the cultivation factors, mainly in terms of the media composition (phytohormones and the type of nutrient medium). Cultivated strawberry varieties have shown large variability in the cell differentiation competence of their somatic tissues, and the effects of plant growth regulator (PGR) treatments in the induction of this process appear to be related to specific genetic factors [6]. The regeneration media that have generally produced the greatest shoot regeneration include the Murashige and Skoog (MS) medium [17], supplemented with 6-benzylaminopurine (benzyl adenine) and indole-3-butyric acid (IBA) [6, 18]. The ability of 1-phenyl-3-(1,2,3-thiadiazol-5-yl) urea (thidiazuron [TDZ]) to induce high shoot regeneration efficiency, in particular in woody plant tissues, has also been reported [19–21], while in strawberry the effect of TDZ has been explored recently in a restricted number of Fragaria × ananassa cultivars. With this cytokine-like plant growth regulator (PGR), strawberry regeneration showed specific responses that were dependent on the genotype and the type of tissue [6]. Among the auxins, 3-benzo[b] selenienyl acetic acid (BSAA) is a new highly active molecule that has already been tested in some crops, where it has shown a highly effective activity for the induction of somatic embryogenesis [22]; although it has not yet been tested for its capability to control organogenesis in woody plants, we recently achieved interesting results particularly in strawberry genotypes. A medium with a combination of TDZ and BSAA was found as a good regeneration medium for different genotypes [23]. Nowadays, due to the difficulty in finding BSAA on the market, new regeneration trials were carried out in order to find new combinations of plant growth regulators able to induce high strawberry leaf tissue regeneration efficiency. Good results were obtained using a medium supplemented with 0.5 mg/L TDZ in combination with 0.01 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D) in Calypso octoploid cultivar, while for Sveva a growing medium supplemented with 1 mg/L TDZ and 0.1 mg/L 2,4-D. Further investigations are in progress to test the activity of a growing medium supplemented with 3 mg/L BA and 0.2 mg/L IBA in order to improve regeneration efficiency of other cultivars such as Sveva, a new short-day variety. Among several strawberry genotypes tested in our trials, the regeneration and transformation response varied mainly depending on the genotype. The highest efficiency in genetic transformation

Strawberry (Fragaria × ananassa)

219

(about 5 %) was observed from the genotypes with the highest leaf tissue regeneration efficiency (100 % of leaf tissue regeneration), such as Sveva, a newly released octoploid cultivar (F. × ananassa), and the diploid F. vesca cv. Alpina W.O. Genotypes such as cv. Onda and cv. Paros, performing with an intermediate leaf tissue regeneration efficiency (about 80 % of leaves with adventitious shoots), showed a reduced Agrobacterium transformation efficiency (1–3 %). Strawberry genotypes showing much lower percentages of leaf tissue regeneration (lower then 40 %) can be quite more difficult to be transformed [23]. The achievement of stable genetically transformed plants is also strictly related to the antibiotic (kanamycin) selection protocol, starting from the early stage of leaf tissue regeneration, immediately after the Agrobacterium infection and coculture, and including the in vitro proliferation and rooting of newly selected shoots. Depending on the efficiency of the regeneration and transformation protocol, the first stable newly produced transgenic line can be available after 5–6 months from the first transformation experiment. Selection of trasgenic plants using antibiotics must be optimize depending of genotype used through toxicity threshold tests [24] and evaluating the possibility to use iterative or non iterative method of selection [25]. GFP fluorescence technique nowadays seems to be an alternative approach in order to help and in some case replace antibiotics in strawberry selection protocols [26].

2

Materials

2.1 Agrobacterium tumefaciens Strains, Vector, and Plant Selectable Markers

1. The LB4404 and EHA105 A. tumefaciens strains are the most commonly used and probably the most efficient, for strawberry genetic transformation. 2. The pBI121 binary plasmid was also successfully used [27]. The neomycin phosphotransferase II (nptII) gene is also the selectable marker most commonly used, and it is recommended for the highest efficiency in cleaning transgenic regenerants at the chimeric state and finally in selecting stable transgenic clones.

Explant Material

Newly expanded entire leaves, from in vitro proliferating shoots, cut transversally and cultured with the abaxial surface in contact with the regeneration medium.

2.3 Stock Solutions and Supplies

1. Thidiazuron (TDZ, 1 mg/mL): To prepare, place 100 mg of TDZ in a tube with a magnetic stir bar; add one drop of dimethyl sulfoxide (DMSO) and 100 mL of deionized sterile water. Allow TDZ to dissolve by stirring. Store in a bottle and at −20 °C for up to 6 months.

2.2

220

Roberto Cappelletti et al.

2. 6-Benzylaminopurine (6-BAP, 1 mg/mL): Prepare stock by adding 50 mg of 6-BAP to a 50-mL centrifuge tube and add few drops of 1 M KOH until dissolved by stirring. Bring to volume with ultrapure water (Milli-Q system water). Stirring the solution while adding water may be required to keep the material in solution. Store at −20 °C for up to 6 months. 3. 2,4-Dichlorophenoxyacetic acid (2,4-D, 1 mg/mL): To prepare, place 100 mg of 2,4-D in a tube with a magnetic stir bar; add one drop of ethanol or 1 N NaOH and 100 mL of deionized sterile water. Allow 2,4-D to dissolve by stirring. Store in a bottle and store at 2–8 °C for up to 6 months. 4. Indole-3-butyric acid (IBA, 1 mg/mL): Prepare stock by adding 50 mg of IBA powder to a 50-mL centrifuge tube and add a few drops of 1 N NaOH to dissolve it by stirring. Once completely dissolved, bring to volume with ultrapure water. Store at −20 °C for up to 6 months. 5. Rifampicin (33.3 mg/mL): To prepare, place 330 mg rifampicin powder in 10 mL of DMSO and allow rifampicin to dissolve by stirring. Filter-sterilize and divide in 1.5-mL Eppendorf tubes. Store at −20 °C for up to 6 months. 6. Streptomycin (100 mg/mL): To prepare, place 1 g of streptomycin powder in 10 mL of ultrapure water and allow streptomycin to dissolve by stirring. Filter-sterilize and divide into 1.5-mL Eppendorf tubes. Store at −20 °C for up to 6 months. 7. Kanamycin monosulfate (50 mg/mL): To prepare, place 500 mg of kanamycin monosulfate powder in 10 mL of ultrapure water, and allow kanamycin to dissolve by stirring. Filtersterilize and divide into 1.5-mL Eppendorf tubes. Store at −20 °C for up to 6 months. 8. Cefotaxime (100 mg/mL): The commercial product consists of 1 g of powder that has to be dissolved in 10 mL of ultrapure water and mixed vigorously. Store at −20 °C for up to 6 months (see Note 2). 9. Acetosyringone (20 mg/L): To prepare, place 100 mg of acetosyringone powder in 5 mL of ethanol absolute, and allow acetosyringone to dissolve by stirring. Filter-sterilize and store at −20 °C for up to 6 months. 10. Proline (200 mg/mL): To prepare, place 1 g of proline powder in 5 mL of ultrapure water, and allow proline to dissolve by stirring. Filter-sterilize and store at −20 °C for up to 6 months. 2.4

Media

After pH adjustment, all media should be autoclaved at the temperature of 121 °C and 1 bar pressure for 20 min. 1. Shoot-proliferating medium: 4.3 g/L of MS [17] micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic

Strawberry (Fragaria × ananassa)

221

acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 30 g/L of sucrose, 0.5 mg/L 6-BAP, 7.5 g/L of agar, pH 5.7. This medium can stand at room temperature for 2 weeks or store at 2–8 °C. 2. LB medium liquid and solid for Agrobacterium: 2.5 g/L of yeast extract, 5 g/L of tryptone, 5 g/L NaCl, 7.5 g/L Bacto agar (only for solid media), pH 7 (adjusted with NaOH). This medium can be stored at 4 °C for no more than 2 weeks. Antibiotics must be added after sterilization, as they are heat sensitive. Generally, kanamycin is added at a concentration of 50 mg/L, rifampicin 10 mg/L, and chloramphenicol 10 mg/L although concentration or type of selective antibiotics used depend on the type of genetic construct. 3. Leaf infection solution: 4.3 g/L of MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 20 g/L of sucrose, pH 5.2. Add proline and acetosyringone with a 1 μL/mL ratio depending on the amount of leaf infection solution required. These two last components are added after sterilization, as they are heat sensitive. The infection solution should be prepared fresh as required. 4. Agrobacterium-plant coculturing medium: Prepare solid medium containing 4.3 g/L of MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 30 g/L of sucrose, pH 5.7. Prepare a liquid solution with MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 20 g/L of sucrose, and after autoclaving, add proline and acetosyringone with a 1 μL/mL ratio. Add 500 μL of this liquid solution in a surface of solid medium previously poured in petri dishes. 5. Leaf tissue washing solution: Sterile H2O added with 500 mg/L cefotaxime. Prepare fresh as required. 6. Leaf explant regeneration and selection medium: 4.3 g/L of MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 30 g/L of sucrose, pH 5.7, 7.5 g/L plant agar, 200 mg/L of cefotaxime, 25 mg/L of kanamycin monosulfate (50 mg/mL stock). For Calypso cultivar, supplement this basal medium with 0.5 mg/L of TDZ and 0.01 mg/L of 2,4-D; for Sveva cultivar, 1 mg/L of TDZ and 0.1 mg/L of 2,4-D. 7. Rooting medium: 4.3 g/L of MS micro- and macroelements, 5 mg/L of pyridoxine, 5 mg/L of nicotinic acid, 20 mg/L of

222

Roberto Cappelletti et al.

glycine, 1,000 mg/L of myoinositol, 10 mg/L of thiamine, 30 g/L of sucrose, pH 5.7, 7.5 g/L of agar, 0.5 mg/L of IBA, 200 mg/L of cefotaxime, 25 mg/L of kanamycin monosulfate.

3

Methods The protocol includes three main steps: (1) the supply of plant material (in vitro proliferating shoots), (2) the Agrobacterium infection, and (3) the regeneration and selection of stable transformed “plantlets.”

3.1 Preparation of Strawberry Leaf Tissue

1. For each genotype start in vitro proliferating shoots by sterilizing lateral buds collected from runners (vegetative parts of the mother plant) and treating them with 2 % (v/v) chlorideactive solution for 20 min. 2. After rinsing 4–5 times with sterile distilled water, transfer the meristematic tissues to sterile glass tubes (length 11 cm) containing the shoot-proliferating medium, to let meristematic tissues develop and to generate shoots. 3. Incubate the proliferating shoots in growth chambers under 16 h at 70 μmol/m2/s and 8 h dark, at 24 ± 2 °C, and subculture regularly at 4-week intervals. 4. The transformation and regeneration experiments are carried out by using young expanded leaves detached from 4-weekold in vitro proliferating shoots, after a minimum of 4–5 subcultures from the initial explants. When detached, incise the leaf laminar on transversal rib and keep in distilled sterile water until starting the transformation experiment (see Notes 1–3).

3.2 Agrobacterium tumefaciens Preparation and Plant Tissue Infection

1. Agrobacterium tumefaciens strain is grown in LB solid medium containing kanamycin 50 mg/L, rifampicin 10 mg/L, and chloramphenicol 10 mg/L, in 90-mm-diameter petri dish, cultured at 4 °C and transferred every 1–2 months to a new LB solid medium. 2. Agrobacterium inoculation suspension can be prepared by using LB liquid medium added with the selecting and cleaning antibiotics: 50 mg/L kanamycin, 10 mg/L rifampicin, and 10 mg/L chloramphenicol. 3. Inoculate a small amount (one full handle) of Agrobacterium colonies from LB solid medium to a 50-mL Falcon tube containing 10 mL of LB liquid medium supplemented with 50 mg/L kanamycin, 10 mg/L rifampicin, and 10 mg/L chloramphenicol. 4. Seal the tubes with Parafilm and incubate the culture overnight at 28 °C on a shaker (100–150 rpm).

Strawberry (Fragaria × ananassa)

223

5. On the day of transformation experiment, quantify bacteria growth at the spectrophotometer. Take an amount of 100 μL of bacteria culture and 900 μL of LB liquid medium and put in 1 mL cuvette. The desired optical density (OD) value is approximately 0.8 at 600 nm, corresponding to an inoculum density of 108 bacterial cells per mL [28]. 6. To prepare the inoculum suspensions with the desired cell density (OD600 = 0.8), centrifuge bacteria suspension culture at 2,500 × g for 15 min, discard the supernatant, and resuspend the pellet in the infection solution (about 100 mL for each 1 OD value) to have a final resuspension solution of 50 mL which is normally sufficient for infecting 100–300 leaves. 7. To induce the virulence (vir) genes of Agrobacterium, use liquid leaf infected solution supplemented with proline and acetosyringone as described before, close the tubes with Parafilm and mix vigorously, and then put the tubes at 28 °C on a shaker (100–150 rpm) for 5 h in order to activate Agrobacterium cell division and virulence. 3.3 Explant Tissue Infection

1. Infection and cocultivation is the main step of leaf tissue transformation. When the detached and cut leaves are ready and maintained in sterile H2O to prevent drying, gently wash the leaves in 30 mL infection solution containing the Agrobacterium tumefaciens strain for 15 min at 100–150 rpm. 2. After infection the leaves are blotted with sterile filter paper and transferred to the Agrobacterium-plant coculturing medium for 48 h at 25 °C in dark condition. It is necessary to put the leaves with their inferior-abaxial side in contact with the medium. 3. At the end of the coculturing period, stop the infection by transferring the leaves to the washing solution for 5 h at 25 °C with shaking at 100–150 rpm.

3.4 Leaf Tissue Regeneration and Selection

1. The washed leaves are then blotted with sterile filter paper and placed on leaf explant regeneration and selection medium, always by keeping in contact with the medium the abaxial side of the leaf. 2. For strawberry, the highest leaf tissue regeneration response is promoted by a first period of incubation (2 weeks) at continuous dark and then under 16 h at 70 μmol/m2/s and 8 h dark, at 24 ± 2 °C. Leaf tissue has to be subcultured regularly at 2-week intervals on freshly prepared media. 3. At each subculture, the type of morphogenic activity that occurs for each explant should be monitored. Generally, yellow pale callus will form at the cut leaf edge around the end of the first subculture. After moved to light (16/8 photoperiod),

224

Roberto Cappelletti et al.

some callus cultures start to form green dot nodules, while the remaining parts display progressive necrosis. 4. The leaves bearing callus and green dot nodules are subcultured every 2 weeks on a freshly prepared regeneration and selection medium. Keep subculturing the leaf and callus tissues as long as it remains a proliferation and differentiation activity (up to 6 months). 5. When transplanting, detach the selectable green and elongated regenerated shoots (about 2–4 cm in size) from the callus tissues and transfer in glass tube (12-mm diameter) containing the shoot-proliferating medium supplemented with the selective agent (kanamycin 25 mg/L) and the decontaminant (cefotaxime 200 mg/L) antibiotic used in the regeneration medium. A larger number of isolatable regenerants generally occur at the second and third subculture (see Note 4). 6. The proliferation stage of the isolated shoots is another critical stage for the identification of stable homogenous transgenic lines. Again, 2–3 subcultures on the same proliferation medium supplemented with antibiotics are generally useful to identify the regenerated lines showing the more homogenous green tissues (see Note 5). The type of agar (plant agar or Gelrite) and their concentration inside the medium (from 7.5 to 7 g/L) could help to expose regenerating plant to the antibiotics in order to make the selection more efficient. 3.5 Rooting and Transplanting to Soil

1. Transfer the green stable proliferating lines on a rooting medium. A first proof of new stable putative transgenic lines is their ability to root in the presence of kanamycin. Usually plantlets start rooting after 3 weeks. Only regenerated shoots that are able to root on medium with kanamycin are considered new putative transgenic plants. A polymerase chain reaction (PCR) analysis can be performed for a first molecular confirmation of the transgenic event. 2. Before acclimatization, plants should be elongated both in epigeic and ipogeic part; the first step of acclimatization is generally critical, and only plants with a balanced development and an accurate humidity management can prevent shoot mortality and ensure an acclimatization rate of up to 80 %. An elongated phase in a medium without plant growth regulators could help to this purpose. Once plants have a balanced development, rooted shoots are transplanted into small pots, containing soil mix (Substrate 2, Klasmann-Deilmann GmbH©; see Note 6) for plant acclimatization, covered by a transparent cap allowing light to pass through and maintain the plants in the growth room in a high relative humidity condition (up to 90 %), temperature of 24 °C, 16-h photoperiod, and light intensity of 300 μmol/m2/s, in order to produce new roots and acclimatize plant.

Strawberry (Fragaria × ananassa)

225

3. After the first week, humidity should be reduced by removing the cover daily for 1 h, and gradually increase the time of acclimation to ex vitro conditions in the successive 4 weeks. 4. Acclimation and hardening of the plants should be performed either in a climatic box that provides temperature and humidity control or in the greenhouse. Generally, start the molecular characterization using PCR and Southern blot analysis of the transgenic events at this stage (see Note 7). 5. Transgenic clones are cultured in a greenhouse and/or transferred to open field trials depending on agronomic interest and with respect of the laws about genetically modified organism (GMO) experimental trials. Our greenhouse conditions are 25–30 °C, 16–18-h photoperiod, and an increasing light intensity from 500 to 1,400 μmol/m2/s. 6. At each cultivation cycle and for each clone, new plants are produced by vegetative propagation (runners) and used for starting the risk and benefit assessment at open field conditions, as requested for transgenic plants.

4

Notes 1. Experiment planning: Each experiment has to be carried out using young trifoliate strawberry leaves. 2. Experiment repetition: Plan at least three subsequent transformation experiments, with at least 50 or 100 leaf explants each, depending on the efficiency of the regeneration protocol. 3. It is of extreme importance to ensure sterile conditions for all experiment processes. 4. Each newly selected regenerant has to be identified with the corresponding leaf tissue origin. This leaf tissue can be maintained for other subsequent subcultures, but if other regenerating shoots will occur later, they can be isolated, but it is better to identify them as a subclone of the first regenerated shoot already isolated from the same explant. If both will grow stably on proliferation/selection medium, only the molecular characterization (Southern blot) can confirm their origin from different transformation events. If the regeneration and transformation protocols are really efficient, as soon as a regenerated shoot is isolated, the leaf explant can be discarded. 5. The identification and selection of greener stably proliferating and rooting shoots are fundamental aspects of the in vitro procedure to avoid the risk of selecting chimeric clones. 6. Blend of white and frozen through black sphagnum peat. Structure medium grade, optimum air to water ratio. pH 6

226

Roberto Cappelletti et al.

(H2O). Electrical conductivity 0.55 dS/m. Amount of added fertilizer (NPK14:16:18) 2 kg/m3. 7. To have a first molecular proof of the transformation event, a PCR analyses can be performed on isolated lines able to root on kanamycin. Southern blot molecular characterization can be performed on tissue of acclimatization plants. References 1. Mezzetti B (2003) Genetic transformation in strawberry and raspberry. In: Jaiwal PK, Singh RP (eds) Plant genetic engineering improvement of fruit crops, vol. 6. SCI Tech Publishing LLC, USA 2. Foucault C, Letouze R (1987) In vitro: regeneration des plant de Fraisier a partir de fragmentes de petiole et de bourgeons floraux. Biol Planta 29:409–414 3. Liu ZR, Sanford JC (1988) Plant regeneration by organogenesis from strawberry leaf and runner tissue. HortScience 23:1057–1059 4. Rugini E, Orlando R (1992) High efficiency shoot regeneration from calluses of strawberry (Fragaria x ananassa Duch.) stipules of in vitro shoot cultures. J Hortic Sci 67:577–582 5. Graham J, McNicol RJ, Greig K (1995) Transgenic apples and strawberries: advances in transformation, introduction of genes for insect resistance and field studies of tissue cultured plants. Ann Appl Biol 127:163–173 6. Passey AJ, Barrett KJ, James DJ (2003) Adventitious shoot regeneration from seven commercial strawberry cultivars (Fragaria x ananassa Duch.) using a range of explant types. Plant Cell Rep 21:397–401 7. Nehra NS, Chibbar RN, Kartha KK, Datla RSS, Crosby WL, Stushnoff C (1990) Genetic transformation of strawberry by Agrobacterium tumefaciens using a leaf disk regeneration system. Plant Cell Rep 9:293–298 8. Sorvari S, Ulvinen S, Hietarante T, Hiirsalmi H (1993) Pre-culture medium promotes direct shoot regeneration from micropropagated strawberry leaf disks. HortScience 28:55–57 9. El Mansouri L, Mercadi JA, Valpuesta V, Lopez-Aranda JM, Pliegi-Alfaro F, Quesada MA (1996) Shoot regeneration and Agrobacterium-mediated transformation of Fragaria vesca L. Plant Cell Rep 15:642–646 10. Haymes KM, Davis TM (1997) Agrobacteriummediated transformation of ‘Alpine’ Fragaria vesca and transmission of transgenes to R1 progeny. Plant Cell Rep 17:279–283 11. Balokhina NV, Kaliayeva MA, BuryanovYa I (2000) The elaboration of a shoot regenera-

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

tion system for the genetic transformation of the wild strawberry (Fragaria vesca L.). Biotekhnologiya 16:46–51 Jimenez-Bermudez S, Redondo NJ, MunozBlanco J, Caballero JL, Lopez-Aranda JM, Valpuesta V, Pliego-Alfaro F, Quesada MA, Mercado JA (2002) Manipulation of strawberry fruit softening by antisense expression of a pectate lyase gene. Plant Physiol 128: 751–759 Agius F, Gonzalez-Lamothe R, Caballero JL, Munoz-Blanco J, Botella MA, Valpuesta V (2003) Engineering increased vitamin C levels in plants by overexpression of a D-galacturonic acid reductase. Nat Biotechnol 21:177–181 Mezzetti B, Landi L, Pandolfini T, Spena A (2004) The DefH9-iaaMauxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry. BMC Biotechnol 4:4. http://www.biomedcentral. com/1472-6750/4/4 Qin Y, Jaime A, da Silva T, Zhang L, Zhang S (2008) Transgenic strawberry: state of art for improved traits. Biotechnol Adv 26:219–232 Oosumi T, Gruszewski HA, Blischak LA, Baxter AJ, Wadl PA, Shuman JL, Veilleux RE, Shulaev V (2006) High-efficiency transformation of the diploid strawberry (Fragaria vesca) for functional genomics. Planta 223:1219–1230 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 Barcélo M, El Mansouri I, Mercado JA, Quesada MA, Alfaro FP (1998) Regeneration and transformation via Agrobacterium tumefaciens of the strawberry cultivar Chandler. Plant Cell Tiss Org Cult 54:29–36 Huetteman CA, Preece JE (1993) Thidiazuron: a potent cytokinin for woody plant tissue culture. Plant Cell Tiss Org Cult 33:105–119 Bhagwat B, Lane WD (2004) In vitro shoot regenerations from leaves of sweet cherry (Prunus avium) ‘Lapins’ and ‘Sweetheart’. Plant Cell Tiss Org Cult 78:173–181 Meng RG, Chen THN, Finn CE, Li YH (2004) Improving in vitro plant regeneration

Strawberry (Fragaria × ananassa)

22.

23.

24.

25.

from leaf and petiole explants of ‘Marion’ blackberry. HortScience 39:316–320 Lamproye A, Hofinger M, Berthon JY, Gaspar T (1990) 3-(Benzo(b)selenienyl)acetic acid, a potent synthetic auxin in somatic embryogenesis. Comptes rendus Acad Sci Paris 311 (série III) 39:127–132 Landi L, Mezzetti B (2006) TDZ, auxin and genotype effects on leaf organogenesis in Fragaria. Plant Cell Rep 25:281–288 Qin YH, Teixeira da Silva JA, Bi JH, Zhang SL, Hu GB (2011) Response of in vitro strawberry to antibiotics. Plant Growth Regulator 65:183193 Husaini AM (2010) Pre- and post-agroinfection strategies for efficient leaf disk transformation

227

and regeneration of trasgenic strawberry plants. Plant Cell Rep 29:97–110 26. Zhang Q, Folta KM, Davis TM (2014) Somatic embryogenesis, tetraploidy, and variant leaf morphology in trasgenic diploid strawberry (Fragaria vesca subspecies vesca ‘Hawaii 4’. BMC Plant Biol 14:23 27. Bevan MW (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12:8711–8721 28. James D, Passey AJ, Barbara DJ (1990) Agrobacterium-mediated transformation of the cultivated strawberry (Fragaria x ananassa Duch.) using disarmed binary vectors. Plant Sci 69:79–94

Chapter 19 Walnut (Juglans) Charles A. Leslie, Sriema L. Walawage, Sandra L. Uratsu, Gale McGranahan, and Abhaya M. Dandekar Abstract Walnut species are important nut and timber producers in temperate regions of Europe, Asia, South America, and North America. Trees can be impacted by Phytophthora, crown gall, nematodes, Armillaria, and cherry leaf roll virus; nuts can be severely damaged by codling moth, husk fly, and Xanthomonas blight. The long generation time of walnuts and an absence of identified natural resistance for most of these problems suggest biotechnological approaches to crop improvement. Described here is a somatic embryo-based transformation protocol that has been used to successfully insert horticulturally useful traits into walnut. Selection is based on the combined use of the selectable neomycin phosphotransferase (nptII) gene and the scorable uidA gene. Transformed embryos can be germinated or micropropagated and rooted for plant production. The method described has been used to establish field trials of mature trees. Key words Agrobacterium tumefaciens, California black walnut, Eastern black walnut, Gene transfer, Juglans hindsii, Juglans nigra, Juglans regia, Paradox, Persian walnut, Somatic embryo

1

Introduction There are approx 20 species of walnut worldwide, many of which are valued for their nut production and timber quality. The principal species used for commercial walnut production, the Persian walnut (Juglans regia L.), is native to the mountain ranges of central Asia. It is now cultivated in many temperate regions including much of the Mediterranean, Central Asia, northern India, China, South Africa, Argentina, Chile, and Australia. In the United States, this crop is produced almost entirely in California, where orchard trees are grafted onto rootstock of either the native California black walnut (Juglans hindsii) or J. hindsii × J. regia hybrids known as Paradox. The eastern black walnut (Juglans nigra), native to the eastern United States, is highly valued for its timber quality and has been introduced into Europe and China for this purpose. Walnuts are susceptible to a number of insect, disease, and nematode problems. The key insect pest is codling moth (Cydia

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_19, © Springer Science+Business Media New York 2015

229

230

Charles A. Leslie et al.

pomonella L.), and Xanthomonas bacterial blight can cause substantial nut loss. Cherry leaf roll virus (blackline disease) is pollen disseminated and can kill grafted trees at full production. Rootstock diseases seriously impacting both nurseries and growers include crown gall disease (Agrobacterium tumefaciens), Phytophthora crown and root rots, and oak root fungus (Armillaria mellea). Nematodes are an increasingly serious problem in nurseries and in orchard establishment due to loss of available fumigants. Genetic resistance for most of these problems has not been clearly identified in walnut, and walnut breeding is a very lengthy process. Embryo rescue [1] and Agrobacterium-mediated transformation have both been used in attempting to address these pest problems. Walnut hybrids can be micropropagated for rootstock production [2], or Persian walnut cultivars can be produced on their own roots [3] to avoid graft costs and blackline disease. Repetitively embryogenic somatic embryo cultures can be produced easily from immature zygotic embryos [4] and with difficulty from immature catkins (unpublished data). Triploid walnuts have been produced from endosperm [5]. Agrobacterium-mediated transformation of walnut somatic embryos was first reported using marker genes [6, 7]. Subsequent work showed these methods could be applied to generate transgenic walnuts expressing a modified Bacillus thuringiensis gene for insect resistance [8, 9], the rolABC genes from A. rhizogenes for short internodes and altered root architecture [10], and RNAi constructs to inhibit crown gall formation [11]. More recently walnut plants with resistance to both nematodes and crown gall were developed by a co-transformation procedure employing two vectors simultaneously [12]. A number of additional genes that were successfully transformed into and expressed in walnut did not produce useful phenotypes including the LFY gene from Arabidopsis, the GNA snowdrop lectin gene, and the Xa21 Xanthomonas resistance gene from rice (McGranahan and Dandekar, unpublished data). The protocol detailed here is based on our experience using repetitively embryogenic walnut somatic embryo cultures. New somatic embryos develop from single epidermal cells on existing embryos [13]. This process automatically eliminates any chimeras so non-chimeral transformants can be selected by picking from second-generation embryos. We used both the neomycin phosphotransferase (nptII) as a selectable marker and the uidA gene as a scorable marker. Nontransformed embryos multiply poorly and generally develop bad form and a yellowish color on kanamycincontaining medium. Embryos which multiply well and appear healthy on kanamycin can be checked for β-glucuronidase (GUS) activity using X-glucuronidase staining [14] or green fluorescent protein (GFP) fluorescence [15]. Transformed embryos can be germinated following desiccation [16]. This method has also been used to transform eastern black walnut [17] and pecan [18].

Walnut (Juglans)

231

Transformation efficiency (the percent of initially treated embryos [E0] that produce one or more non-chimeric transformed second-generation [E2] embryos which continue to be embryogenic) is approx. 20–25 % [7, 9]. Bacterial overgrowth can sometimes be a problem and embryo germination rates are relatively low. The latter may be circumvented by micropropagating transformed epicotyls and either rooting the resulting microshoots or budding them to seedling rootstocks [19].

2 2.1

Materials Plant Material

2.2 Transformation Vectors and A. tumefaciens Strains

Immature walnuts of the variety or species of interest, preferably harvested 6- to 10-week post anthesis, or previously established walnut somatic embryo cultures. 1. A. tumefaciens strains that work efficiently for walnut are the disarmed derivatives like EHA101 [20, 21] of the tumorigenic A281 strain that harbors the Ti plasmid pTiBo542 and the nonpathogenic strain C58C1 [21, 22] which contains a disarmed version of the tumorigenic Ti plasmid pTiC58 (see Note 1). 2. The binary system for walnut transformation is completed with the introduction of broad host range binary plasmids that contained the desired T-DNA region. For this we use derivatives of binary plasmids described by McBride and Summerfelt [23]. These derivatives have been exclusively used for the Agrobacterium-mediated transformation protocol described here. This binary contains the selectable marker gene APH(3) II for kanamycin resistance and has been modified to contain the scorable marker gene uidA encoding GUS (see Note 1). Binary vectors can be introduced into Agrobacterium strains by a number of methods such as electroporation or freeze/ thaw (see Note 2).

2.3

Stock Solutions

1. Kanamycin sulfate (50 mg/mL): Dissolve 5 g kanamycin sulfate powder in 100 mL of water, filter-sterilize, and freeze in 10–15 mL aliquots in 25 mL screw-cap vials. 2. Gentamicin sulfate (25 mg/mL): Dissolve 250 mg gentamicin sulfate powder in 10 mL of water, filter-sterilize, and store frozen. 3. Timentin (100 mg/mL): Dissolve 6.2 g (two 3.1 g bottles) of timentin powder in 62 mL of water, filter-sterilize, and freeze in 10–15 mL aliquots in 25 mL screw-cap vials. 4. Hygromycin B (12.5 mg/mL): Dissolve 125 mg hygromycin B powder in 10 mL of water, filter-sterilize, and store frozen (see Note 3).

232

Charles A. Leslie et al.

5. Acetosyringone: Dissolve acetosyringone (3,5-dimethoxy-4′hydroxyacetophenone) in ethanol to make a 100 mM (19.6 mg/mL) solution. Do this in a capped centrifuge tube and vortex so the ethanol does not evaporate. Seal the top well with Parafilm or plastic wrap to prevent evaporation and store at room temperature. 6. Proline (100 mg/mL): Dissolve the powder in water, filter-sterilize, and store at 4 °C. 7. X-Gluc staining solution: Dissolve 5-bromo-4-chloro-3indolyl glucuronide (X-Gluc) in dimethylformamide to make a 0.3 % (w/v) solution. Dilute with 100 mM sodium phosphate buffer (pH 7.0) containing 0.006 % Triton X-100 and 0.5 mM K + Fe cyanide to make a 1 mM X-Gluc working solution. Filter-sterilize and store refrigerated. Keep for at least 1 year. 8. Indole-3-butyric acid (IBA): Dissolve IBA potassium salt (K-IBA) in water to give a 0.1 mg/mL stock solution. 9. 6-Benzylaminopurine (BAP): Dissolve BAP powder in a few drops of 1 N KOH and dilute to volume with water to give a 1 mg/mL BAP stock solution. 2.4

Media

1. Driver–Kuniyuki walnut (DKW) basal medium (Sigma; cat. no. D6162; PhytoTechnology Laboratories cat. no. D2470): Dissolve DKW powder in 30 g/L sucrose in water, dilute to volume, adjust pH to 5.5, add 2.1 g/L Gelzan® (Caisson Labs), Gelrite® (Merck), Phytagel® (Sigma), or other brand of gellan gum to solidify, autoclave, and pour in 100 × 15 mm Petri plates. 2. Agrobacterium liquid growth medium: Use either 523 [24] medium or Luria–Bertani (LB) [25] medium: (a) 523 medium: 10 g/L sucrose, 8 g/L casein hydrolysate, 4 g/L yeast extract, 2.0 g/L K2HPO4⋅3H2O, and 0.15 g/L MgSO4 in distilled water. Adjust pH to 7.1 and autoclave. (b) LB medium: 10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl in distilled water. Adjust pH to between 6.8 and 7.2 and autoclave. 3. Agrobacterium growth plates (523 or LB): Prepare medium as described above adding appropriate antibiotics for the vector used and 15 g/L Bacto agar to solidify. Autoclave and pour in 100 × 15 mm Petri plates. 4. Virulence induction medium (IM): Prepare 100 mL or more liquid DKW basal medium containing 30 g/L sucrose, 100 μM acetosyringone, and 1 mM proline. Adjust pH to 5.2 and filter-sterilize. Store in refrigerator in sterile 50 mL capped centrifuge tubes.

Walnut (Juglans)

233

5. Acetosyringone medium (AS) plates: Prepare DKW basal medium containing 30 g/L sucrose and 100 μM acetosyringone. Adjust pH to 5.5, add 2.1 g/L Gelrite, autoclave, and pour in 100 × 15 mm Petri plates (see Note 4). 6. KAN/TIM selection medium: Prepare basal DKW with 30 g/L sucrose, adjust pH to 5.5, dispense into 1 L screw-cap bottles (500 mL/bottle), add 1.05 g Gelrite® to each bottle, autoclave, and cool to 60 °C in a water bath. Then add 200 mg/L pH adjusted (see Note 5), filter-sterilized kanamycin and 200 mg/L filter-sterilized timentin (see Note 6). Mix thoroughly and pour into sterile 100 × 15 mm Petri plates. When solidified, store refrigerated in the original plastic sleeves until ready for use. 7. KAN only selection medium: The same medium as KAN/TIM selection medium but without the timentin. 8. DKW shoot medium: Dissolve DKW basal medium powder and 30 g/L sucrose in water and add 1 mg/L BAP and .01 mg/L IBA, dilute to volume, adjust pH to 5.5, and add 2.1 g/L Gelzan® (Caisson Labs), Gelrite® (Merck), Phytagel® (Sigma), or other brand of gellan gum to solidify. Microwave until the medium boils, mix thoroughly on a stir plate, dispense into Magenta Corporation GA7 vessels (approx 30 mL of medium each), and autoclave. 2.5 Other Supplies and Chemicals

1. Sterile empty 100 × 15 mm Petri plates. 2. Sterile disposable 50 mL screw-cap centrifuge tubes. 3. Sterile disposable cotton-plugged 10 mL pipette. 4. Pipettors with sterile 1 mL and 200 μL tips. 5. Sterile disposable 6-well Multiwell plates. 6. Sterile disposable 96-well Multiwell plates. 7. Filter paper or paper toweling disks cut to fit in 100 × 15 mm Petri plates and autoclaved. 8. Filter paper or paper toweling disks cut to the diameter of the wells of a 6-well plate and autoclaved. 9. 150 mm diameter desiccator (Nalgene; cat. no. 5315–0150). 10. Saturated ZnSO4 or NH4NO3 solution. 11. Driver Kuniyuki walnut (DKW) basal medium with vitamins (PhytoTechnology Laboratories cat. no. D2470). 12. Magenta GA-7 vessels (Magenta Corp., Chicago, IL). 13. Ray Leach Cone-tainer SC-10 Super Cells (Hummert Corp).

234

3

Charles A. Leslie et al.

Methods

3.1 Initiate or Obtain Actively Multiplying Walnut Somatic Embryo Cultures

1. Surface-sterilize immature intact walnuts in 15 % Clorox® (6 % sodium hypochlorite) for 10–15 min and rinse in sterile water. 2. Remove the zygotic embryos from the walnuts. To do this for Persian walnuts, hold the nut with the blossom end up. Cut 1 or 2 mm into the issue with a scalpel several mm above the midpoint (equator) and continue this cut all the way around the nut. Twist the blade slightly to flip the blossom end off. The embryo will be exposed in the center and can be excised with a scalpel. For other species of walnut, shell hardening will normally occur before the embryo is visible, but embryos can be extracted by cracking the nuts in a vice. Embryos can be most easily located and extracted if nuts are placed in the vice with the blossom end up, the suture perpendicular to the face of the vice, and then cracked using gentle pressure. 3. Culture zygotic embryos on basal DKW medium. Culture 1–5 embryos per plate, depending on the embryo size. Leave 1–2 cm of space between embryos to facilitate rescue of clean embryos if one is contaminated during excision. Place the embryos on the surface, not in the medium. The orientation is not critical, but once established transfer embryos in the same orientation so the same surface is always on the medium. Place in the dark at room temperature. 4. If discoloration due to phenolic leakage occurs, transfer to fresh medium daily until it stops and then weekly until somatic embryogenesis is observed. Continue to transfer every 1–2 weeks, allowing embryos to multiply until enough material is available to proceed.

3.2 Agrobacterium Preparation

1. Streak Agrobacterium from glycerol stock onto a 523 or LB plate with appropriate antibiotics for the vector used. Incubate at 28–30 °C for 2 days or until good bacterial growth occurs. Then store refrigerated if a longer time period is required before use. 2. For each construct to be used, inoculate liquid cultures (one or two 50 mL conical tubes with approx 20 mL each liquid 523 or LB medium) with a loop of bacteria from the plates and place the capped tubes on a rotary shaker at moderate speed (200 rpm) at room temperature (about 25 °C). 3. After approx 2 h, add the appropriate selective antibiotics for the vector used and return to shaker. 4. After shaking overnight the bacterial cultures should be turbid. Determine the A600 by reading a 1:10 diluted sample in a spectrophotometer.

235

Walnut (Juglans)

5. Calculate the amount of Agrobacterium culture to be used to obtain the desired volume of cocultivation suspension at the desired bacterial concentration (an A600 reading of 0.5 is equivalent to 2.5 × 108 bacteria/mL) using the following formula:

( Amount

of suspension wanted ) ´ ( A600 of desired conc.)

( A600

reading you get ) ´ dilution factor

.

Example: You want to make 25 mL of cocultivation solution at a concentration of 2.5 × 108 bacteria/mL. You used a 1:10 dilution in the spectrophotometer and got a reading of 0.371. How much of the original culture do you need?

( 25 mL ) ´ ( 0.5) = 3.36 mL. ( 0.371) ´ 10 6. If performing co-transformation, mix the two bacterial cultures in a 1:1 ratio before preparing the final volume (see Note 7). 7. Using a sterile pipette, place the calculated volume of culture solution into a sterile plastic-capped 50 mL centrifuge tube and centrifuge sufficiently to lightly pellet the bacteria (e.g., 10 min at 4,000 × g). 8. Pour or pipette the supernatant into an autoclavable waste container and resuspend the pellet in the cocultivation medium. The pellet is easier to resuspend in a small volume (0.5 mL first) using a pipette tip. Then add the full volume. If needed, set up a tube for a no-bacteria control using only cocultivation medium. 9. Return the tubes to the shaker until ready to use. 3.3

Cocultivation

1. Based on the number of genotypes to be transformed and the number of vectors employed, determine the number of total treatments. 2. Put sterile filter paper or paper towel disks in the bottom of the appropriate number of wells in 6-well Multiwell plates. This will make it easier to remove small embryos after cocultivation. 3. Select actively growing somatic embryos of the genotypes to be used and for each vector to be used with that genotype, fill a well ½ to 2/3 full of embryos (see Note 8). 4. Dispense the appropriate Agrobacterium cocultivation suspension into each well using sterile 10 mL pipettes with cottonplugged ends (see Note 9). Allow to sit for at least 10–15 min or longer until ready for the next step (see Note 10). 5. Place sterile filter paper or paper towel disks in empty sterile Petri plates—one for each treatment—and label them.

236

Charles A. Leslie et al.

6. Remove as much excess cocultivation liquid as possible from each well to an autoclavable waste container. Pipetting with a 1 mL sterile tip works well. Keep the tip against the side to avoid plugging with small embryos. To avoid any cross contamination from splashing, a sterile waste container—such as a Magenta container or small sterile jar—for each construct is useful. 7. Transfer the embryos from the wells to the Petri plates. The larger embryos can be picked up with sterile forceps. Then carefully pick up the filter paper in the well with two forceps and set the whole thing on the dry paper in the Petri plate. This blots off additional excess liquid. 8. Transfer the embryos (about 10/plate—keep them well spread out) to plates of AS medium and place in the dark for 48 h at 20–22 °C. 3.4 Selection on Kanamycin or Hygromycin

1. After cocultivating for 48 h, transfer the embryos to plates of KAN/TIM or HYG/TIM selection medium containing 200 mg/L kanamycin or 25 mg/L hygromycin (see Note 11) combined with 200 mg/L timentin (see Note 12). Incubate the culture plates in the dark at room temperature. 2. Transfer embryos to fresh KAN/TIM medium after another 48 h and again after the first wk. This helps to reduce bacterial overgrowth. Then transfer weekly for 8–12 weeks. 3. As new somatic embryos begin to emerge, separate them from the parent (E0) embryos. Label these as E1 embryos. Repeat this process for one more generation (E2 embryos). 4. After 6–8 weeks of selection, embryos can be moved to selection medium containing only the kanamycin or hygromycin. Removing the timentin at this point ensures that the embryos no longer have any residual Agrobacterium and avoids unnecessary expense for timentin.

3.5 Scoring for GUS Expression

1. As E2 embryos emerge, test them for GUS (uidA) activity. 2. Pipette 40 μL of X-Gluc working solution into wells of a sterile 96-well Multiwell plate. 3. Using a fine-point scalpel or by twisting off with a pair of forceps, remove a small piece of tissue (cotyledon tips work well) from each well-formed and healthy E2 embryo of interest. Put the tissue piece in the X-Gluc and label and mark the location of the embryo from which it was excised. 4. Watch for blue color. Color change should be apparent in 10 min–2 h. 5. If tissue turns blue, propagate more somatic embryos from the tested E2 embryo (see Note 13).

Walnut (Juglans)

3.6 PCR Confirmation of Gene Insertion

237

1. Select GUS-positive, actively proliferating E2 embryos from each embryo line for DNA isolation. 2. Isolate total DNA using a DNeasy Plant Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocols. 3. Perform PCR using 2.5 μL 10× PCR buffer containing 1.5 mM MgCl2 (Applied Biosystems, Foster City, CA), 1.25 μL of each primer, 0.5 μL dNTPs, and 0.2 μL Taq DNA polymerase (Applied Biosystems). 4. Primers for detection of nptII are (5′ → 3′): (a) Aph3: ATGATTGAACAAGATGGATTGCACGCA (b) Aph4: GAAGAACTCGTCAAGAAGGCGATAGA 5. Carry out amplifications in a GeneAmp PCR System 9700 (Applied Biosystems, Foster City, CA), pre-cycling for 2 min at 94 °C, followed by 40 cycles of 1 min at 94 °C, 1 min at 60 °C, and 1 min at 68 °C. 6. Electrophorese PCR products using 0.8 % agarose gel, stained with SYBR safe DNA gel stain, and visualize with a UV illuminator. 7. Bands showing at 790 bp are indicative of nptII gene insertion.

3.7 Germination and Plant Production

After sufficient additional somatic embryos have developed, desiccate some to initiate germination. Choose well-formed somatic embryos and place them in 35 × 10 mm sterile Petri plates with no medium. Cover the plates but leave unsealed (do not wrap with Parafilm) and place them in the dark at room temperature on the rack of a well-sealed desiccator containing 10–15 mL of saturated ZnSO4 or NH4NO3 in the bottom. 1. After 2–7 days, when the embryos become opaque white with the consistency of popcorn but before they brown, remove the embryos from the desiccator and place them on DKW shoot medium in Magenta GA-7 vessels or glass jars with similar headspace. Culture at room temperature under cool white fluorescent lights (16 h/day photoperiod, approx 100 μmol/ m2/s) for 2–8 weeks. 2. Most embryos will produce roots, but typically fewer than 10 % of embryos develop shoots. Roots will usually emerge from embryos in a week to 10 days. A few shoot buds may also begin to push quickly. In this case, the plants should be removed from the medium as soon as possible and planted in potting soil. If the embryos are left on the shoot medium, the roots begin to deteriorate but more shoot buds will push. These can be excised and micropropagated. Alternatively embryos can be placed on shoot medium for 1 week to initiate

238

Charles A. Leslie et al.

germination and then transferred to DKW basal medium. This will not push as many shoots but will give more intact plants. 3. Embryos that develop both shoots and roots can be transplanted to any well-drained potting soil, for example, UC Mix (25:42:33 % sand–fir bark–peat moss). Plant in a container that drains well, for example, Super Cell (8.5 × 1.5 in.) containers from Hummert. Plastic cups with holes punched in the bottoms work for small numbers. 4. To acclimatize, keep plants at 100 % humidity for 2 weeks and then gradually reduce the humidity. Covering small pots with plastic bags works well for small numbers. Then gradually open the bags over a 2-week period by creating small holes and then enlarging them, until the plants are fully acclimated. For larger numbers, place potted plants in a fog (not mist) chamber for 2 weeks and then keep moist (fog if possible) on an open bench and reduce humidity gradually over the next 2 weeks. Water and fertilize daily with half-strength Hoagland’s solution, Miracle-Gro®, or other commercially available complete fertilizer. Keep plants under 16 h photoperiod at 25–28 °C. If under artificial light, provide as much light as possible. If in the greenhouse, whitewash the glass or provide shade cloth during the summer. 5. Established plants can be repotted to larger containers as needed and maintained in a greenhouse or lath house.

4

Notes 1. Walnut is susceptible to wide variety of Agrobacterium strains. This was discussed in an earlier publication [23] where we showed the susceptibility of walnut vegetative tissues to a variety of strains. Among the strains that are particularly infective are the derivatives of A281, A6, and C58. We have used mainly the disarmed versions of A281 and C58 in all of our transformation experiments. With the exception of apical meristems, we found most vegetative tissues quite susceptible to the infection with Agrobacterium including somatic embryos; the latter was noted in our earlier publication [6]. The nptII gene works when higher concentrations of kanamycin are used, typically 100 μg and above. Lower concentrations do not work particularly well. Because of the weak selection with kanamycin and the variability in the efficiency of transformation this may produce, we used GUS to confirm the transformants. Among the GUS constructs, the gene that contains an intron has the least background, but the others work as well too. 2. We use electroporation to introduce DNA into Agrobacterium. Briefly, 1 μL of plasmid DNA (10–100 ng) is added to

Walnut (Juglans)

239

Agrobacterium competent cells. The mixture is placed on ice for 2 min before being transferred to a precooled 0.2 cm electroporation cuvette (Bio-Rad). Apply voltage with settings at 2.5 kV (field strength), 25 μF (capacitance), and 400 Ω (resistance) at time constants of 8–12 m/s. One milliliter of YEPrich media is added to the electroporated cell/DNA mixture. Incubate it with shaking at room temperature for 45 min and then plate on selective media. 3. Hygromycin B can serve as an alternative selectable marker in place of kanamycin or as a second selectable marker if performing co-transformation to insert two genes simultaneously. 4. The 100 mM acetosyringone stock should be at room temperature. Be sure it is in suspension. If it has been cold, you may need to warm it in warm water and vortex briefly to resuspend. To make 100 μM acetosyringone medium (AS medium), add this stock to DKW basal medium before autoclaving. 5. Kanamycin sulfate in solution has a very high pH. If used at a concentration greater than 100 mg/L for selection, the kanamycin begins to raise the pH of the medium, altering the salt solubility and gelling properties. For this reason, one may prefer to adjust the pH of the kanamycin stock solution to 5.5. To do so, dissolve the kanamycin powder in water to about half the desired final volume, adjust to pH 5.5 using 1 N HCL, and dilute with water to final volume. 6. Both cefotaxime and carbenicillin were tried initially. Carbenicillin showed an auxin-like effect that reduced embryo quality and its use was abandoned. Cefotaxime actually improves both the quality and the multiplication rate of nontransformed embryos but is not used for routine culture because of expense. Subsequently timentin has proven more effective in suppressing Agrobacterium and is now the preferred antibiotic for this purpose when transforming walnut somatic embryos. 7. When using co-transformation to simultaneously insert two genes, follow the procedures in Subheading 3.2 to prepare each bacterial culture separately. Then mix the two cultures in a 1:1 ratio based on bacterial concentration. We tried mixing in a 3:1 ratio, but the 1:1 ratio gave higher transformation efficiency. Co-transformation requires a different selectable marker in each vector used (e.g., kanamycin in one vector and hygromycin in the other) or a selectable marker in one vector and selection by PCR for the second trait. If both vectors carry the same selectable marker, it is not possible to use that marker to identify embryos with both genes of interest. 8. It is helpful to pick out embryos to use ahead of time and place them on plates of DKW basal medium. This will give you an

240

Charles A. Leslie et al.

idea of how many you will have to work with before you get too far into the rest of the work. If you need more, wait another wk or lower your selection standards. To achieve the best transformation efficiency, it is important to use rapidly multiplying embryos. Embryos multiply continuously and a culture will have a mixture of all sizes, ages, and qualities of embryos. If you want to measure transformation rates and timing or otherwise need uniform initial material for experimental purpose, choose small, white (2–5 mm) embryos of good somatic embryo form (two visible cotyledons) and semitranslucent rather than ivory white opaque appearance. This gives starting material that is distinct and can be counted easily, and these embryos will continue to multiply well. Opaque white embryos often move toward germination and produce fewer new embryos. Once you have selected the embryos, distribute them equally across treatments. Mark one or more plates for each treatment and then select similar sets of embryos to be used for each treatment. Continue this process until all the embryos are assigned to a treatment. Be very careful with your sterile technique because you can contaminate everything during this process. If the goal is only to obtain some transformants, use any rapidly multiplying embryo culture material except browning older embryos. 9. Do this soon after placing embryos in the wells so they don’t dry out. Use enough medium to cover the embryos (approx 8 mL/well) if you have enough; otherwise, distribute the medium over the embryos so they all get wet. Label carefully and be sure to avoid cross contamination. You may want to use a different plate for each vector. 10. Physical wounding is not necessary and is, in fact, detrimental to successful transformation. Wound sites develop callus rather than new somatic embryos. 11. We tested the efficiency of applying kanamycin immediately after cocultivation vs applying at a later stage. Early application gave a better yield of transformants. Appropriate kanamycin and hygromycin concentrations were determined by performing kill curves on untransformed embryos (unpublished data). 12. Transfer embryos in a consistent pattern on each plate so that if resistant bacteria begin to multiply, they are not moved to all the embryos on the plate. 13. The X-Gluc is not always toxic. If you use a filter-sterilized X-Gluc solution, dispense it into sterile wells, and return the tissue to selection medium as soon as the blue color becomes apparent, then tissue pieces that turn blue can sometimes themselves develop embryogenic cultures in addition to using the embryo from which it was excised.

Walnut (Juglans)

241

References 1. McGranahan GH, Tulecke W, Arulsekar S, Hansen JJ (1986) Intergeneric hybridization in the Juglandaceae: Pterocarya sp. x Juglans regia. J Am Soc HortSci 111:627–630 2. Driver JA, Kuniyuki AH (1984) In vitro propagation of Paradox walnut (Juglans hindsii x Juglans regia) rootstock. HortSci 19:507–509 3. McGranahan GH, Leslie CA, Driver JA (1988) In vitro propagation of mature persian walnut cultivars. HortSci 23:220 4. Tulecke W, McGranahan GH (1985) Somatic embryogenesis and plant regeneration from cotyledons of walnut, Juglans regia L. Plant Sci (Limerick) 40:57–64 5. Tulecke W, McGranahan GH, Ahmadi H (1988) Regeneration by somatic embryogenesis of triploid plants from endosperm of walnut, Juglans regia L. cultivar ‘Manregian.’. Plant Cell Rep 7:301–304 6. McGranahan GH, Leslie CA, Uratsu SL, Martin LA, Dandekar AM (1988) Agrobacterium mediated transformation of walnut somatic embryos and regeneration of transgenic plants. Nat Biotechnol 6:800–804 7. McGranahan GH, Leslie CA, Uratsu SL, Dandekar AM (1990) Improved efficiency of the walnut somatic embryo gene transfer system. Plant Cell Rep 8:512–516 8. Dandekar AM, McGranahan GH, Vail PV, Uratsu SL, Leslie C, Tebbets JS (1994) Low levels of expression of wild type Bacillus thuringiensis var. Kurstaki cryIA(c) sequences in transgenic walnut somatic embryos. Plant Sci 96:151–162 9. Dandekar AM, McGranahan GH, Vail PV, Uratsu SL, Leslie CA, Tebbets JS (1998) High levels of expression of full-length cryIA(c) gene from Bacillus thuringiensis in transgenic somatic walnut embryos. Plant Sci 131:181–193 10. Vahdati K, McKenna JR, Dandekar AM et al (2002) Rooting and other characteristics of a transgenic walnut hybrid (Juglans hindsii x J. regia) rootstock expressing rolABC. J Am Soc HortSci 127:724–728 11. Escobar MA, Leslie CA, McGranahan GH, Dandekar AM (2002) Silencing crown gall disease in walnut (Juglans regia L.). Plant Sci 163:591–597 12. Walawage SL, Britton MT, Leslie CA, Uratsu SL, Li Y (2013) Stacking resistance to crown gall and nematodes in walnut rootstocks. BMC Genomics 14:668 13. Polito VS, McGranahan GH, Pinney K, Leslie C (1989) Origin of somatic embryos

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

from repetitively embryogenic cultures of walnut (Juglans regia L.)—implications for Agrobacterium-mediated transformation. Plant Cell Rep 8:219–221 Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5:387–405 Escobar MA, Park J-I, Polito VS et al (2000) Using GFP as a scorable marker in walnut somatic embryo transformation. Annal Bot (London) 85:831–835 Leslie C, McGranahan G, Mendum ML (1997) Genetic engineering of walnut (Juglans regia L.). In: Gomes Pereira JA (ed) Acta horticulturae. ISHS, Alcobaca, Portugal, pp 33–41 Bosela MJ, Smagh GS, Michler CH (2004) Genetic transformation of black walnut (Juglans nigra). In: Michler CH (ed) Black walnut in a new century: proceedings of the 6th walnut council research symposium. North Central Research Station, Forest Service, USDA, Lafayette, IN, pp 45–58 McGranahan G, Leslie CA, Dandekar AM, Uratsu SL, Yates IE (1993) Transformation of pecan and regeneration of transgenic plants. Plant Cell Rep 12:634–638 Reil WO, Leslie CA, Forde HI, McKenna JR (1998) Propagation. In: Ramos DE (ed) Walnut production manual. Division of Agriculture and Natural Resources, University of California, Oakland, CA, pp 71–83 Hood EA, Helmer GL, Fraley RT, Chilton MD (1986) The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside the T-DNA. J Bacteriol 168:1291–1301 Dandekar AM, Martin LA, McGranahan GH (1988) Genetic transformation and foreign gene expression in walnut tissue. J Am Soc HortSci 113:945–949 Van Larebeke N, Engler G, Holsters M, den Elsacker V, Zaenen I, Schilperoort RA, Schell J (1974) Large plasmid in Agrobacterium tumefaciens essential for crown gall-inducing ability. Nature 252:169–170 McBride KE, Summerfelt KR (1990) Improved binary vectors for Agrobacterium-mediated plant transformation. Plant Mol Biol 14: 269–276 Rodriguez RL, Tait RC (1983) Recombinant DNA techniques: an introduction. Benjamin Cummings, Menlo Park, CA Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning—a laboratory manual. Cold Spring Harbor Press, Cold Spring Harbor, NY

Part IV Tropic Plants

Chapter 20 Citrus Transformation Using Juvenile Tissue Explants Vladimir Orbović and Jude W. Grosser Abstract The most frequently used method for production of citrus transgenic plants is via Agrobacterium-mediated transformation of tissues found on explants obtained from juvenile seedlings. Within the last decade and especially within the last 5–6 years, this robust method was employed to produce thousands of transgenic plants. With the newly applied screening methods that allow easier and faster detection of transgenic shoots, estimates of transformation rate for some cultivars have gone up making this approach even more attractive. Although adjustments have to be made regarding the (varietal) source of the starting material and Agrobacterium strain used in each experiment preformed, the major steps of this procedure have not changed significantly if at all. Transgenic citrus plants produced this way belong to cultivars of rootstocks, sweet oranges, grapefruits, mandarins, limes, and lemons. Key words Agrobacterium tumefaciens, Citrus, Genetic transformation, Juvenile tissue

1

Introduction Researchers have found many applications for Agrobacteriummediated transformation of citrus. Out of two methods of transformation using stem explants as a starting material, the one based on juvenile tissue is far more prevalent and efficient than the method based on mature tissue. The latter will be discussed in details in Chapter 21. As a reflection of the present state of citrus industry worldwide, most of the efforts invested in production of genetically modified citrus are directed toward improvements of tolerance to citrus diseases [1–8]. However, a plethora of genes were introduced into citrus plants for the purpose of improvement of tolerance to environmental stress [9–11], manipulation of hormonal balance [12, 13], alteration in development [14, 15], and even changes in fruit flavor [16, 17]. In the previous edition of this chapter [18], the availability of starting material was stated as a major advantage for this method over the use of mature tissue explants. That statement still stands firm. Extraction of seeds from fruit, seed processing, and their

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_20, © Springer Science+Business Media New York 2015

245

246

Vladimir Orbović and Jude W. Grosser

successful germination under sterile conditions result in production of ample quantities of explants for co-incubation with Agrobacterium. Correct preparation of needed media and Agrobacterium culture(s) accompanied with the proper handling of explants will yield a crop of transgenic citrus shoots, and the success rate will mostly be determined by the genetic background of the cultivar used. Until recently, β-glucuronidase (GUS) assays [19] were used frequently to screen for transgenic shoots. In our facility, for the last 4 years we did not use GUS assay. Most of the shoots produced had either green fluorescent protein (GFP; [20]) as a reporter gene or no reporter gene at all. Shoots carrying the active gfp gene are selected by visual inspection under the fluorescent microscope. For the experiments where shoots without any reporter gene were being produced, they were screened with the PCR-based method. Minute amount of shoot tissue is used as a source of template in the PCR reaction representing the first round of selection. Shoots selected as putatively positive are grafted and grown until enough tissue can be harvested from leaves for genomic DNA (gDNA) extraction so that second round of PCR selection can be performed. Only plants that provide a source of template resulting in positive PCR in both rounds are considered transgenic. PCR-based screening allows detection of inserted sequences within the host’s genome without interference of expression controlling factors that can sometimes hinder function of reporter genes that are used for selection of transformed shoots. For that reason, we have seen the increase in transformation success rate compared to period when we used only reporter gene-based screening. Transgenic citrus plants produced with this method take 5–6 years to flower and fruit due to the juvenile nature of explants used as starting material. A trait improvement in any citrus plant due to introduction of transgene can be approved/accepted only if it does not interfere with the fruit and juice quality. A protracted period of time needed before evaluation of commercial traits of transgenic citrus fruit calls for acceleration of this process through definition of new method that will make these plants flower earlier. Despite this drawback, production of transgenic citrus plants with the use of juvenile stem explants remains a very popular way of getting relatively quickly high number of transgenic plants to be tested in the “proof-of-concept” experiments for different trait improvements. It is an efficient and non-expensive method that can be adopted by most laboratories in the world without substantial financial and labor investment.

2 2.1

Materials Plant Material

1. Seeds are obtained by extraction from harvested fruit. Extraction can be facilitated with the use of a citrus juicer (see Note 1). Seeds of rootstocks are also available for sale from

Citrus Transformation Using Juvenile Tissue Explants

247

specialized nurseries. For these experiments, seeds from “Duncan” grapefruit (Citrus × paradisi) were used. 2. Stems of etiolated plants germinated from seeds are cut into segments that are 15–20 mm in length and represent material that will be used for incubation with Agrobacterium. 2.2 Agrobacterium Strain and Plasmid

1. Multiple strains of Agrobacterium are used in our facility. For the experiment described in this chapter, EHA105 [21] was used. 2. The binary vector called pX20 was mobilized into EHA105 strain (see Note 2). Information about the gene within the vector is proprietary and the vector itself is the derivative of pBI121 (originally available from Clontech Laboratories, Mountain View, CA).

2.3 Media and Stock Solutions

1. 1× Murashige and Skoog (MS) [22] basal medium. 2. 1× MS basal salt mixture. 3. 100× Murashige and Tucker (MT) [23] vitamin stock: 10 g/L of myoinositol, 1 g/L of thiamine HCl, 1 g/L of pyridoxine HCl, 0.5 g/L of nicotinic acid, and 0.2 g/L of glycine. Dissolve in water and store at 4 °C. 4. Seed germination medium: 1× MS basal medium with 25 g/L of sucrose and 8 g/L of agar, pH 5.8. Glass tubes (25 mm × 150 mm) with this medium are stored at room temperature and used within 2–3 days after preparation. 5. Stock solutions of growth substances: 1 mg/mL of 6-benzylaminopurine (BA), 1 mg/mL of α-naphthaleneacetic acid (NAA), and 1 mg/mL of 2,4-dichlorophenoxyacetic acid (2,4-D). Prepare by dissolving the powder in couple of drops of 5 M NaOH and bring to final volume with water. Store at 4 °C. 6. Acetosyringone stock solution: 9.8 mg/mL. Dissolve 196 mg of acetosyringone powder in 20 mL of 50 % ethanol. Store at −20 °C. 7. Cocultivation medium (CCM): MS medium plus 3 mg/L of BA (3 mL of BA stock solution), 0.1 mg/L of NAA (0.1 mL of NAA stock solution), 0.5 mg/L of 2,4-D (0.5 mL of 2,4-D stock solution), 19.6 mg/L of acetosyringone (2 mL of acetosyringone stock solution), and 8 g/L of agar, pH 6. Petri dishes (15 mm × 100 mm) with this medium are kept at room temperature for a maximum of 3 weeks (see Note 3). 8. Regeneration medium (RM): MS medium plus 3 mg/L of BA (3 mL of BA stock solution), 0.5 mg/L of NAA (0.5 mL of NAA stock solution), 333 mg/L of cefotaxime (1.33 mL of cefotaxime stock solution), 8 g/L of agar, and a choice of other appropriate antibiotics, pH 6. For the experiments described herein, we supplemented RM with 70 mg/L of

248

Vladimir Orbović and Jude W. Grosser

kanamycin (1.4 mL of kanamycin stock solution). Petri dishes (20 mm × 100 mm) with this medium are stored at room temperature for a maximum of 7 days. 9. Growth medium (GM): MS medium plus 50 mg/L of cefotaxime (0.2 mL of cefotaxime stock solution), 20 mg/L of kanamycin (0.4 mL of kanamycin stock solution), and 8 g/L of agar, pH 5.8. Petri dishes (20 mm × 100 mm) with this medium are kept at room temperature for up to 4 weeks. 10. Grafting medium: MS salts, Murashige and Tucker [23] vitamins, 70 g/L sucrose, and 8 g/L of agar, pH 5.8. Glass tubes (25 mm × 150 mm) with this medium are kept at room temperature for up to 4 weeks. 11. YEP-Agrobacterium cultivation medium [24]: 10 g/L of bacteriological peptone, 10 g/L of yeast extract, and 5 g/L of NaCl, pH 7. For solid medium add 15 g/L of agar. For the Agrobacterium strains used in experiments, YEP was supplemented with 50 mg/L of rifampicin (1 mL of rifampicin stock solution) and 50 mg/L of kanamycin (1 mL of kanamycin stock solution). Plates (15 mm × 100 mm) with this medium are kept at 4 °C for up to 4 weeks. 12. Stock solutions of antibiotics: cefotaxime stock of 250 mg/mL made by dissolving cefotaxime in water, filter-sterilized and kept at −20 °C. Rifampicin (Rif) stock of 50 mg/mL made by dissolving rifampicin in dimethyl sulfoxide; kept at −20 °C. Kanamycin (Kan) stock of 50 mg/mL made by dissolving kanamycin sulfate in water; filter-sterilized and kept at −20 °C. 13. Phire hot start DNA polymerase: Thermo Scientific, catalog number F-122L (see Note 4). 14. Primers for the virG gene PCR reaction: forward CTGGC GGCAAAGTCTGAT (Tm = 55.5 °C); reverse TGTCGTAA ACCTCCTCGT (Tm = 52.9 °C). All media are autoclaved at 116 °C and 1.5 bar for 20 min. Growth substances are added to the medium before autoclaving. Acetosyringone and antibiotics are added to the medium after it was autoclaved and cooled down to 55 °C.

3

Methods

3.1 Preparation of Plant Material

1. Extracted (or purchased) seeds are peeled and surface-sterilized by shaking for 15 min in 20 % solution of commercial bleach. These seeds are then rinsed with sterile water three times (20 min each rinse). 2. Place two seeds per glass tube containing Seed Germination medium (see Fig. 1a). Cap the tubes containing seeds, seal them with Nescofilm, and incubate them in the dark at room

Citrus Transformation Using Juvenile Tissue Explants

249

Fig. 1 Photographs of materials used in different phases of citrus transformation. (a) Processed seeds 4 days after planting; (b) 37-day-old seedlings ready for cutting; (c) explants after incubation with Agrobacterium; (d) explants with sprouted shoots 35 days after cocultivation with Agrobacterium; (e) plate with harvested shoots; (f) transgenic shoot 14 days after grafting in vitro

250

Vladimir Orbović and Jude W. Grosser

temperature (25 ± 4 °C) for 5 weeks. During this period, seedlings will germinate from the seeds and grow to be about 10–12 cm long (see Fig. 1b). 3. On the day of the experiment, take seedlings out of the tube using sterile forceps and place them on sterilized paper plates. 4. Using a sterile surgical blade mounted on a scalpel handle, remove root, a portion of the stem carrying cotyledons, and apical hook. 5. Cut the remaining seedling into pieces (about 15 mm long, see Fig. 1c) so that both ends of each explant are slanted (see Note 5). 6. Place explants (no more than 250 pieces) in a Petri dish (20 mm × 100 mm) containing liquid CCM (about 30 mL) and leave them there (usually 1–3 h) until the time of transfer to the Agrobacterium suspension. 3.2 Preparation of Agrobacterium Cultures

1. Two days before the experiment (see Note 6), start liquid cultures of Agrobacterium by inoculating 50 mL of YEP + Rif + Kan medium with one colony in 125 mL Erlenmeyer flask. These cultures are placed in an incubator that maintains the temperature at 28 °C and shaking speed at 220 rpm. 2. One day before the experiment, examine the culture, and if it appears dense and opaque (optical density OD600 higher than 1), replenish the medium and antibiotics in the bacterial culture. Take 2 mL of growing culture using a sterile pipette and discard the rest. Use the culture from the pipette as an inoculum for the new 50 mL culture with fresh YEP and antibiotics. If the culture is growing slowly and is translucent, leave it in the incubator without changing the medium or incubation conditions. 3. On the day of the transformation experiment, examine Agrobacterium culture. It should be growing vigorously at this time. Replenish the medium in the same flask by using 3 mL from growing culture and add 50 mL of fresh YEP (as described in step 2) supplemented with antibiotics to obtain actively growing bacteria for maximum effect at the desired time. Allow this culture to grow for additional 4–5 h. 4. Harvest 35 mL of Agrobacterium culture by centrifuging it at 3,000 × g for 10 min then resuspend the pelleted bacteria in 35 mL of liquid CCM medium. 5. The optical density (OD600) of resuspended culture is measured and adjusted to the desired level with additional amounts of CCM. Choice of citrus cultivar affects the optical density of bacterial suspension used in the experiment (see Note 7). For the series of experiments presented herein, we have adjusted OD600 to 0.7.

Citrus Transformation Using Juvenile Tissue Explants

3.3 Co-incubation of Explants with Bacteria

251

1. Take a group of explants (about 50) out of the plate with CCM and place them on sterilized paper towel to remove most of CCM liquid. This step (takes about 1 min) is necessary to avoid further dilution of bacterial suspension by each consecutive group of explants carrying some CCM. 2. Transfer the explants to the Petri dish (20 mm × 100 mm) with 30 mL of Agrobacterium suspension where they should be soaked for 1–2 min. 3. Following co-incubation with bacteria, place the explants on sterilized paper towels again to remove the excess of bacterial suspension. Since in the next step explants are placed on solid CCM medium that does not contain any antibiotics, getting rid of excess of bacteria is needed to prevent their overgrowth that may cause loss of the explants. 4. Place 16 infected explants on plate with solid CCM. Seal plates containing the explants with Nescofilm and place them in the incubator for 2 days. Temperature in the incubator is maintained at 26.1 °C for 16 h photoperiod (35 μmol/m2/s) and at 24.5 °C during 8 h of dark period. 5. Transfer explants from plates with CCM to RM medium, seal plates, and leave them in the incubator for about 5 weeks. Incubation conditions same as in step 4. Shoots should be easy to count and harvest at this time as they are 4–7 mm in length (see Fig 1d).

3.4 Detection of Reporter Gene in Transgenic Shoots (Green Fluorescent Protein, GFP)

1. For detection of GFP [20] as a reporter gene for transformation, observe shoots under the “fluorescent” microscope. This is a binocular microscope that has a source of blue light attached to it. When blue light hits molecules of GFP, it excites them to emit green light. As a result of the presence of GFP in transgenic tissue, shoots appear completely green, light pink, or red with green patches of different sizes. Under the same conditions, wild-type shoots appear red because chlorophyll emits red light after excitation with blue light. The pink color of shoots indicates presence of low levels of GFP in the tissue and the concomitant emission of light by both GFP and chlorophyll. 2. Following selection, excise transgenic shoots from the explants and place them on GM medium (see Note 8).

3.5 Primary PCRBased Screen for the Presence of Transgene in the Tissue of Shoots

1. The shoots used in this test are harvested by excising them from the explants and culturing them on GM medium (see Fig. 1e). Depending on the size of shoots and worker’s ability to manipulate small material, shoots can be used immediately or left on this plate for 3–4 weeks.

252

Vladimir Orbović and Jude W. Grosser

Fig. 2 Photograph of the shoot with the corked-out circular piece of tissue that will be used for the PCR-based primary screen for transgenic shoots. Diameter of the cork borer is 0.5 mm

2. Carefully cork out (see Fig. 2) a piece of leaf and plunge it into already prepared PCR mix. This test is based on the activity of “Phire” hot start II DNA polymerase (see Fig. 3 and Note 9). Cork borers used for removal of small explants from leaves of shoots have a diameter of the cutting tube of 0.5 mm (Harris Uni-Core 0.5 mm multipurpose sampling tool, see Note 10). 3.6 Micrografting of Transgenic Shoots In Vitro

1. Plants that are used as a rootstock are grown the same way as the plants that are used to obtain explants (see Subheading 3.1), meaning they should be fully etiolated on the day of grafting. For rootstock, select only plants which have at least 5 cm of straight shoot and root when measured from cotyledons (see Note 11). 2. Pull the plant out of the tube with sterile forceps, make a transverse cut about 2 cm above cotyledons with a sterile surgical blade mounted on scalpel handle, and discard the stem. 3. Cut the root about 4–5 cm below cotyledons and remove root hairs if there are any. At this point, everything should be done as quickly as possible to prevent the drying of cut surfaces of plant tissue. 4. Take the putative transgenic shoot and carefully cut it at the bottom so that lowest portion of the stem appears as a letter V. 5. Make a 2–3 mm deep longitudinal cut along the center of the cut surface of rootstock with a surgical blade. While the blade is in the rootstock, wiggle it to the left and right so that the slit widens a little and is ready to accept the graft. 6. Insert the wedged part of the shoot into the slit of rootstock, and transfer this plant into the tube with grafting medium.

Citrus Transformation Using Juvenile Tissue Explants

253

Fig. 3 Photographs of two agarose gels with products of PCR reactions performed as a part of primary screen for transgenic shoots. All seven shoots that provided corked-out explants for “positive” PCR reactions shown on the photo were tested in additional PCR for the native Agrobacterium gene. Especially suspicious were PCR products in lanes 7 and 25, and indeed it turned out that the shoot number 7 was not transgenic (see Note 9). Numbers associated with lanes designate the number of shoots tested. Lane labeled H2O was loaded with the products of PCR reaction where water was added instead of DNA sample. Lane labeled (+) was loaded with the products of PCR reaction where the DNA of binary vector that was mobilized into Agrobacterium was used as a template

We micrograft almost all of our transgenic shoots on Carrizo rootstock. Tubes with grafted plants are left in the incubator for 3–4 weeks. During this time, scions that have been successfully grafted develop into young plants, and roots of the rootstock increase in size and grow secondary roots and root hairs. Temperature in the incubator where tubes with these plants are kept is maintained at 26.1 °C for 16 h photoperiod (35 μmol/m2/s) and at 24.5 °C during 8 h of dark period. Our typical rate of grafting success is about 75 % (see Fig. 1f). 7. Grafted plantlets that have grown in vitro to the size of 3–4 cm in height should be transferred to “soil” (see Note 12) and grown in the laboratory on the light bench at room temperature (25 ± 4 °C) and under constant white light (55 μmol/ m2/s) for 2–3 months. 8. During this time, plants are fertilized three times a week with a fertilizer solution (1 g/L of 15:30:15 NPK). The plastic pots (6.5 cm × 6.5 cm × 6.5 cm) with grafted plants are kept in the

254

Vladimir Orbović and Jude W. Grosser

tray, and fertilizer solution leaching through the soil gets collected at the bottom. Most of this solution should be poured out of tray (twice a week) except the volume sufficient enough to cover the bottom (a few millimeters deep) (see Note 12).

4

Notes 1. If you are extracting larger numbers of seeds from freshly harvested fruit on a regular basis, buy a commercial grade juicer as those marketed for household use have motors that burn out easily. 2. Binary vectors were mobilized into Agrobacterium by a freezeand-thaw method [25]. Once the binary vector of interest has been mobilized into an appropriate strain, two stocks of newly created strains are made. Glycerol stock is kept at −80 °C and working stock is kept at 4 °C on plates of YEP medium supplemented with appropriate antibiotics. 3. Liquid CCM is used for temporary incubation of cut explants before they get infected in Agrobacterium suspension. Solid CCM is used for incubation of explants following incubation with Agrobacterium. 4. Phire hot start DNA polymerase is an enzyme with very high activity due to the presence of special DNA-binding domain. Because of high potency, this enzyme can multiply DNA molecules from a small number of templates and is therefore useful for our application where small piece of leaf tissue and not isolated DNA serves as a source of template. The use and storage of both an enzyme and a buffer are done according to manufacturer’s suggestions. 5. There is a report stating that transformation efficiency increases if explants are cut longitudinally as a result of higher surface of cambial tissue being exposed to action of Agrobacterium [26]. We confirmed these results (data not shown) but also noticed that stems of many citrus cultivars are not sturdy enough to sustain longitudinal cuts. For that reason, as well as for labor efficiency, we chose not to cut explants longitudinally but made slanted instead of transversal cuts on ends of explants, thereby increasing the surface area of internal tissues that came in contact with Agrobacterium. 6. Cultures of Agrobacterium start to lose their viability when kept on YEP + Rif + Kan plates at 4 °C for more than 3 weeks. Because of that, it is prudent to start the cultures for experiments 2 days earlier to allow bacteria to attain vigorous growth; a 24-h period may not be enough. 7. Although we never made exact calculations, we have noticed that different cultivars of citrus go through co-incubation with

Citrus Transformation Using Juvenile Tissue Explants

255

Agrobacterium differently. Carrizo citrange and all grapefruit cultivars stand up well to treatment by EHA101 ([27], the most virulent) strain of Agrobacterium. On the other hand, cultivars of sweet orange and lemons do not stand coincubation with EHA101 well, and some explants (10–20 %) turn brown and shrivel within 2–3 weeks. For transformation of these citrus cultivars, we use either EHA105 or AGL-1 [28] strains. Also, for the latter, more sensitive cultivars, OD600 of Agrobacterium suspension is usually set to 0.4–0.6 when using EHA105 and at 0.6 with AGL-1. EHA101 suspension is used with its OD600 set between 0.5 and 0.8. 8. GM medium is used for 2–3 week incubation of smaller shoots harvested from the explants. This allows them to grow to a size of 5–6 mm when they are easy to manipulate and be used in primary PCR screen. 9. When running PCR reaction catalyzed by the “Phire” enzyme, the PCR machine should be programmed according to manufacturer’s instructions as “Phire” has slightly different requirements regarding temperature and duration of annealing time in comparison to other DNA polymerases used for PCR reactions. Activity of “Phire” is so high that it can amplify the sequences present in just a few Agrobacterium cells that may still be present on the leaf of shoot. In that case shoots that are not transgenic may be counted as transgenic (see Fig. 2). All of the shoots that appear “positive” in this test should be subjected to additional PCR for one of Agrobacterium genes not residing on the binary vector (our choice was the VirG gene). Sometimes the intensity of the band corresponding to the amplicons in agarose gel of “false”-positive shoots can be as bright as the intensity of bands of “real” positives. 10. Because PCR is a very sensitive detection method, it is important to clean the cork borers thoroughly before each sampling. Between two samplings, submerge metal tips of cork borers into the 3 % bleach for 2 h. After that, tap their tips against the sterilized paper towel to remove any leftover of the bleach solution. Turn the cork borers upside down and leave to dry in the laminar flow hood until next use. 11. Tubes used for growth of grafted plants have special floaters made out of circular, 9 cm in diameter filter paper. Liquid medium should be poured into the tubes before the floaters are installed as floaters need to stay dry. These floaters are made as follows: paper is put over the top of the tube (the center of the paper should overlap the center of the tube opening) and pushed downwards so it wrinkles and folds around the tube, and only a small platform covering the tube opening stays flat. At this time, the paper looks like a makeshift cover for the tube. The next step is to take a sharp object and make a hole

256

Vladimir Orbović and Jude W. Grosser

(2–3 mm) in the center platform part of the “paper cover” of the tube. Paper is removed from the tube and pushed carefully into the tube so the platform with the hole stays at the top and is a few millimeters below the opening of the tube. Floater prepared like this is ready to receive the rootstock with grafted shoot and to be pushed to the bottom of the tube. Tubes are capped and autoclaved after both medium and the floaters have been put in. Because of this setup, it is necessary to have the root of the rootstock plant straight so it can easily go through the wrinkled part of the floater. Also, it is beneficial if the stem of the rootstock is straight because the grafted shoot stays in the center of the tube once the floater carrying the rootstock is pushed down the tube and plunged into the medium. 12. The word soil in the first sentence of Subheading 3.6, step 7 is placed under quotations as we do not use soil but instead use foam product that serves the role of artificial soil (Oasis Rootcubes; Smithers-Oasis, Kent, OH). Drill the hole in the center of foam cube and insert the root into it. Chip off small chunks of foam from the other cube and push them into the hole with the root so that root is in touch with the foam as much as possible. The foam used for growth of plants in the laboratory is devoid of any organic matter. For that reason, frequency of fertilizing has to be high, but at the same time, roots of grafted plants should not be kept in the environment heavily saturated with water. References 1. Soler N, Plomer M, Fagoaga C, Moreno P, Navarro L, Flores R, Peña L (2012) Transformation of Mexican lime with an intron-hairpin construct expressing untranslatable versions of the genes coding for the three silencing suppressors of Citrus tristeza virus confers complete resistance to the virus. Plant Biotech J 10:597–608 2. Febres VJ, Lee RF, Moore GA (2008) Transgenic resistance to Citrus tristeza virus in grapefruit. Plant Cell Rep 27:93–104 3. Reyes CA, Zanek MC, Velazquez K, Costa N, Plata MI, Garcia ML (2011) Generation of sweet orange transgenic lines and evaluation of Citrus psorosis virus-derived resistance against Psorosis A and Psorosis B. J Phytopath 159: 531–537 4. Zhang X, Francis MI, Dawson WO, Graham JH, Orbović V, Triplett EW, Mou Z (2010) Over-expression of the Arabidopsis NPR1 gene in citrus increases resistance to citrus canker. Eur J Plant Pathol 128:91–100

5. Sendin LN, Filippone MP, Orce IG, Rigano L, Enrique R, Peña L, Vojnov AA, Marano MR, Castagnaro AP (2012) Transient expression of pepper Bs2 gene in Citrus limon as an approach to evaluate its utility for management of citrus canker disease. Plant Pathol 61:648–657 6. Mendes BMJ, Cardoso SC, Boscariol-Camargo RL, Cruz RB, Mourao FAA, Bergamin A (2010) Reduction in susceptibility to Xanthomonas axonopodis pv. citri in transgenic Citrus sinensis expressing the rice Xa21 gene. Plant Pathol 59:68–75 7. Barbosa-Mendes JM, Mourao FDA, Bergamin A, Harakava R, Beer SV, Mendes BMJ (2009) Genetic transformation of Citrus sinensis cv. Hamlin with hrpN gene from Erwinia amylovora and evaluation of the transgenic lines for resistance to citrus canker. Sci Hort 122: 109–115 8. Mondal SN, Dutt M, Grosser JW, Dewdney MM (2012) Transgenic citrus expressing the antimicrobial gene Attacin E (attE) reduces

Citrus Transformation Using Juvenile Tissue Explants

9.

10.

11.

12.

13.

14.

15.

16.

17.

the susceptibility of ‘Duncan’ grapefruit to the citrus scab caused by Elsinoe fawcettii. Eur J Plant Pathol 133:391–404 Molinari HBC, Marur CJ, Bespalhok JC, Kobayashi AK, Pileggi M, Leite RP, Pereira LFP, Vierira LGE (2004) Osmotic adjustment in transgenic citrus rootstock Carrizo citrange (Citrus sinensis Osb. x Poncirus trifoliata L. Raf.) overproducing proline. Plant Sci 167:1375–1381 de Campos MKF, de Carvalho K, de Souza FS, Marur CJ, Pereira LFP, Bespalhok JC, Vieira LGE (2011) Drought tolerance and antioxidant enzymatic activity in transgenic ‘Swingle’ citrumelo plants over-accumulating proline. Environ Exp Bot 72:242–250 Fu X, Khan EU, Hu S, Fan Q, Liu J (2011) Overexpression of the betaine aldehyde dehydrogenase gene from Atriplex hortensis enhances salt tolerance in the transgenic trifoliate orange (Poncirus trifoliata L. Raf.). Environ Exp Bot 74:106–113 Fagoaga C, Tadeo FR, Iglesias DJ, Huerta L, Lliso I, Vidal AM, Talon M, Navarro L, GarciaMartinez JL, Peña L (2007) Engineering of gibberellin levels in citrus by sense and antisense overexpression of a GA 20-oxidase gene modifies plant architecture. J Exp Bot 58:1407–1420 Pasquali G, Orbović V, Grosser JW (2009) Transgenic grapefruit plants expressing the PAPETALA3-IPTgp gene exhibit altered expression of PR genes. PCTOC 97:215–223 Peña L, Martin-Trillo M, Juarez J, Pina JA, Navarro L, Martinez-Zapater JM (2001) Constitutive expression of Arabidopsis LEAFY or APETALA1 genes in citrus reduces their generation time. Nature Biotech 19:263–267 Endo T, Shimada T, Fujii H, Kobayashi Y, Araki T, Omura M (2005) Ectopic expression of an FT homolog from Citrus confers an early flowering phenotype on trifoliate orange (Poncirus trifoliata L. Raf.). Transgenic Res 14:703–712 Koca U, Berhow MA, Febres VJ, Champ KI, Carrillo-Mendoza O, Moore GA (2009) Decreasing unpalatable flavonoid components in Citrus: the effect of transformation construct. Physiol Plantarum 137:101–114 Al Bachchu MA, Jin SB, Park JW, Boo KH, Sun HJ, Kim YW, Lee HY, Riu KZ, Kim JH (2011) Functional expression of Miraculin, a

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

257

taste-modifying protein, in transgenic Miyagawa Wase Satsuma mandarin (Citrus unshiu Marc.). J Korean Soc Appl Biol Chem 54:24–29 Orbović V, Grosser JW (2006) Citrus: sweet orange (Citrus sinensis L. Osbeck ‘Valencia’) and Carrizo citrange [Citrus sinensis (L.) Osbeck x Poncirus trifoliata (L.) Raf.]. In: Wang K (ed) Agrobacterium protocol, Methods in molecular biology. Humana Press Inc, Totowa, NJ, pp 177–189 Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5:387–405 Mankin SL, Thompson WL (2001) New green fluorescent protein genes for plant transformation: intron-containing, ER-localized, and soluble-modified. Plant Mol Biol Rep 19: 13–26 Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–213 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays and tobacco tissue culture. Physiol Plant 15:473–497 Murashige T, Tucker DPH (1969) Growth factor requirements of Citrus tissue culture. Proc 1st Int Citrus Simp 3:1155–1161 Sambrook J, Russell DW (2001) Molecular cloning - a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Walkerpeach CR, Velten J (1994) Agrobacterium-mediated gene transfer to plant cells: cointegrate and binary vector systems. In: Plant molecular biology manual, vol B1. Kluwer Academic Publishers, Belgium, pp 1–19 Yu C, Shu H, Chen C, Deng Z, Ling P, Gmitter FG (2002) Factors affecting the efficiency of Agrobacterium-mediated transformation in sweet orange and citrange. Plant Cell Tissue Organ Cult 71:147–155 Hood EE, Helmer GL, Fraley RT, Chilton M-D (1986) The hypervirulence of Agrobacterium tumefaciens A281 is encoded in region of pTiBo542 outside of T-DNA. J Bacteriol 168:1283–1290 Lazo GR, Stein PA, Ludwig RA (1991) A DNA transformation-competent Arabidopsis library in Agrobacterium. Nat Biotechnol 9:963–967

Chapter 21 Citrus Transformation Using Mature Tissue Explants Vladimir Orbovic´, Alka Shankar, Michael E. Peeples, Calvin Hubbard, and Janice Zale Abstract Mature tissue protocol for production of transgenic Citrus plants via Agrobacterium-mediated transformation uses explants derived from branches of mature, fruit-bearing trees. Through the multiple cleaning steps consisting of grafting of apical tip meristems on rootstock plants grown under sanitary conditions, “mother” plants are produced that will serve as a source of budding material. These buds are grafted onto rootstock plants grown under the same, highly sanitary conditions. Newly obtained, one meter tall, young grafted plants serve as a source of explants for co-incubation experiments with Agrobacterium. Following successful transformation with Agrobacterium, selected transgenic shoots are micrografted onto rootstock plants in vitro where they are allowed to grow for a couple of months. Grafted transgenic plantlet together with the associated rootstock plant is taken out of culture tubes, severed from the root, and regrafted in terra on a 1-year-old rootstock plant. With the application of proper horticultural techniques, such a plant will yield first fruit about 12–15 months later. Key words Agrobacterium tumefaciens, Citrus, Genetic transformation, Mature tissue

1

Introduction The method of using mature tissue explants for production of Citrus transgenic plants via Agrobacterium-mediated transformation was described almost 15 years ago [1]. Despite the fact that it cannot be considered as “new,” only a few laboratories have attempted to employ this protocol with varying levels of success [2, 3]. The most important advantage of this approach to producing genetically modified Citrus plants is that they will be fruiting within short period of time of about 18 months (see Note 1). Compared to the method of using juvenile tissue explants as a starting material ([4], see associated chapter) in transformation experiments, mature tissue transformation yields fruiting plants 3–4 times faster. Having transgenic plants that are true to type and capable of producing fruit allows for rapid evaluation of commercially important traits of transgenic plants associated with fruit and

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_21, © Springer Science+Business Media New York 2015

259

260

Vladimir Orbovic´ et al.

juice quality together with the trait that was being improved via the introduction of transgene. Production of starting material for co-incubation with Agrobacterium in this protocol requires highly organized plantgrowing facility manned with skilled personnel. Uninterrupted production of rootstock plants is a major part of this operation. Rootstocks need to be available for grafting in batches that can number up to 100 plants, which upon grafting will yield high number of scion plants that will be cut into explants two times over seven to eight months. Also, additional rootstock plants need to be ready whenever there is a positively identified transgenic plant that should be grafted in terra. Figure 1 depicts the phases of production and the growth of plants that will be cut into explants for coincubation experiments. Having sufficient amounts of starting material for co-incubation experiments will lead to success in transformation only if the quality of explants is at the most satisfactory level. The absence of any microorganisms in the tissue of the plants to be cut into explants is the crucial parameter of quality. As much as following good horticultural practices in growing these plants to be vigorous and of proper size is important, it fades in comparison to making sure that these plants, both rootstocks and scions, do not contract any infection before they get used in transformation protocol. From the time of seed planting and germination of rootstock, and all phases of growth, extreme care has to be exercised in keeping these plants away from outside pests which could carry bacterial and/or fungal infection. In our facility, plants are grown in walk-in chambers that are contained within another building. Entrances to the building and to all the rooms where different activities associated with the maintenance of plants are performed are equipped with an “air curtain” to prevent insects from entering. Growth rooms themselves do not have “air curtains” installed. All personnel working within the facility wear protective/disposable coats and footwear that is used only on those premises. A special system is in place to purify water which is used for irrigation and fertigation and to feed humidifiers that are operational within the growth chamber. Because many pieces of equipment used for proper maintenance of plants are technical in nature, support for this type of the facility has to include a crew of maintenance personnel as well. Although this methodology holds the promise of yielding fruiting Citrus plants within 18–24 months, the relatively large initial financial investment and low output have made its adoption rare. Table 1 contains the data from two experiments that differ in choice of binary vector. The vector named pTLAB21 carries a gene for green fluorescent protein (GFP) between T-DNA borders [5], and pCAMBIA2301 binary vector is available commercially. High percentage transformation rate recorded in the experiment where pTLAB21 vector was used is highly unusual and is most probably due to the small number of shoots that were regenerated from explants.

Citrus Transformation Using Mature Tissue Explants

261

Fig. 1 Different stages of production of plants that will be used as source of explants for cocultivation with Agrobacterium. (a) Unwrapped grafted bud from “mother” plant 3 weeks after grafting; (b) shoot sprouted from grafted bud 7 days after unwrapping; (c) same as (b) but 14 days after unwrapping; (d) 4-week-old branch; (e) 3-month-old plant ready to be cut into explants; (f) inset from the photo in panel (e); (g) same as (f) but without leaves and thorns; (h) explants on the SM plate. Scale lines: a, b, and c, 1 cm; d, f, g, and h, 5 cm; e, 15 cm

262

Vladimir Orbovic´ et al.

Table 1 Transformation rate recorded in two experiments with “Hamlin” sweet orange cultivar

Bin. vector

Number of explants

Number of sprouted

Number of (+) shoots

Transformation efficiency (%)

pCAMBIA2301

490

236

2

0.8

pTLAB21

530

16

2

12.8

Mature tissue transformation can complement juvenile tissue methodology by quickly producing fruiting Citrus plants transformed with the gene proven to be of great value in the transgenic plants obtained from seedling explants.

2 2.1

Materials Plant Material

1. Seeds for the rootstock plants used for bud grafting to produce plants that will be cut into explants are obtained from commercial nursery. For this purpose, we use Swingle citrumelo [Citrus paradisi × Poncirus trifoliata] and Citrus macrophylla and obtain the seeds from Willits and Newcomb company (Bakersfield, CA). 2. Seeds of Carrizo [Citrus sinensis (L.) Osbeck × Poncirus trifoliata (L.) Raf.] rootstock used for micrografting of transgenic shoots are obtained either from the nursery or by extraction from harvested fruit. Plants propagated in the growth room by bud grafting from clean “mother” plants came from the following clone of sweet orange (Citrus sinensis. L.) cultivars: ‘Hamlin’ 1-4-1. Although we presented here the data from experiments with ‘Hamlin’, we also use different clones of sweet orange cultivar ‘Valencia’ and grapefruit (Citrus × paradisi) cultivar ‘Ray Ruby’.

2.2 Agrobacterium Strain and Plasmid

1. For the experiments described in this chapter, EHA101 [6] and EHA105 [7] strains of Agrobacterium were used. 2. The binary vector called pTLAB21 [5] carries gfp and nptII genes on T-DNA and a streptomycin-resistance gene for bacterial selection and was mobilized into EHA101 strain. The vector called pCAMBIA2301 (Cambia, Canberra, Australia) carries gus and nptII genes on T-DNA and a kanamycinresistance gene for bacterial selection and was mobilized into EHA105 strain (see Note 2).

Citrus Transformation Using Mature Tissue Explants

2.3 Plant Tissue Culture Media and Stock Solutions

263

1. Seed germination medium (SGM): 4.3 g/L of Murashige and Skoog (MS, [8]) basal salts mixture 8 g/L of agar, pH 5.7–5.8. 2. Inoculation medium (IM): 4.3 g/L of MS salts, 10 mL/L of White vitamin stock solution,10 mL/L of myoinositol, 30 g/L of sucrose, pH 5.7–5.8. 3. Cocultivation medium (CCM): 4.3 g/L of MS salts, 10 mL/L of White vitamin stock solution, 10 mL/L of myoinositol, 30 g/L of sucrose, 20 mL/L of 2,4-dichlorophenoxyacetic acid (2,4-D; see Note 3), 20 mL/L of indole-3-acetic acid (IAA), 10 mL/L of 2-isopentenyl-adenine (2,i-P), 8 g/L of agar, pH 5.7–5.8. 4. Selection medium (SM): 4.3 g/L of MS salts, 10 mL/L of White vitamin stock solution, 10 mL/L of myoinositol, 30 g/L of sucrose, 3 mg/L of 6-benzylaminopurine (BAP), 8 g/L of agar at pH 5.7–5.8, supplemented with 100 mg/L of kanamycin sulfate, 250 mg/L of cefotaxime, and 250 mg/L of vancomycin. Include Meropenem (10 mg/L) in the selection medium only during the first 2 weeks of selection. 5. Grafting medium (in vitro): 4.3 g/L of MS salts, 10 mL/L of White vitamin stock, 10 mL/L of myoinositol, 75 g/L of sucrose, pH 5.7–5.8. 6. White vitamin stock [9]: 20 mg/L of thiamine HCl, 100 mg/L pyridoxine HCl, 100 mg/L of nicotinic acid. Store at 4 °C. 7. Myoinositol stock: 10 mg/L dissolved in deionized water. Store at 4 °C. 8. 2,4-D stock solution: 10 mg/100 mL. Prepare by dissolving the powder in a few drops alcohol. Adjust volume with deionized water. Store at 4 °C. 9. IAA stock solution: 10 mg/100 mL. Prepare by dissolving the powder in a few drops 95 % ethyl alcohol. Adjust volume with deionized water. Store at 4 °C. 10. 2,i-P stock solution: 10 mg/100 mL. Prepare by dissolving in few drops of 1 N NaOH and store at 4 °C. 11. BAP stock solution: 10 mg/100 mL. Prepare by dissolving the powder in a few drops of 1 N NaOH. Complete final volume with deionized water. Store at 4 °C. 12. Kanamycin sulfate stock solution: 100 mg/mL. Prepare by dissolving 1 g of powder in 10 mL of sterile deionized water. Sterilize by filtration through a 0.45 μm membrane, make 1 mL aliquots in sterile Eppendorf tubes, and store at −20 °C. 13. Cefotaxime stock solution: 250 mg/mL. Prepare by dissolving 1 g of powder in 4 mL of deionized distilled water. Sterilize by

264

Vladimir Orbovic´ et al.

filtration through a 0.45 μm membrane, make 1 mL aliquots in sterile Eppendorf tubes, and store at −20 °C. 14. Vancomycin stock solution: 250 mg/mL. Prepare by using the same method used for cefotaxime, aliquot, and store at −20 °C. 15. Meropenem (USP, Rockville, MD): Prepare by dissolving 10 mg for 1 L of selection medium. Filter sterilize through 0.45 μm membrane. Prepare as needed because it cannot be stored. All media are sterilized by autoclaving at 121 °C for 20 min. Antibiotics and temperature-sensitive plant growth regulators are added to the autoclaved medium after reaching 40 °C. 2.4 Culture Media for A. tumefaciens

1. Liquid Luria broth (LB) medium: 20 g/L LB broth Vegitone. 2. Liquid Agrobacterium culture medium: LB medium containing 25 mg/L of kanamycin sulfate and 25 mg/L of nalidixic acid (see Note 4). For solid LB culture medium, add 10 g/L of agar, pH 7.5. 3. LB agar solid medium: 35 g/L LB agar Vegitone. 4. Liquid Leifert and Waites (LW) medium: 45.22 g/L of LW mix. 5. Nalidixic acid stock solution: 25 mg/mL. Prepare by dissolving 250 mg of powder in a few drops of 1 N NaOH and then add water to complete 10 mL. Sterilize by filtration, make 1 mL aliquots in sterile Eppendorf tubes, and store at −20 °C. All media are sterilized by autoclaving at 121 °C for 20 min. Antibiotics are added to the medium after autoclaving.

2.5 GUS Substrate Solution

2.6 Growth Chamber Care Supplies

To make 10 mL of GUS substrate solution, add 10.41 mg X-Gluc (5-bromo-4-chloro-3-indolyl glucuronic acid cycloheximide salt), 400 μL formamide (X-Gluc is dissolved in formamide), 1 mL Tris (stock concentration 1 M), pH 7.0, 100 μL NaCl (stock concentration 5 M), 100 μL Triton X-100, 6.5 mg potassium hexacyanoferrate, sterile deionized water 8.4 mL. GUS solution is light sensitive. Store in dark-walled vessel in the refrigerator. 1. Sunshine® Pro™ Just Coir, 100 % organic coconut fiber. 2. Metro-Mix® 930, 35 % composted pine bark, 30 % vermiculite, 25 % Canadian sphagnum peat moss, 10 % perlite, with dolomitic limestone, wetting agent, and a starter nutrient charge added. 3. Harrell’s® Slow Release, 16-5-10 (NPK), 1.735 % Ca, 0.65 % Mg, 0.13 % Cu, 1.56 % Fe, 0.13 % Mn, 0.003 % Mo, 0.13 % Zn.

Citrus Transformation Using Mature Tissue Explants

265

4. Harrell’s MAX® Minors, 1.00 % soluble Mg, 3.50 % combined S, 0.02 % B, 0.25 % chelated Cu, 4.00 % chelated Fe, 1.00 % chelated Mn, 0.0005 % Mo, 0.60 % chelated Zn. 5. Harrell’s MAX® Non-Staining Iron, 6.00 % chelated Fe. 6. Pestrong® Pro-Select Prill Dolomitic Limestone. 7. Aliette® WDG (Bayer CropScience, Research Triangle, NC). 8. Crystal Blue® Copper Sulfate, algaecide, 99.0 % copper sulfate pentahydrate, 1.0 % other ingredients. 9. Ridomil Gold® EC, fungicide, 47.6 % (R)-2-[(2,6dimethylphenyl)-methoxyacetylamino]-propionic acid methyl ester, 1.4 % related compounds, 51.0 % inert ingredients. 10. Bed Bug Spray (JT Eaton & Co., Twinsburg, OH), 0.13 % pyrethrins, 1.27 % piperonyl butoxide, 98.6 % other ingredients (see Note 5).

3

Methods

3.1 Preparation and Growth of Plant Material 3.1.1 Germination of Seeds for Production of Rootstock Plants for Bud Grafting

1. Seeds of either Citrus macrophylla or Swingle citrumelo are placed in a beaker with slightly soapy water and stirred for 3 min to clean the exterior and moisten the seed coat for easy removal. The first seed coat is removed from the seeds using forceps. Seeds are then sterilized in 10 % bleach for 10 min and then rinsed five times with sterilized DI water. 2. One seed is placed in each cone-tainer containing sterilized 100 % coconut fiber (coir). Beforehand, the coir is soaked in water until the electrical conductivity (EC) is approximately 0.5 mS/cm, strained, and sterilized twice in a soil sterilizer set at 180–200 °F for 3–4 h. Rinsing the coir until the EC reaches 0.5 mS/cm ensures the substrate salinity is low enough for healthy plant growth. After the coir has cooled, it is used to fill plastic cone-tainers with a height of 15 cm, diameter of 3 cm, and volume of 160 cm3. 3. Seeds are watered two or three times per week with approximately 20–30 mL of UV-sterilized water containing 2–3 ppm of chlorine. When the first true leaves develop, 2 g of Harrell’s® Slow Release is placed in the coir.

3.1.2 Transplanting Rootstock Seedlings to Be Used as Plants for Bud Grafting

1. When seedlings are 10–15 cm tall (3–4 months after starting seeds in coir), they are transplanted to 1 gallon pots. 2. Metro-Mix® 930 soil is sterilized twice in a soil sterilizer set at 82.2–93.3 °C for 3–4 h. After the soil has cooled, it is mixed with Harrell’s® Slow Release (16-5-10 with Minors) and Pestrong® Dolomitic Limestone. For approximately 65 L soil,

266

Vladimir Orbovic´ et al.

204 g of Harrell’s® Slow Release and 150 g of Pestrong® Dolomitic Limestone are added and mixed thoroughly. 3. Each seedling is placed in the middle of a 1 gallon pot containing the soil preparation described in the previous step. Immediately after planting, seedlings are watered and a stake and clip are used to keep the plant straight. 4. Following transplanting, seedlings are watered 3 days a week with approximately 250–500 mL of UV-sterilized water containing 2–3 ppm of chlorine. 3.1.3 Fertilizer Application

1. Every 3 months two fertilizer solutions are alternately applied to prevent nutrient deficiencies. If nutrient deficiencies appear between applications, the particular deficiency is diagnosed and the appropriate fertilizer solution is applied. 2. Harrell’s MAX® Non-Staining Iron is mixed in UV-sterilized water at a ratio of 10 mL of fertilizer per 1 L of water. After mixing, the solution is used to drench the soil. For plants in 1 gallon pots, 100 mL of solution is added, and for plants in 4 gallon pots, 200–300 mL of solution is added. 3. Harrell’s MAX® Minors is mixed in UV-sterilized water at a ratio of 10 mL of fertilizer per 1 L of water. Application volumes are the same as listed above for Harrell’s MAX® NonStaining Iron.

3.1.4 Pesticide Application

1. Once a month three pesticide solutions are cyclically applied to prevent the growth of fungus and algae. One pesticide is applied at a time, and any plant batches within 1 or 2 weeks of experimental transformation are not included in the application. 2. Aliette® WDG is mixed in UV-sterilized water at a ratio of 2.5 g per 1 L of water. After mixing, the solution is used to drench the soil. For plants in 1 gallon pots, 250 mL of solution is added, and for plants in 4 gallon pots, 500 mL of solution is added. 3. Crystal Blue® Copper Sulfate is mixed in UV-sterilized water at a ratio of 2.0 g per 1 L of water. Application method and volumes are the same as listed above for Aliette® WDG. 4. Ridomil Gold® EC is mixed in UV-sterilized water at a ratio of 0.08 mL per 1 L of water. Application method and volumes are the same as listed above for Aliette® WDG.

3.1.5 Bud Grafting Rootstock and Growth of Scions into Plants to Be Used as a Source of Explants for Co-incubation with Agrobacterium

1. When the rootstock has attained a width of approximately 1 cm (6–7 months after starting seeds in coir), they are grafted using the buds from mother plants. 2. Leaves and thorns are removed from the rootstock up to 30 cm above the soil level. Then an inverted-T incision is made 10–15 cm above the soil.

Citrus Transformation Using Mature Tissue Explants

267

3. A bud stick from the selected mother plant(s) is clipped, leaving 1–2 nodes to allow shoot regeneration, and buds are sliced off forming an oval shape with the bud in the center. Young and old buds should not be used if possible. The bud must be sliced very straight so that the cambial layers of the rootstock and bud come into close, even contact. 4. The doors of the T incision are opened slightly, and the bud is slipped up until the epidermis is able to begin closing under the bud. 5. Grafting plastic is firmly wrapped around the budded area. The wrap should be tight enough to keep excess moisture out of the grafted area but not so tight as to harm the bud. 6. The rootstock is then bent down and tied perpendicularly across the base of the rootstock to allow more light to reach the bud through the wrap. 7. After 21 days, the plastic wrap is removed and a 1 mm wide strip is girdled out 1 cm above the bud to direct water and nutrients to the bud (see Fig. 1a). Girdling is done only on the side of the rootstock with the bud. 8. When the bud has produced a shoot, the rootstock is clipped at the place where the 1 mm strip of epidermis was removed (see Fig. 1c), leaving a 10–15 cm rootstock with grafted scion emerging near the top. This scion is allowed to grow for next 2–3 months into ~1 m long plant that will be used as a source of explant material (see Fig. 1 e). 3.1.6 Germination of Seeds for Production of Rootstock Plants for Grafting of Transgenic Shoots (Primary Micrografting In Vitro) 3.1.7 Primary Micrografting

1. Both seed coats are peeled from Carrizo citrange seeds that are surface-sterilized by shaking for 10 min in 5 % solution of commercial bleach. These seeds are rinsed 5–6 times with sterile water. 2. Sow individual seeds into 25 × 150 mm glass tubes filled with 25 mL of SGM and incubate at 26 °C in the dark for 2 weeks. 1. Decapitate Carrizo seedlings leaving 1–1.5 cm of the epicotyls. Shorten the roots to 4–6 cm and remove the cotyledons and their axillary buds. Place the regenerated shoot onto the apical end of the cut surface of the decapitated epicotyl, in such a way to establish a contact between the vascular tissues of both scion and the rootstock (see Fig. 2a). 2. Culture grafted plants in grafting medium and maintain under conditions of 25 °C, 16 h light/8 h dark photoperiod, and 45 μE/m2s of illumination. Scions develop 2–4 expanded leaves within about 3–4 weeks after grafting.

3.1.8 Secondary Grafting

1. When the transgenic scion begins producing new leaves and is looking healthy, the in vitro-grown plant is taken to be grafted on 6- to 9-month rootstock grown in the clean growth room.

268

Vladimir Orbovic´ et al.

Fig. 2 Photographs depicting: (a) primary micrografting, (b) secondary grafting, (c) initial stages of growth of transgenic plant, and (d) 19-month-old plant (the inset shows developing flowers)

The plant is removed from the test tube; deionized water is used to rinse any remaining liquid media from the shoot portion of the plant. 2. Leaves and thorns are removed from the rootstock up to 30 cm above the soil level. Then a T incision is made 10–15 cm above the soil. 3. The surgical scalpel is used to slice off the root portion of the in vitro plant. Next a smooth slice is made down and inward to the center of the pith, and the slice is continued downward, exposing the cambium of the in vitro plant. 4. The doors of the T incision are opened slightly, and the prepared in vitro plant is slipped downward, bringing the cambial layers of the two plants together (see Fig. 2b).

Citrus Transformation Using Mature Tissue Explants

269

5. Grafting plastic is firmly wrapped around the graft, being careful not to damage the in vitro plant. The rootstock is bent down and tied perpendicularly across the base of the rootstock, and the grafted plant is placed inside a clear plastic bag. 6. A stake is placed in the soil in front of the grafted in vitro plant to prevent injury. A twist tie is then used to close the bag around the stake to maintain a high-humidity environment. 7. After 21 days, the plastic wrap is removed and a 1 mm wide strip of epidermis is removed on the side above the graft. Over a period of 2–3 weeks, the clear plastic bag is slowly opened to allow the plant to acclimate to a less humid environment. 8. When the grafted in vitro plant is observed to be growing well, the rootstock is clipped above the graft and the plant is removed from the bag. 3.2 Cocultivation of Explants with Agrobacterium 3.2.1 Preparation of Agrobacterium Cultures

1. The first day: streak Agrobacterium on the plate with LB agar medium (containing antibiotics) at 28 °C for 2 days. 2. Two days later: pick a single colony of bacteria and inoculate 5 mL of LB liquid culture medium (containing antibiotics) and grow overnight at 28 °C on an orbital shaker at 200 rpm. 3. On the fourth day (also the day of experiment): check the OD of overnight culture. Take 1–3 mL of culture (depending on absorbance at 600 nm), inoculate 100 mL of LB liquid medium, and grow 4–5 h at 28 °C. Check the OD at 600 nm. OD should be between 0.5 and 0.8. Centrifuge the bacterial culture for 10 min at 148 × g and resuspend in IM to obtain final concentration of bacteria 4 × 108 cells/mL. Keep in 4 °C until use.

3.2.2 Preparation of Explants and Cocultivation with Agrobacterium

1. Cut the bud stick (see Note 6) into pieces (about 40–50 cm long; see Fig. 1g) from first flushes of propagated plants leaving two nodes for regeneration of the second flush. Remove the leaves and thorns, and collect them in plastic bag. Move this material to the laboratory. Next steps are all done in the laboratory. 2. Done outside of laminar flow hood: place the bud sticks in a tub containing tap water and soap. Scrub them carefully with a soft brush. Rinse the bud sticks with distilled water. Collect the clean bud sticks in graduated cylinder that will accommodate length of bud sticks. Add 20 % bleach solution with 5–6 drops of Tween-20 and wash bud sticks for 10 min while inverting the cylinder. The cylinder should be sealed with Parafilm. Transfer to laminar flow hood. 3. Done inside laminar flow hood: rinse all bud sticks five times with sterile deionized water. Cut bud stick internodes transversely into 15 mm long explants with the help of forceps and sterile clippers on the autoclaved Whatman filter paper. Collect

270

Vladimir Orbovic´ et al.

40 explants in individual sterile humid glass petri dishes until all stem pieces have been processed. 4. Transfer explants into petri dishes with bacterial suspension. Just before inoculation, bacterial suspension prepared earlier is diluted ten times with the IM. Inoculation should last for 15 min with occasional gentle swirling by hand. 5. Blot-dry the explants on sterile Whatman filter paper and place horizontally on plates containing CCM (approx 20–30 explants per plate). Incubate for 3 days at 28 °C at a low light intensity (2 μmol/m2/s, 16 h light/8 h dark photoperiod). 3.3 Selection of Transgenic Shoots 3.3.1 Incubation on Selection Medium

1. After 3 days of incubation of explants on cocultivation medium without antibiotics, transfer the explants to SM but only ten per plate keeping a wide distance between them (see Fig 1h). 2. Maintain cultures in the dark for 3–4 weeks at 26 °C. A callus should appear on explants during this phase. Explants should be observed every 2–3 days with a stereoscope. 3. Transfer the explants to a 16 h light/8 h dark photoperiod, 45 μmol/m2/s light intensity, at 26 °C. Explants should be subcultured to a fresh set of plates with SM every 3–4 week.

3.3.2 Harvest of Putatively Transgenic Shoots

1. Shoots should develop from the cut ends of explants 2–3 weeks after transfer to light. They should be allowed to develop to the stage where they have at least two leaves. 2. Harvest the shoots and check their transgenic nature by performing a histochemical GUS assay or by observing the GFP expression under fluorescent microscope.

3.3.3 Histochemical GUS [10] Assay (See Note 7)

1. Take a 96-well ELISA plate and aliquot 100 μL of GUS substrate solution into each well. 2. Cut out the shoots from the explants with the help of forceps and sterile surgical scalpel. Cut a thin cross section at the base of the stem or small piece of leaf and place it in one of the wells of ELISA plate. 3. Seal the plate with Parafilm and keep it at 37 °C overnight. 4. Tissue from the transgenic shoots will turn blue in color. Stop the reaction by washing the tissue three times with 100 mM Tris, pH 7.0. 5. Bleach out the green color from the tissue (originating from the presence of chlorophyll) to better visualize the blue staining. For these washes use increasing series of ethanol: 30, 50, 70, and 100 % until the green color is lost.

Citrus Transformation Using Mature Tissue Explants

271

Fig. 3 Photograph of two explants with transgenic shoots carrying functional GFP in their tissue. Explants were exposed to both blue light and dim white light. Blue light was used to induce GFP emission and white light to allow photographing of explants. Scale line 12 mm

3.3.4 GFP Detection (See Note 7)

4

1. All shoots that sprouted from explants should be inspected for the presence of GFP fluorescence. Shoots are observed under the microscope equipped with a source of blue light which will be used to induce emission of green light from tissue of transgenic shoots due to the presence of GFP (see Fig. 3). Wild-type shoots appear red under these conditions due to emission of red light by chlorophyll under these conditions.

Notes 1. Preparation of “cleaned” mother plants used as source of budding material is not included into time necessary to produce fruiting plants as it requires considerable amount of time itself. Obtaining “clean” budwood from the certified nursery will be of great help in this endeavor. In our experience, even some of

272

Vladimir Orbovic´ et al.

the budwood obtained from the local USDA branch carried some microorganisms despite being certified as “clean.” Always double-check the material by cutting branches into pieces and using a few sections from the middle for incubation with the liquid LB and LW media for 48 h. Only if there is no growth in the flasks with the media where the sections from branches were submerged, that material can be used for further propagation. 2. Binary vectors used in these experiments were introduced into Agrobacterium by employing a freeze-and-thaw method [11]. Upon confirmation that appropriate Agrobacterium strain carries the binary vector of interest, a “working” stock and a glycerol stock of newly created strains should be made. The working stock is kept in the refrigerator on plates of LB solid medium supplemented with appropriate antibiotics (not longer than three weeks as Agrobacterium loses its viability). Glycerol stock is kept at −80 °C. 3. Concentration of 2,4-D will vary depending on the cultivar that is being transformed. 4. Nalidixic acid (Sigma-Aldrich, prod. #N8878) is a synthetic quinolone antibiotic that acts in a bacteriostatic manner. In susceptible bacteria, nalidixic acid blocks DNA replication through inhibition of DNA gyrase. 5. In spite of precautions such as multiple air curtains and requiring people entering the growth room to wear long-sleeved lab coats and shoe covers, it is possible for some insects to gain entry to the growth chamber environment. Under Florida conditions, fungus gnats may become established and lacking any natural predators will reproduce easily and feed on the soft tissue of youngest rootstock seedlings. If fungus gnats are discovered, JT Eaton® Bed Bug Spray can be used for control. Squirt approximately 2 mL of the premixed solution onto the surface of coir in all seedling cone-tainers, avoiding contact with germinated seedlings as much as possible. Continue application once a week until fungus gnats have been controlled. 6. For the steps 1–3 in Subheading 3.2.2, the following tools should be ready: clippers washed and cleaned with 50 % bleach, sterilized forceps, solution of bleach (20 %) with 0.1 % Tween-20, autoclaved Whatman filter paper (46 × 57 cm) wrapped in aluminum foil, and autoclaved glass petri plates with filter paper (9 cm in diameter) moistened with 3 mL of deionized water. 7. As the volume of work increased in our facility, we started using the PCR-based screening method to select transgenic shoots. This method is described in detail in associated chapter on Citrus juvenile tissue transformation.

Citrus Transformation Using Mature Tissue Explants

273

References 1. Cervera M, Juarez J, Navarro A, Pina JA, Duran-Vila N, Navarro L, Peña L (1998) Genetic transformation and regeneration of mature tissues of woody fruit plants bypassing the juvenile stage. Transgenic Res 7:51–59 2. Almeida WAB, Mourao Filho FAA, Pino LE, Boscariol RL, Rodriguez APM, Mendes BMJ (2003) Genetic transformation and plant recovery from mature tissue of Citrus sinensis L. Osbeck. Plant Sci 164:203–211 3. He YR, Chen SC, Peng AH, Zou XP, Xu LZ, Lei TG, Liu XF, Yao LX (2011) Production and evaluation of transgenic sweet orange (Citrus sinensis Osbeck) containing bivalent antibacterial peptide genes (Shiva A and Cecropin B) via a novel Agrobacterium-mediated transformation of mature axillary buds. Sci Hort 128:99–107 4. Orbović V, Grosser JW (2006) Citrus: sweet orange (Citrus sinensis L. Osbeck ‘Valencia’) and Carrizo citrange [Citrus sinensis (L.) Osbeck × Poncirus trifoliata (L.) Raf.]. In: Wang K (ed) Agrobacterium protocol – methods in molecular biology. Humana, Totowa, NJ, pp 177–189 5. Orbović V, Pasquali G, Grosser JW (2007) A GFP-containing binary vector for Agrobacterium

6.

7.

8.

9.

10.

11.

tumefaciens-mediated plant transformation (ISHS). Acta Hort 738:245–253 Hood EE, Helmer GL, Fraley RT, Chilton M-D (1986) The hypervirulence of Agrobacterium tumefaciens A281 is encoded in region of pTiBo542 outside of T-DNA. J Bacteriol 168:1283–1290 Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–213 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays and tobacco tissue culture. Physiol Plant 15:473–497 White PR (1943) Nutrient deficiency studies and an improved inorganic nutrient for cultivation of excised tomato roots. Growth 7:53–65 Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5:387–405 Walkerpeach CR, Velten J (1994) Agrobacterium-mediated gene transfer to plant cells: cointegrate and binary vector systems. In: Gelvin SB, Schilperoort RA (eds) Plant molecular biology manual. Kluwer, Belgium, pp 1–19

Chapter 22 Coffee (Coffea arabica L.) Eveline Déchamp, Jean-Christophe Breitler, Thierry Leroy, and Hervé Etienne Abstract Coffee (Coffea sp.) is a perennial plant widely cultivated in many tropical countries. It is a cash crop for millions of small farmers in these areas. As for other tree species, coffee has long breeding cycles, which makes conventional breeding programs time-consuming. For that matter, genetic transformation can be an effective way to introduce a desired trait in elite varieties or for functional genomics. In this chapter, we describe two highly efficient and reliable Agrobacterium-mediated transformation techniques developed for the C. arabica cultivated species: (1) A. tumefaciens to study and introduce genes conferring resistance/ tolerance to biotic (coffee leaf rust, insects) and abiotic stress (drought, heat, seed desiccation) in fully transformed plants and (2) A. rhizogenes to study candidate gene expression for nematode resistance in transformed roots. Key words Abiotic stress, Agrobacterium rhizogenes, Agrobacterium tumefaciens, Coffee leaf rust resistance, Embryogenic cultures, Functional genomics, Hairy roots, Meloidogyne sp., Nematode resistance

1

Introduction With more than seven million tons of green coffee beans produced every year on about 11 million hectares all over the intertropical countries, coffee is an extremely important agricultural crop. Growing regions typically offer moderate sunshine and rain, steady temperatures around 26 °C, and rich, porous soil. In terms of economic importance on the international markets, coffee is the second natural commodity in value after petroleum. The total coffee production for year 2009/2010 was of 120.6 million bags (www.ico. org). Brazil is responsible for about a third of all coffee production (39.4 million bags of 60 kg), making it by far the most important coffee-producing country, followed by Vietnam, Indonesia, and Colombia. About 125 million people depend on coffee for their livelihood in Latin America, Africa, and Asia.

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_22, © Springer Science+Business Media New York 2015

275

276

Eveline Déchamp et al.

Traditional breeding is aimed at improving the income of the planters, who are mainly small farmers. As other perennial crops, coffee has a long juvenile period. Conventional breeding can take between 25 and 35 years. It is a major drawback for coffee improvement. Genetic engineering could shorten this time by allowing the incorporation of known genes into elite genetic backgrounds. Two major species, Coffea arabica (self-pollinated and allotetraploid: 2n = 44, 68 % of the global production) and Coffea canephora (self-sterile and diploid: 2n = 22) are cultivated all over tropical areas. Arabica breeding is traditionally based on pure line selection, but since 15 years, an F1 hybrid selection strategy has been developed [1, 2]. The main traits of interest for breeding are the following: yield and beverage quality along with pests and diseases resistance. C. canephora breeding is more oriented toward improving yield and technological and organoleptic qualities through creation of hybrids between genotypes of different genetic groups [3] or selection of improved clones [4]. Works on genomics and gene mining have recently been developed. Genetic transformation is also a tremendous tool for studying the function and expression of genes (e.g., genes involved in coffee quality or in resistance to diseases and parasites or resistance to abiotic stress like heat, drought, and salinity) or for understanding mechanisms associated with the introgression of foreign germplasm within a species. Mastering introgression, primarily from C. canephora to C. arabica, mainly for pest and disease tolerance, is the major challenge for the next 20 years. The major pests threatening the production are coffee leaf rust, coffee berry disease, leaf miner, and nematodes. The leaf miner Leucoptera sp. has an economically important impact in East Africa and Brazil. Since the caterpillar develops inside coffee leaves, insecticide sprays do not affect it much. Ingestion of the insecticide or an insecticidal protein by the miner is necessary for an efficient treatment. This implies the use of systemic insecticides which are harmful to farmer and the environment. A valuable strategy would then be the transgenic approach. The use of Bacillus thuringiensis genes to transform plants for protection to insect is currently the most reliable strategy [5, 6], and preliminary investigations were therefore conducted to determine the susceptibility of Leucoptera spp. to B. thuringiensis insecticidal proteins and identify candidate genes for transformation of coffee [7]. The toxin expressed by the cry1Ac gene, widely used to confer resistance to Lepidopterae [8], has been demonstrated to be the most effective. Current studies are in progress to select other B. thuringiensis strains active against coffee berry borer and white stem borer [9], two coleopteran pests of economic importance. Transformed plants highly resistant to leaf miner under greenhouse conditions were tested under field conditions in French Guiana for 4 years for field resistance [10] in an experiment with 54 transformation events. Approximately 70 %

Coffee (Coffea arabica L.)

277

of the events tested were resistant to leaf miner with a similar growth and development compared to control plants. The main cultivated C. arabica varieties are dwarfs and high yielding and give good quality coffee, but they are susceptible to numerous pathogens, particularly endoparasitic root nematodes of the genus Meloidogyne [11] and coffee leaf rust caused by the obligate parasitic fungus Hemileia vastatrix Berk. and Br. (Uredinales). In many production regions, and more particularly in Brazil and Central America, Meloidogyne spp. (root-knot nematodes) are a major agricultural constraint. Their attacks have a considerable impact, and they can even reduce yields substantially, kill the trees, and lead farmers to cut off coffee trees. Nematicide products are expensive, not very efficient, and harmful to humans and the environment. It is unanimously accepted that the way to fight rootknot nematodes is to select resistant varieties. Sources of specific resistance to Meloidogyne have been identified in diploid species [12]. The regeneration of hairy roots after transformation with A. rhizogenes has been reported in a large number of species [13]. Hairy roots are used to study mycorrhization, nodulation and nitrogen fixation, and the production of secondary metabolites under controlled conditions in bioreactors or for studying plant/ nematode interaction or functional analysis of resistance gene candidates [14, 15]. Our team has developed the production of roots transformed by A. rhizogenes to validate candidate genes of resistance to root-knot nematodes by functional complementation and to study the conditions required for expression of such genes. Coffee leaf rust is one of the most serious diseases which greatly limits Arabica coffee production in almost all growing countries around the world. Therefore, since a long time, the development of coffee varieties resistant to coffee leaf rust has been a breeding objective of the highest priority in many countries [16]. A number of resistance (R) genes to coffee leaf rust have been identified in the cultivated or wild Coffea gene pool. The genetic and physical maps of the SH3 resistance locus introgressed species were established [17, 18]. Analysis of SH3 locus in C. arabica has revealed the presence of 5, 3, and 4 R genes in Ea, Ca, and Cc sub-genomes, respectively, all of them belonging to CC-NBS-LRR (CNL) subfamily of R genes [19]. Validation of these candidate R genes by functional complementation with an A. tumefaciens-mediated transformation process is under way in our laboratory. For both pests—i.e., Meloidogyne nematodes and coffee leaf rust—the ultimate objective is to breed varieties using molecular marker-assisted selection (MAS), into which genes of resistance to the different nematodes and coffee leaf rust races have been pyramided. Reviews on biotechnology techniques applied to coffee have been published recently [20, 21]. Most studies deal with largescale propagation techniques through somatic embryogenesis, somaclonal variation, in vitro preservation of coffee germplasm,

278

Eveline Déchamp et al.

genetic transformation, and evaluation and use of genetic resources based on the utilization of molecular markers. Recent researches have been conducted in coffee on pest and disease resistance genes [12, 18, 19], drought resistance genes [22], cup quality improvement genes [23], and specific promoters [24, 25]. Functional analysis of some of them has already been successfully performed. Genetic tools like genetic maps [26, 27] and BAC DNA libraries [28] can be useful for new gene searches. Next-Generation Sequencing technology and more particularly the advances in the C. canephora and C. arabica genome sequencing [29] open the possibility to quickly identify many agronomically interesting coffee genes. Genetic transformation of coffee was first performed on cells using protoplast electroporation [30]. Genetic engineering using Agrobacterium sp. has also been reported [31–34]. Regeneration of transgenic coffee trees was obtained after transformation of somatic embryos via Agrobacterium rhizogenes [35–37] or via Agrobacterium tumefaciens [38–40]. Although somatic embryogenesis is still a tedious process for some coffee species, embryo regeneration is easily obtained. Very efficient and reliable somatic embryogenesis processes have been recently developed in C. arabica [41, 42] and are industrially applied since 2006. Suitable transformation protocols are of utmost importance, either to evaluate gene functionality or to introduce new genes of interest. We developed two different protocols. Embryogenic calli have been frequently used as the target tissue for transformation, but the difficulty in producing or maintaining embryogenic tissues is one of the major problems encountered in genetic transformation of many woody plants, including Coffea arabica. We established the conditions for long-term proliferation of embryogenic cultures in C. arabica var. Caturra and a highly efficient and reliable Agrobacterium tumefaciens-mediated transformation method based on their utilization [43]. At the histological level, transformation success was related to the abundance of proembryogenic masses (PEMs). All the regenerated plants were proved to be transformed by PCR and Southern blot hybridization. The average transformation frequency (number of transformed calli/total number of calli subjected to the transformation treatment × 100) ranges from 50 to 90 % depending on the genotypes and quality of the embryogenic tissues. The present Agrobacterium-mediated transformation of embryogenic cultures represents a reliable and useful tool for coffee breeding and functional analysis of agronomically important genes. The second protocol we describe here has been adapted to study the expression of genes of resistance to root-knot nematodes. It consists in the rapid regeneration of hairy roots after transformation of zygotic embryos by A. rhizogenes (see Note 1). This protocol was developed for coffee, based on those published

Coffee (Coffea arabica L.)

279

for other species [44, 45]. Our procedure enables rapid and routine generation of hairy roots, as well as their maintenance. Two Coffea arabica genotypes were used for these experiments. The Caturra variety, which is widely grown in Latin America, is susceptible to the root-knot nematode Meloidogyne exigua. The second variety used, Iapar 59 (a Catimor-type interspecific hybrid), is resistant to numerous diseases and pests. Its resistance to Meloidogyne exigua has been demonstrated [46].

2

Materials

2.1 Regeneration of Whole Transgenic Plants Using A. tumefaciens

Leaves from greenhouse grown mature plants of C. arabica.

2.1.1 Plant Materials 2.1.2 Transformation Vectors

1. Agrobacterium tumefaciens strains: LBA1119. 2. Vector background: Construct has been integrated in the pBIN19 [47] and the pMDC32 [48] plasmids. 3. Transgenes: (a) a screenable marker gene (see Note 2) and (b) a selectable marker gene (see Note 3).

2.1.3 Culture Media for Agrobacterium Strains

1. LB agar high-salt medium: 10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, 10 g/L agar, pH 7.0. 2. Hygromycin: 50 mg/mL stock solution in ultrapure water. Sterilize by filtration through a 0.2 μm membrane. Dispense 1 mL aliquots in Eppendorf tubes and store at −20 °C. 3. Rifampicin: 25 mg/mL stock solution in ultrapure water, dissolve in methanol and bring up the final volume with reverse osmosis (RO) water. Sterilize by filtration through a 0.2 μm membrane. Dispense 1 mL aliquots in Eppendorf tubes and store at −20 °C. 4. Kanamycin sulfate: 50 mg/mL stock solution in water. Sterilize by filtration through a 0.2 μm membrane. Dispense 1 mL aliquots in Eppendorf tubes and store at −20 °C. 5. LB liquid medium containing 50 mg/L kanamycin, 50 mg/L rifampicin, pH 7.5.

2.1.4 Stock Solutions

1. 6-Benzylaminopurine (BAP): 1 mg/mL stock solution. Prepare by dissolving in 1 mL of 1 N H2SO4 before making up to 10 mL with RO water. Store at 4 °C. 2. 2,4-Dichlorophenoxyacetic acid (2,4-D): 0.5 mg/mL stock solution. Prepare by dissolving in 1 mL of 1 N NaOH before making up to 10 mL with RO water. Store at 4 °C.

280

Eveline Déchamp et al.

3. 6-(γ,γ-dimethylallylamino)purine (2-iP): 0.1 mg/mL stock solution. Prepare by dissolving in 1 mL of 1 N NaOH before making up to 100 mL with RO water. Store at −20 °C. 4. Indole-3-butyric acid (IBA): 0.1 mg/mL stock solution. Prepare by dissolving in 1 mL of 1 N NaOH before making up to 100 mL with RO water. Store at 4 °C. 5. Kinetin: 0.1 mg/mL stock solution. Prepare by dissolving in 1 mL of 1 N NaOH before making up to 100 mL with RO water. Store at 4 °C. 6. Cefotaxime: 125 mg/mL in RO water. Sterilize by filtration and store at −20 °C. 7. Acetosyringone (Fluka Chemical cat. no. 38766): 200 μM in EtOH, store at −20 °C. Shake well before use. 2.1.5 Media for Plant Tissue Culture and Transformation

All media are sterilized by autoclaving under 1.1 kg/cm2 for 20 min at 121 °C; antibiotics and cefotaxime added to autoclaved media after cooled down to 55 °C. 1. C callogenesis medium [49]: half-strength MS salts [50], 10 mg/L thiamine HCl, 1 mg/L pyridoxine HCl, 1 mg/L nicotinic acid, 1 mg/L glycine, 100 mg/L myoinositol, 100 mg/L casein hydrolysate, 400 mg/L malt extract (Sigma), 0.5 mg/L 2,4-D, 1 mg/L IBA, 2 mg/L 2-iP, 30 g/L sucrose, 2 g/L Phytagel™, pH 5.6. 2. Embryogenic callus production (ECP) medium [49]: halfstrength MS salts, 20 mg/L thiamine HCl, 20 mg/L glycine, 40 mg/L L-cysteine (Sigma), 200 mg/L myoinositol, 60 mg/L adenine hemisulfate salt (Sigma), 200 mg/L casein hydrolysate, 800 mg/L malt extract, 1 mg/L 2,4-D, 4 mg/L BAP, 30 g/L sucrose, 3.2 g/L Phytagel™, pH 5.6. 3. R regeneration medium [49]: half-strength MS salts, 10 mg/L thiamine HCl, 1 mg/L pyridoxine HCl, 1 mg/L nicotinic acid, 10 mg/L L-cysteine, 2 mg/L glycine, 200 mg/L myoinositol, 400 mg/L casein hydrolysate, 400 mg/L malt extract, 4 mg/L BAP, 40 g/L sucrose, 3.2 g/L Phytagel, pH 5.6. 4. M maturation medium [49]: semisolid MS medium with fullstrength salts, 10 mg/L thiamine HCl, 100 mg/L myoinositol, 0.3 mg/L BAP, 30 g/L sucrose, 3.2 g/L Phytagel™, pH 5.6. 5. G germination medium [49]: semisolid MS plant development medium with full-strength salts, 10 mg/L thiamine HCl, 100 mg/L myoinositol, 1 g/L activated charcoal, 30 g/L sucrose, 3.2 g/L Phytagel™, pH 5.6.

Coffee (Coffea arabica L.) 2.1.6 Other Solutions and Supplies

2.2 Hairy Root Regeneration Using A. rhizogenes

281

1. Leaf surface disinfectant solution: 8 % HClO (w/v).

Seeds of Coffea arabica var. Caturra and Iapar 59 were obtained at the ICAFE research center of Costa Rica.

2.2.1 Plant Materials 2.2.2 Transformation Vectors

The Agrobacterium rhizogenes strain A4RS was used for transformation (see Note 4). This strain derived from the wild strain A4 modified for the resistance to rifampicin and spectinomycin antibiotics [51]. Construct has been integrated in the pBin19 plasmid [47]. The uidA bacterial gene isolated from Escherichia coli coding for β-glucuronidase (GUS) was introduced [52], with an additional intron for specific expression in plants [53]. The gene was controlled by the cauliflower mosaic virus (CaMV) 35S promoter and terminator. The A4RS including the pBIN19 plasmid with the above construct was called armed A4RS.

2.2.3 Culture Media for Agrobacterium rhizogenes Strains

1. MYA medium: 5 g/L yeast extract, 0.5 g/L casein hydrolysate, 8 g/L mannitol, 2 g/L MgSO4, 5 g/L NaCl, and 15 g/L agar, pH 6.6. 2. Kanamycin sulfate: 50 mg/mL stock solution in water. Sterilize by filtration through a 0.2 μm membrane. Dispense 1 mL aliquots into Eppendorf tubes and store at −20 °C. 3. Rifampicin: 25 mg/mL stock solution in water; use a few drops of 100 % methanol for correct dilution. Sterilize by filtration and store at −20 °C. 4. Spectinomycin: 20 mg/mL stock solution in water. Sterilize by filtration through a 0.2 μm membrane and store at −20 °C. 5. MYA semisolid medium containing 50 mg/L rifampicin (both for wild and armed A4RS), 500 mg/L spectinomycin (both for wild and armed A4RS), 50 mg/L kanamycin (only for armed A4RS), pH 6.6.

2.2.4 Tissue Culture

Media sterilized by autoclaving for 20 min at 121 °C; cefotaxime added to cooled sterile media. 1. GER germination medium: semisolid MS medium [49] with full-strength salts, vitamins (10 mg/L L-cysteine, 10 mg/L thiamine HCl, 1 mg/L pyridoxine HCl, 2 mg/L glycine, 1 mg/L nicotinic acid), 40 g/L sucrose, and 3.2 g/L Phytagel™. 2. Seed surface disinfectant solution: 8 % HClO (w/v), Tween40 (ten droplets). 3. Cefotaxime (Duchefa Biochemie): 200 mg/mL in water. Sterilize by filtration and store at −20 °C.

282

3

Eveline Déchamp et al.

Methods

3.1 Protocol for Producing Whole Transgenic Plants Using A. tumefaciens 3.1.1 Leaf Explant Sterilization

3.1.2 Callus Culture Initiation

1. Cut leaves from mother trees in the greenhouse. Optimal stage is fully expanded leaves, still immature (not as glossy as older leaves). 2. Sterilize the leaves for 20 min with 8 % HClO (w/v) and rinse three times with sterile RO water. Cut leaves into small pieces (0.25 cm2) and culture them (four explants per dish) in 5.5 cm diameter Petri dishes containing 12.5 mL C callogenesis medium according to the genotypes (see Subheading 3.1.2). 1. Leaf explants are cultured successively on the two media defined for the Arabica genotypes. First, culture leaf explants on C medium in 5.5 cm diameter Petri dishes (four leaf pieces per plate) for 4 weeks in the dark at 27 °C. 2. Then transfer the leaf explants to ECP medium in baby food jars (25 mL medium) (four leaf pieces per jar) and incubate the baby food jars during 6–8 months under a low-light condition (10 μE/m2/s, 16 h/day, 27 °C) until embryogenic callus appears. The yellow or whitish embryogenic callus appears on the primary necrotic calli that have initially developed on the cut edges (see Note 5).

3.1.3 Establishment of Maintained Embryogenic Callus Cultures

1. Long-term embryogenic cultures are successfully established using the initial embryogenic callus and by monthly transferring yellowish fragments collected on the upper part of embryogenic calli on fresh semisolid ECP medium. Embryogenic callus cultures are maintained in the dark at 27 °C. 2. Culture aging directly affects the success of transformation. It has been shown that the optimal culture duration is between 7 and 16 months during which the callus cultures are particularly rich in proembryogenic masses (PEMs). PEMs are the target cells for A. tumefaciens transformation.

3.1.4 Callus Culture Preparation for Transformation

3.1.5 Agrobacterium tumefaciens Culture Preparation

1. Three weeks before transformation, yellowish callus fragments are transferred to ECP medium to be bulked up for transformation. 2. The third week corresponds to exponential growth and tissues are mainly composed of actively proliferating proembryogenic cells. 1. Prepare the A. tumefaciens culture from a −80 °C glycerol stock. To prepare glycerol culture, mix 50 % autoclaved glycerol solution with equal volume of bacterial culture. Deep freeze in −80 °C. 2. Inoculate bacteria from the 25 % glycerol stock to Petri dish of LB agar medium with appropriate antibiotics: kanamycin 50 mg/L and rifampicin 50 mg/L.

Coffee (Coffea arabica L.)

283

3. Select one colony and inoculate bacteria in 50 mL Erlenmeyer flask containing 10 mL LB liquid medium with appropriate antibiotics: kanamycin 50 mg/L and rifampicin 50 mg/L supplemented with acetosyringone at a final concentration of 100 μM. 4. Grow the bacteria overnight on a shaker incubator (100 rpm, at 28 °C) until the optical density (OD) reaches 0.6–0.8 (OD600nm) (see Notes 6 and 7). 5. Centrifuge the bacteria (2,500 × g, for 10 min), and resuspend in a 10 mL of ECP liquid medium supplemented with 100 μM acetosyringone. It is not required to check OD at that point. 6. Gently shake the bacterial suspension during 1 h at room temperature before use it for tissue infection. 3.1.6 Infection and Cocultivation

1. Submerge the embryogenic calli directly in the baby food jars in which they are cultivated with 10 ml A. tumefaciens suspension for 10 min without agitation. Do not close the jars during this period to avoid ethylene accumulation. 2. The excess of suspension is removed and the inoculated tissues are cocultivated at 20 °C in the dark for 3–5 days. After this period the callus tissues are transferred in new sterile baby food jars and then rinsed twice with 20 mL sterile water. Finally, 20 mL ECP medium containing 1.2 g/L cefotaxime is added in each jar. Cultures are placed on a rotary shaker at 90 rpm during 3 h. 3. After this time the liquid is removed and the calli are rinsed with ECP medium during 15 min. 4. The liquid is removed and the tissues are gently blotted on sterile Whatman paper to remove excess bacterial solution. They are subsequently placed in Petri dishes containing ECP medium with 500 mg/L cefotaxime. From each initial jar, embryogenic calli subjected to transformation treatment are transferred to 3–4 Petri dishes (20 micro-calli/90 mm Petri dish). Cultures are placed in the dark at 27 °C for 4 weeks.

3.1.7 Selection and Regeneration

1. After decontamination, the cultures are subcultured every 4 weeks twice on R regeneration medium containing 17.76 μM 6-BAP and 100 mg/L hygromycin (with pMDC32 plasmid) or 400 mg/L kanamycin (with pBIN19 plasmid) and decreasing cefotaxime concentrations (250, 125 mg/L) (see Note 8). The cultures will turn brown progressively during the second subculture (see Fig. 1a). 2. The cultures are then subcultured twice on M maturation medium containing 1.35 μM 6-BAP, 100 mg/L hygromycin, and 125 mg/L cefotaxime. Embryogenic calli and then somatic embryos resistant to hygromycin will appear during this period (see Fig. 1b, c).

284

Eveline Déchamp et al.

Fig. 1 Regeneration of transformed coffee plants from maintained embryogenic cultures [43]. (a) Calli in selective media containing 100 mg/L hygromycin and 125 mg/L cefotaxime, 4 months after cocultivation with A. tumefaciens LBA1119 without plasmid, used as a control. (b) Regeneration of resistant calli in selective media containing 100 mg/L hygromycin and 125 mg/L cefotaxime, 4 months after cocultivation with A. tumefaciens LBA1119 carrying pMDC32; the yellow calli are resistant to hygromycin. (c) Regeneration of torpedo-shaped somatic embryos 6 months after cocultivation. (d) In vitro plantlet development 8 months after cocultivation. (e) Acclimatization of transgenic plants in the greenhouse 12 months after cocultivation

3. The other subcultures are carried out on M maturation medium containing 1.35 μM 6-BAP devoid of cefotaxime and hygromycin until plantlet development (see Fig. 1e). Several embryos and plants frequently regenerate from each resistant callus (see Fig. 1d). 4. Ten months after cocultivation, the plantlets are acclimatized in the greenhouse. During the entire regeneration process, the cultures are maintained under a 14 h photoperiod (20 μmol/ m2/s light intensity) at 26 °C until acclimatization.

Coffee (Coffea arabica L.) 3.1.8 Molecular Analysis of Transgenic Plants

285

1. Stable expression of GFP is evaluated 30 days after Agrobacterium inoculation to assess the transformation efficiency. The plant tissues are screened for GFP expression using a Leica MZ Fluo III (optic 0.63 Zeiss) fluorescence microscope supplied with a DC 300F camera (Leica Microsystems, Wetzlar, Germany) with plant GFP filter no. 3 from Leica: excitation wavelengths, 470–540 nm (BP). The autofluorescence from chlorophyll was blocked using a red interference filter. 2. Polymerase chain reaction (PCR) and Southern analysis are performed using DNA from coffee leaves to verify the transgenic nature. Genomic DNA extraction is performed using a Qiagen® kit.

3.2 Hairy Root Regeneration Using A. rhizogenes 3.2.1 Seed Sterilization and Zygotic Embryo Germination

1. Seed sterilization: Remove the parchment from the coffee beans by hand. Sterilize by immersing the beans in seed surface disinfectant solution. Stir for 5 min, apply a vacuum for 20 min, and then stir for 5 min. Rinse three times in sterile water. 2. Soaking: Divide the seeds up into 10 cm diameter Petri dishes (2 cm deep), containing sterile water, and place in the dark at 27 °C. Under these conditions the seeds will be totally imbibed after 48–72 h. 3. Embryo extraction: Remove the pergamine. Use a scalpel to remove the endosperm over the embryo, cutting from the root pole toward the cotyledons. Then extract the embryo levering it out from the root pole with the same scalpel blade. 4. Germination: Culture the zygotic embryos in 5.5 cm diameter Petri dishes (three embryos/dish and 12.5 mL of medium) on semisolid GER medium. Place the dishes in the dark at 27 °C for 8 weeks. At the end of that period, the embryos will have started germinating; they will have a 12 mm long hypocotyl and a root about 10 mm long.

3.2.2 Transformation and Hairy Root Induction

1. Grow the A. rhizogenes strain (with the appropriate construct) from a −80 °C 25 % glycerol stock on MYA semisolid medium with appropriate antibiotics. The bacteria should be grown at 28 °C for 48 h to be used directly for genetic transformation. 2. Use a scalpel with a blade contaminated by drawing it over the bacterium culture. 3. Make a 2 mm long wound in the hypocotyl of the zygotic embryos with the contaminated blade. 4. Culture the wounded embryos in 5.5 cm diameter Petri dishes (three embryos/dish) containing sucrose-free GER medium. Place the dishes in the dark at 18 °C for 2 weeks (see Note 9). 5. After coculturing, rinse the embryos for 2 h in liquid GER medium containing 500 mg/L of cefotaxime. Cut the taproot well above the collar and discard (see Note 10).

286

Eveline Déchamp et al.

Fig. 2 Regeneration of Coffea arabica transgenic roots (“hairy roots”) using Agrobacterium rhizogenes [33, 34]. (a) Regeneration of a transgenic C. arabica root at the wounded and infected site (hypocotyl) 6 weeks after transformation. Bar = 0.4 cm. (b) Several 4 to 6 cm long roots develop from the inoculation site. (c) Composite plants ready for transfer to greenhouse. (d) C. arabica composite plants in soil substrate ready for nematode inoculation in resistance tests. (e) Histochemical localization of β-glucuronidase (GUS) gene expression in transgenic roots of C. arabica transformed with the p35S-gusA-int gene construct. The blue staining allows the localization of tissues that actively express the chimeric GUS gene. The staining is strong in all the meristematic regions and central cylinders. Bar = 3 mm. (f) Axenic culture of hairy roots of C. arabica cv. Caturra; long-term maintenance in the presence of IBA in the dark

6. Culture the infected embryos (three embryos/5.5 cm dish) on GER medium with 500 mg/L cefotaxime under low light (10 μE/m2/s), with a 14 h photoperiod at 27 °C for 4 weeks. Transgenic roots will appear after 3 weeks at the wound and bacterium inoculation site (see Fig. 2a). 7. Transfer the embryos (three embryos/dish) to 2.5 × 10 cm Petri dishes containing GER medium + 250 mg/L cefotaxime

Coffee (Coffea arabica L.)

287

under the same incubation conditions for 4 weeks. Several 4–6 cm long roots will develop from the inoculation site (see Fig. 2b). 8. Culture the embryos again on GER medium + 150 mg/L cefotaxime (2 embryos/dish) under same conditions for another 4 weeks. 9. At this time, the transgenic roots (hairy roots) will be highly branched. One well-branched transgenic root can be conserved on the non-transformed germinated embryo to obtain a composite plant, i.e., transformed rootstock on a non-transformed aerial part (see Figs. 2c, d). The highly branched transgenic roots can be sectioned (see Note 11). They should then be grown in the dark on GER medium supplemented with 2.5 μM IBA in 10 cm diameter Petri dishes (see Note 12). The culture can be maintained for long period by fresh transfers to this nutrient medium every 4 weeks at 27 °C (see Fig. 2f). 3.2.3 Molecular Analysis of Hairy Roots

1. Histochemical GUS assay (see Fig. 2e): To assay GUS activity, drench sectioned hairy roots with a staining solution containing 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronide (X-Gluc), and incubate overnight at 37 °C, as indicated by Jefferson [52]. To confine the localization of the blue staining, add 0.5 mM K3Fe(CN)6 and 0.5 mM K4Fe(CN)6 as catalysts. 2. DNA extraction from hairy roots: For DNA isolation from root tissue, 1 g fresh weight can be either lyophilized or ground under liquid nitrogen into a fine powder using a mortar and pestle. Transfer the tissue powder to a 2 mL tube. Lyophilized samples can be stored at 4 °C and disrupted at ambient temperature, while frozen samples should be stored at −80 °C. When grinding plant tissue, sample tubes should be kept in liquid nitrogen and the sample not allowed to thaw. DNeasy® Plant Mini Kit N 69104 (Qiagen®) showed to be an appropriate procedure to obtain adequate purified DNA concentration (>20 μg) required for following molecular analysis. 3. PCR analysis: Use hairy roots that display a positive reaction to the GUS histochemical test. DNA from transformed roots was extracted using the DNeasy® Plant Mini Kit N 69104 (Qiagen®). For amplification of a 584-bp fragment of the gus (uidA) gene use primers 5′-GAATGGTGATTACCGACGAAA-3′ and 5′-GCTGAAGAGATGCTCGACTGG-3′. The PCR mixture should consist of 5 μL (5 ng) of plant DNA, 2.5 μL of 10× Taq buffer (Promega), 1.5 μL of 25 mM MgCl2, 1.0 μL of 5 mM deoxynucleotide triphosphate (dNTP), 0.25 μL of Taq DNA polymerase (5 U/μL Promega), 1 μL from each 10 pmol primer, and 12.75 μL of sterile distilled water. Perform PCR analysis with a PTC-100 Programmable Thermal Controller (MJ Research Inc., San Francisco, CA). Heat samples to 94 °C

288

Eveline Déchamp et al.

for 5 min, followed by 29 cycles at 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min, and then 56 °C for 10 min. Separate amplified products by electrophoresis on 1.0 % agarose gels with 0.5 mg/L ethidium bromide in 0.5× TAE and detect by fluorescence under ultraviolet light.

4

Notes 1. Tests showed that this methodology also worked with somatic embryos and could therefore be used on heterozygous materials. 2. Screenable marker: We used the reporter gene GFP5 isolated from Aequorea victoria jellyfish coding for green fluorescent protein. The gene was controlled by the constitutive cauliflower mosaic virus (CaMV) 35S promoter. 3. Selectable marker: We used the hygromycin phosphotransferase gene (HPTII) isolated from E. coli conferring resistance to hygromycin for selection of transformed cells and regeneration of transgenic plants. 4. Five Agrobacterium rhizogenes wild strains were compared for transformation efficacy: 1583 also called A4 (agropin mannopin strain), ARqua1 (agropin mannopin strain), 1724 (mikimopin strain), 2659 (cucumopin strain), and 8196 (mannopine strain). The A4 strain was the most efficient (80 % transformation efficacy), then ARqua1 (30 %), 1724 (10 %), and 2659 (5 %). Hairy roots were not obtained with the 8196 strain. 5. The transformation frequency (number of transformed calli/ total number of calli subjected to the transformation treatment × 100) is variable from one genotype to another. For C. arabica, the process is efficient and reliable; the transformation efficiency can vary between 50 and 90 % depending on the genotype and the quality of the embryogenic tissues. 6. Both YEP and LB (10 g/L bacto-tryptone, 10 g/L yeast extract) media can be used for bacteria growing. However, Agrobacterium grows slightly slower in Luria-Bertani (LB) medium than in YEP medium. 7. Several binary plasmids have been successfully used for coffee transformation (pBIN19, pCAMBIAA1, PMDC32). 8. Hygromycin is the most efficient antibiotics for coffee transformation [43]. If kanamycin is used, it should be used at high concentrations (more than 400 mg/L). 9. The temperature during the coculturing stage had a marked effect on transformation efficiency with A. rhizogenes. For example, the results obtained were 70–80 % for embryos transformed at 18 °C and 20–30 % at 27 °C [33].

Coffee (Coffea arabica L.)

289

10. We discovered competition in the growth of the two types of roots. Eliminating the non-transgenic taproot encouraged the development of transgenic roots. 11. Hairy roots must be sufficiently developed before being sectioned for them to develop autonomously. 12. Coffee tree hairy roots need an exogenous supply of auxin to grow. The nature and concentration of the auxin affect their development. References 1. Bertrand B, Etienne H, Cilas C et al (2005) Coffea arabica hybrid performance for yield, fertility and bean weight. Euphytica 141:255–262 2. Bertrand B, Alpizar E, Llara L et al (2011) Performance of Arabica F1 hybrids in agroforestry and full-sun cropping systems in comparison with pure lines varieties. Euphytica 181: 147–158 3. Leroy T, Montagnon C, Cilas C (1997) Reciprocal recurrent selection applied to Coffea canephora Pierre. III Genetic gains and results of first cycle intergroup crosses. Euphytica 95:347–354 4. Capot J (1977) L’amélioration du caféier Robusta en Côte d’Ivoire. Café Cacao Thé 21: 233–244 5. Estruch JJ, Carozzi NB, Desai N et al (1997) Transgenic plants: an emerging approach to pest control. Nature Biotech 15:137–141 6. Schuler TH, Poppy GM, Kerry BR et al (1998) Insect-resistant transgenic plants. Tib Technol 16:168–175 7. Guerreiro O, Denolf P, Peferoen M et al (1998) Susceptibility of the coffee leaf miner (Perileucoptera spp.) to Bacillus thuringiensis δ-endotoxins : a model for transgenic perennial crops resistant to endocarpic pests. Curr Microbiol 36:175–179 8. Dandekar AM, McGranahan GH, Vail PV et al (1998) High levels of expression of full-length cryIA(c) gene from Bacillus thuringiensis in transgenic somatic walnut embryos. Plant Sci 131:181–193 9. Surekha K, Royer M, Naidu R, et al. (2002) Bioassay of Bacillus thuringiensis toxins against two major coffee pests, ie coffee berry borer (Hypothenemus hampei) and coffee white stem borer (Xylotrechus quadripes). In: SIP (eds) Annual meeting of the society for invertebrate pathology. 35, 2002/08/18-23, Foz de Iguassu, Brésil, Program and Abstracts, p 85 10. Perthuis B, Pradon J, Montagnon C et al (2005) Stable resistance against the leaf miner

11.

12.

13.

14.

15.

16.

17.

18.

Leucoptera coffeella expressed by genetically transformed Coffea canephora in a pluriannual field experiment in French Guiana. Euphytica 144:321–329 Campos VP, Sivapalan P, Gnanapragasam NC (1990) Nematode parasites of coffee, cocoa and tea. Luc M., Sikora RA., Bridge J eds. Plant-parasitic nematodes in subtropical and tropical agriculture. CAB International, In, pp 113–126 Noir S, Anthony F, Bertrand B et al (2003) Identification of a major gene (Mex-1) from Coffea canephora conferring resistance to Meloidogyne exigua in Coffea arabica. Plant Pathol 52:97–103 Christey MC (2001) Use of Ri-mediated transformation for production of transgenic plants. In Vitro Cell Dev Biol-Plant 37:687–700 Veena V, Taylor CG (2007) Agrobacterium rhizogenes: recent developments and promising applications. In Vitro Cell Dev Biol-Plant 43: 383–403 Jian B, Hou W, Wu C et al (2009) Agrobacterium rhizogenes-mediated transformation of Superroot-derived Lotus corniculatus plants: a valuable tool for functional genomics. BMC Plant Biol 9:78. doi:10.1186/1471-2229-9-78 Van der Vossen HAM (2005) State of the art of developing durable resistance to biotrophic pathogens in crop plants, such as coffee leaf rust. In: Zambolim E, Zambolim M, Varzea VMP (eds) Resistance to Coffee Leaf Rust. Brazil, Vicosa, p 305 Mahé L, Combes MC, Varzea VMP et al (2008) Development of sequence characterized DNA markers linked to leaf rust (Hemileia vastatrix) resistance. Mol Breeding 21:105–113 Lashermes P, Combes MC, Ribas A et al (2010) Genetic and physical mapping of the SH3 locus that confers resistance to leaf rust in coffee (Coffea arabica L.). Tree Gen Gen 6:973–980

290

Eveline Déchamp et al.

19. Ribas A, Cenci A, Combes M-F et al (2011) Organization and molecular evolution of a disease-resistance gene cluster in Coffee trees. BMC Genomics 12:240, http://www. biomedcentral.com/1471-2164/12/240 20. Etienne H, Anthony F, Dussert S et al (2002) Biotechnological applications for the improvement of coffee (Coffea arabica L.). In Vitro Cell Dev Biol- Plant 38:129–138 21. De Los Santos-Briones C, HernándezSotomayor SMT (2006) Coffee biotechnology. Braz J Plant Physiol 18:217–227 22. Marraccini P, Freire LP, Alves GSC et al (2011) RBCS1 expression in coffee: Coffea orthologs, Coffea arabica homeologs, and expression variability between genotypes and under drought stress. BMC Plant Biol 11:85 23. Marraccini P, Pereira LPP, Ferreira LP et al (2003) Biochemical and molecular characterization of enzyme controlling sugar metabolism during coffee bean development. ISPMB conference, Barcelona (Spain), 23–28 June 2003, poster S19–14 24. Marraccini P, Deshayes A, Pétiard V et al (1999) Molecular cloning of the complete 11S seed storage protein gene of Coffea arabica and promoter analysis in transgenic tobacco plants. Plant Physiol Biochem 37:273–282 25. Petitot AS, Barsalobres-Cavallari C, Ramiro D et al (2013) Promoter analysis of the WRKY transcription factors CaWRKY1a and CaWRKY1b homoeologous genes in coffee (Coffea arabica). Plant Cell Rep 32(8):1263– 1276, doi:1007/s00299-013-1440-3 26. Lashermes P, Combes MC, Prakash NS et al (2001) A genetic linkage map of Coffea canephora: effect of segregation distortion and analysis of recombination rate in male and female meiosis. Genome 44:589–595 27. Leroy T, De Bellis F, Legnate H et al (2011) Improving the quality of African robustas: QTLs for yield- and quality-related traits in Coffea canephora. Tree Genetics & Genomes 7:781–798 28. Leroy T, Marraccini P, Dufour M et al (2005) Construction and characterization of a Coffea canephora BAC library to study the organization of sucrose biosynthesis genes. Theor Applied Genet 111:1032–1041 29. Denoeud F, Carretero-Paulet L, Dereeper A et al (2014) Structure and adaptive landscape of the coffee genome. Science (in press) 30. Barton CR, Adams TL, Zarowitz MA (1991) Stable transformation of foreign DNA into Coffea arabica plants. In: ASIC (eds) 14th International colloquium on coffee science, San Francisco (USA), 14–19 July 1991, ASIC, Paris (France), pp 853–859

31. Feng Q, Yang MZ, Zheng XQ et al (1992) Agrobacterium mediated transformation of coffee (Coffea arabica L.). Chn J Biotech 8:255–260 32. Freire AV, Lightfoot DA, Preece JE (1994) Genetic transformation of coffee (Coffea arabica L.) by Agrobacterium spp. Hortsci 29:454 33. Alpizar E, Dechamp E, Espeout S et al (2006) Efficient production of Agrobacterium rhizogenes-transformed roots and composite plants for studying gene expression in coffee roots. Plant Cell Rep 25:959–967 34. Alpizar E, Dechamp E, Guilhaumon C et al (2008) Agrobacterium rhizogenes-transformed roots of coffee: conditions for long-term proliferation, morphological and molecular characterization. Ann Bot 101:929–940 35. Spiral J, Pétiard V (1993) Développement d'une méthode de transformation appliquée à différentes espèces de caféiers et régénération de plantules transgéniques. In: ASIC (eds) 15th International colloquium on coffee science, Montpellier (Fra), 6–11 June 1993, ASIC, Paris (France), pp 115–122 36. Spiral J, Thierry C, Paillard M et al (1993) Obtention de plantules de Coffea canephora Pierre (Robusta) transformées par Agrobacterium rhizogenes. C R Acad Sci Paris 316:1–6 37. Sugiyama M, Matsuoka C, Takagi T (1995) Transformation of coffee with Agrobacterium rhizogenes. In: ASIC (eds) 16th International colloquium on coffee science, Kyoto (Jap), 9–14 April 1995, ASIC, Paris (France), pp 853–859 38. Hatanaka T, Choi YE, Kusano T et al (1999) Transgenic plants of coffee Coffea canephora from embryogenic callus via Agrobacterium tumefaciens-mediated transformation. Plant Cell Rep 19:106–110 39. Leroy T, Paillard M, Royer M et al (1998) Introduction de gènes d’intérêt agronomique dans l’espèce Coffea canephora Pierre par transformation avec Agrobacterium sp. In: ASIC (eds) 17th international colloqium on coffee science, Nairobi (Kenya), 20–25 July 1997, ASIC, Paris, pp 439–445 40. Leroy T, Henry AM, Royer M et al (2000) Genetically modified coffee plants expressing the Bacillus thuringiensis cry1Ac gene for resistance to leaf miner. Plant Cell Rep 19:382–389 41. Etienne H, Bertrand B, Georget F et al (2013) Development of coffee somatic and zygotic embryos to plants differs in the morphological, histochemical and hydration aspects. Tree Physiol 33:640–653 42. Bobadilla Landey R, Cenci A, Georget F et al (2013) High genetic and epigenetic stability in Coffea arabica plants derived from embryogenic suspensions and secondary embryogenesis as

Coffee (Coffea arabica L.)

43.

44.

45.

46.

47.

revealed by AFLP, MSAP and the phenotypic variation rate. PloS ONE 8(2):e56372. doi:10.1371/journal.pone.0056372 Ribas A, Dechamp E, Bertrand B, Champion A et al (2011) Agrobacterium tumefaciensmediated genetic transformation of Coffea arabica (L.) is highly enhanced by using long-term maintained embryogenic callus. BMC Plant Biol 11:92, doi:10.1186/1471-2229-11-92. h t t p : / / w w w. b i o m e d c e n t r a l . c o m / 1471-2229/11/92 Mugnier J (1988) Establishment of new axenic hairy root lines by inoculation with Agrobacterium rhizogenes. Plant Cell Rep 7:9–12 Kifle S, Shao M, Jung C et al (1999) An improved transformation protocol for studying gene expression in hairy roots of sugar beet (Beta vulgaris L.). Plant Cell Rep 18:514–519 Bertrand B, Anthony F, Lashermes P (2001) Breeding for resistance to Meloidogyne exigua in Coffea arabica by introgression of resistance genes of Coffea canephora. Plant Pathol 50:637–643 Bevan M (1984) Binary Agrobacterium vectors for plant transformation. Nucleic Acids Res 12:8711–8721

291

48. Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133:462–469 49. Etienne H (2005) Protocol of somatic embryogenesis: coffee (Coffea arabica L. and C. canephora P.). In: Jain SM, Gupta PK (eds) Protocols for somatic embryogenesis in woody plants series: forestry sciences, vol 77. Springer, Deutschland, pp 167–179. ISBN 1-4020-2984-5 50. Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473–497 51. Jouanin L, Tourneur J, Casse-Delbart F (1986) Restriction maps and homologies of the three plasmids of Agrobacterium rhizogenes strain A4. Plasmid 16:124–134 52. Jefferson R (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol Rep 5:387–405 53. Vancanneyt G, Schmidt R, O’Connor-Sanchez A et al (1990) Construction of an introncontaining marker gene. Splicing of the intron in transgenic plants and its issue in monitoring early events in Agrobacterium-mediated plant transformation. Mol Gen Gen 220:245–250

Chapter 23 Pineapple [Ananas comosus (L.) Merr.] Gaurab Gangopadhyay and Kalyan K. Mukherjee Abstract The efficacy of Agrobacterium-mediated pineapple transformation technique has been improved (mean percentage of transgenic micro-shoots regenerated from initial callus explants up to 20.6 %) using a novel encapsulation-based, antibiotic selection procedure. The detailed protocol using a standard plant transformation vector (pCAMBIA1304) as reported in an ‘elite’ Indian variety (Queen) of pineapple [Ananas comosus (L.) Merr] can be applied to other varieties of pineapple for introgression of target genes. Key words Agrobacterium tumefaciens, Antibiotic selection, Encapsulation, Pineapple, Transformation

1

Introduction Pineapple [Ananas comosus (L.) Merr, family Bromeliaceae] is considered as one of the most economically important tropical fruits. It is the number one agricultural commodity in certain parts of the world. However, its production often becomes severely limited due to a number of soilborne pathogens (http://www.nhb. gov.in/fruits/pineapple/pin002.pdf) since the normal practice of its propagation is through “crowns” (“tops”) and slips (side shoots arising in older leaf axils) (http://www.uga.edu/fruit/pinapple. htm). Classical pineapple plant breeding is based on crosses, backcrosses, and selection [1]. Because of the long generation cycle of pineapple, the conventional breeding programs are extremely time-consuming and can hardly keep pace with the rapid evolution of pathogenic fungi [2]. Genetic engineering is an attractive tool for improving elite pineapple clones. This has been attempted with varying degrees of success either through micro-projectile-mediated gene delivery [3, 4], selection by micropropagation in temporary immersion bioreactors (TIBs) [5], or Agrobacterium-mediated transformation [6] techniques. The target explants for cocultivation vis-à-vis transformation range from leaf bases of micropropagated shoots [3] to embryogenic cell clusters [6]/callus pieces [4, 5].

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_23, © Springer Science+Business Media New York 2015

293

294

Gaurab Gangopadhyay and Kalyan K. Mukherjee

Each gene delivery system and choice of target tissue has its own inherent advantage as well as limitations. Of the three gene delivery systems, the biolistic and use of temporary immersion bioreactors seem to be more technically demanding in comparison to the Agrobacterium-mediated transformation, which has delivered success in most of the plant system targeted for transgenic production till date. Regarding the target explant, which would show high regeneration frequency after cocultivation either through organogenesis or somatic embryogenesis, direct organogenesis from explants or an intermediate callus stage is a preferred one over regeneration from long-term maintained embryogenic calli or cell clusters due to relative higher frequency of the former than the latter. Finally, the efficacy of any transformation program for large-scale production depends on stringent selection as far as practicable so that “true targeted” transgenics can be picked up rightly from the large “crowd” of “false-positive antibiotic/GUS.” This is evident in the entire successful pineapple transformation programs where relatively few transgenic lines have been confirmed by the workers in spite of obtaining a large number of GUS-positive regenerants/transformants initially. The biolistic approach provided an “acceptable efficiency of 0.21– 1.5 %” in case of ‘Smooth Cayenne’ cultivar of pineapple [4], while an “efficiency of 6.6 % of transgenic plant recovery” was reported [5]. This cultivar while worked out with Agrobacteriummediated transformation technique again encountered a large number of escape plants, which was gradually eliminated through a very rigorous and time-consuming “stepwise selection” procedure [6]. Furthermore, regeneration from embryogenic callus pieces with occasional somaclonal variation was another bottleneck with this approach [6]. Considering all these factors, the present protocol of an Agrobacterium-mediated transformation for pineapple using a standard plant transformation vector (pCAMBIA1304) with subsequent encapsulation-based novel antibiotic selection technique was designed to minimize the occurrence of false-positive plants, which in consequence would elevate the transformation frequency. Precisely, in this two-step selection protocol, micro-shoots regenerating from the organogenic calli after cocultivation and initial screening in agar-gelled media for antibiotic resistance were encapsulated in alginate beads containing hygromycin, the selection antibiotic. The hypothesis was the alginate beads containing sublethal concentration of antibiotic would provide a uniform environment for selection to the entrapped micro-shoot that has overcome the first step of screening in antibiotic containing agar-gelled media. This endeavor of stringent selection resulted in higher transformation frequency (mean percentage of transgenic micro-shoots regenerated from initial organogenic callus explants up to 20.6 %). The work was reported by our group in ‘elite’ Indian variety (Queen) of pineapple [7]. The scheme of this protocol is presented in Fig. 1.

Pineapple [Ananas comosus (L.) Merr.]

295

Establishment of aseptic culture Step

Action

1

Surface sterilization and culture of meristems with leaf primordia from the innermost leaves in RM2

2

Subculture of the responding explants in RM2

Day of Action/observation 1

30

45-55

3

Plantlets separated out aseptically and subcultured individually in maintenance media in MM

Events

Regeneration plantlets from bases

of leaf

60

Establishment of regeneration system suitable for transformation 1

Culture of excised meristematic leaf base regions of the aseptically maintained plantlets in RM1

1

30-40

10 mm

Development of organogenic calli

Fig. 1 Scheme of the entire protocol

296

Gaurab Gangopadhyay and Kalyan K. Mukherjee

Agrobacterium mediated transformation followed by encapsulation based selection Step 1

2

Action Infection of organogenic callus pieces (explants) with Agrobacterium followed by co cultivation in induction media (RM1 + acetosyringone)

Transfer of explants to agar gelled selection media (containing 20 mg /L hygromycin)

Day of Action/observation 1

Efficiency cascade

100 explants per experimental set (total 408 infected in four sets)

4

3

Same as above but media containing 30 mg /L hygromycin

11

4

Same as above but media containing 40 mg /L hygromycin

18

Same as above but media containing 50 mg /L hygromycin

25

6

Same as above but media containing 60 mg /L hygromycin

32

~65 – 70 explants

7

Encapsulation of micro shoots (excised aseptically from regenerated calli, individual micro shoot ~1.5 – 2.0 mm long, rate of regeneration 6-10 per explant) in Ca-alginate beads containing 60 mg /L hygromycin; beads kept in sterile petri dishes under culture room conditions

40

~500 micro shoots

5

Fig. 1 (continued)

10 mm

Pineapple [Ananas comosus (L.) Merr.]

Step

Action

8

Day of Action/observation

70

297

Efficiency cascade (per experimental set)

~275 micro shoots

Growth of hygromycinresistant micro shoots rupturing the beads

9

10

11

Histochemical GUS assay of portions of the selected micro shoots

Multiplication of the selected trasformants in RM2 for three successive sub cultures of three weeks each (~60 days)

PCR analysis with uidA gene specific primers of the selected plantlets micro propagated in MM, followed by Southern Hybridization

Fig. 1 (continued)

70

36% GUS positive (99/275)

130

135 onwards

The uidA fragment (1051 bp) amplified in DNA samples from ~85% plantlets (84/99); 30.54% considering the total number of viable micro shoots (84/275); 20.58% considering the initial infected callus explants (84/408). All randomly selected plantlets showed low to moderate copy number of gene integration.

298

2 2.1

Gaurab Gangopadhyay and Kalyan K. Mukherjee

Materials Plant Material

2.2 Agrobacterium tumefaciens Vectors and Strains

2.3 Plant Culture Media

‘Elite’ Indian variety (Queen) of field-grown pineapple was used in the works reported earlier [8]. A. tumefaciens (strain LBA4404) harboring the binary vector pCAMBIA1304 (12,361 bp; Centre for Application of Molecular Biology to International Agriculture, Australia) was used for transformation. The T-DNA contains hygromycin phosphotransferase II (hptII), the hygromycin plant selection gene, and the reporter genes mgp5 (modified green fluorescent protein) and uidA (β-glucuronidase). All these genes are driven by CaMV35S (cauliflower mosaic virus 35S) promoter. 1. Maintenance Medium (MM): Full-strength MS basal medium [9] supplemented with myoinositol (100 mg/l), sucrose (30 g/l), agar (0.75 %), 6-benzylaminopurine (BAP, 1 mg/l), and indole-3-acetic acid (IAA, 0.1 mg/l). 2. Regeneration Medium 1 (RM1): Similar to MM except the growth regulators—6-benzylaminopurine (BAP, 10 mg/l) and 1-naphthaleneacetic acid (NAA, 10 mg/l). 3. Regeneration Medium 2 (RM2): Similar to RM1 except the growth regulators—6-benzylaminopurine (BAP, 5 mg/l) and indole-3-acetic acid (IAA, 0.5 mg/l). 4. Liquid Rooting Medium (LRM): Basal MS medium without agar, supplemented with IAA (1 mg/l) as the sole growth regulator. 5. The pH of media is to be adjusted to 5.6 with KOH/HCl (1 N) before the addition of gelling agent and autoclaving at 121 °C, 104 kPa for 15 min. All media (except LRM) are to be solidified with 0.75 % agar to obtain gel strength of about 800 g/cm2. Cultures are to be kept under a photoperiod of 16 h (white fluorescent light, 40–80 μmol/m2/s) at 25 ± 2 °C and 78 % relative humidity.

2.4 Bacterial Culture Media

1. YEB medium: 0.1 % yeast extract, 0.5 % beef extract, 0.5 % peptone, 0.5 % sucrose, 0.049 % MgSO4, pH 7.2, containing kanamycin (100 mg/l, for pCAMBIA1304 selection) and rifampicin (50 mg/l, for chromosomal background selection) (see Note 1). 2. The autoclaving condition of bacterial culture medium is similar to that of plant culture medium.

2.5 Chemicals, Stock Solutions, and Other Supplies

1. Plant tissue culture general chemicals, vitamins, and growth regulators: SIGMA. 2. Stock solution of BAP: Weigh 10 mg BAP powder and dissolve with 2–3 drops of HCl (1 N), volume to be made up to

Pineapple [Ananas comosus (L.) Merr.]

299

10 ml with double-distilled water (DDW). To be filtersterilized and stored in aliquots at 4 °C. Put in water bath (~35–40 °C prior use). 3. Stock solution of auxins (IAA/NAA): Weigh 10 mg IAA/ NAA powder and dissolve with 2–3 drops of ethanol, volume to be made up to 10 ml with DDW. To be filter-sterilized and stored in aliquots at 4 °C. Put in water bath (~35–40 °C prior use). 4. Presterilized (γ-irradiated; of TARSONS/AXYGEN/others) plastic Petri plates (90 mm and/or 35 mm diameter) are to be used for callus induction/coculture/bacterial culture maintenance. 5. For increased T-DNA transfer, 400 μM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone) is to be used. 6. Filter papers for coculture step: Whatman, qualitative grade 1. 7. CaCl2·2H2O and sodium alginate are to be procured from SIGMA/FLUKA. 8. X-Gluc (5-bromo-4-chloro-3-indolyl SIGMA preferably is to be used.

glucuronide)

from

9. Genomic DNA of control and putative transgenic plants can be isolated using the Qiaquick DNeasy Plant Kit (Qiagen) or any other standard kit of reputed manufacturer. 10. Primers were obtained from MWG Biotech (AG, Ebersberg, Germany) and can be procured from any reputed company. 11. PCR components were procured from SibEnzyme and can be obtained from any reputed company dealing with molecular biology products. 12. PCR amplification can be carried out with thermal cycler machine of any reputed make like MJ Research, Applied Biosystems, and Bio-Rad. 13. Agarose (DNase/RNase-free) and ethidium bromide are to be procured from SIGMA/Invitrogen/Bioline. 14. Tris (tris(hydroxymethyl)aminomethane), EDTA (ethylenediaminetetraacetic acid), and other components for buffer preparation should be DNase/RNase-free and of reputed make. 15. Restriction enzymes (e.g., EcoRI and BamHI) are to be procured from Fermentas, Life Sciences, NEB etc. 16. For Southern hybridization nylon membrane (Hybond N+) of Amersham (GE Healthcare Life Sciences) can be used. 17. Rediprime II Random Labeling Kit of Amersham (GE Healthcare Life Sciences) can be used for random priming.

300

3

Gaurab Gangopadhyay and Kalyan K. Mukherjee

Methods

3.1 Establishment and Aseptic Maintenance of Plant Cultures

1. Meristems with leaf primordia from the innermost leaves (numbers 3–6 from the stem apex, each ~0.5–1.5 cm long) from the crowns of any pineapple variety of interest are to be used as explants. 2. Explants are to be thoroughly washed with few drops of Tween 20 (surfactant). 3. Explants are subsequently surface-sterilized with 0.25 % (w/v) mercuric chloride for 5–10 min (see Note 2) followed by rinsing with sterile DDW four times in laminar flow hood chamber. Plantlets regenerate in tuft from the sheathing leaf bases by direct organogenesis in this stage in RM2 (Regeneration Medium 2). 4. Each plantlet is separated out aseptically and those are to be maintained in vitro in MM (Maintenance Medium) as the stock culture for regeneration and transformation experiments.

3.2 Establishment of Plant Regeneration System Suitable for Transformation

1. Excised meristematic leaf base regions (leaves are to be taken from the in vitro maintained aseptic plantlets) are cultivated in Petri dishes (35 mm diameter, sterile) on RM1 (Regeneration Medium 1). 2. Highly regenerating organogenic calli persistently giving rise to adventitious shoot bud-like structures by repetitive organogenic calli will be obtained within 4–5 weeks. 3. Those calli are to be used as the starting explants for subsequent Agrobacterium infection. 4. A set of leaf base regions has to be monthly transferred on induction medium in order to obtain a continuous supply of suitable explants for carrying out the transformation experiments.

3.3 Maintenance of Bacterial Culture

3.4 Inoculation and Cocultivation

A 50 ml bacterial culture initiated from a single Agrobacterium colony is to be grown overnight (28 °C, 180 rpm) in sterile YEB medium. 1. After attaining an optical density (absorbance) of 1.0 at 600 nm, the bacterial cultures are to be centrifuged at 2,712 × g for 5 min (20 °C). 2. The supernatant has to be discarded and the pellet resuspended in 10 ml of 10 mM MgCl2. 3. After centrifugation at 2,712 × g for 5 min, the washed bacterial pellet is to be resuspended by shaking at 100 rpm for 2 h with 10 ml of MS basal liquid medium (without agar, pH 5.6) devoid of growth regulator but containing 400 μM acetosyringone (preinduction medium; see Note 3).

Pineapple [Ananas comosus (L.) Merr.]

301

4. Explants (ca. 10 mm callus pieces with initiation of shoot budlike structures) have to be simultaneously excised and aseptically pooled in MS liquid medium without growth regulator. From that pool about 100 explants per experimental set are to be placed in 10 ml of preinduction medium in which 10 ml of preinduced liquid bacterial culture is to be finally added to obtain a 20 ml coculture. 5. Explants are then to be subjected to vacuum infiltration for 5 min in vacuum desiccators followed by shaking at 100 rpm for 2.5 h. Excess of bacterial suspension has to be removed by filtration with sterile filter papers in Büchner funnel (see Note 4), and Agrobacterium-infected explants are placed on semisolid MS induction medium (same as RM1, supplemented with 400 μM acetosyringone, poured in 35 mm Petri plates). 6. The plates are to be left for cocultivation under a photoperiod of 16 h (white fluorescent light, 40–80 μmol/m2/s) at 25 ± 2 °C and 78 % relative humidity. 3.5 Selection of Transformants Prior to Encapsulation

1. The lethal and sublethal doses of cefotaxime (500 and 300 mg/l) and hygromycin (60 and 40 mg/l) have to be determined separately using uninfected control explants. 2. The infected explants are to be transferred after 3 days of cocultivation onto agar-gelled selection medium (poured in 35 mm Petri plates), i.e., MS induction medium supplemented with both decontamination (cefotaxime 300 mg/l) and selective antibiotics (hygromycin B). 3. Explants are to be weekly subcultured on selection medium for 5 weeks with gradual increase of hygromycin concentration (20–60 mg/l in 10 mg intervals).

3.6 Selection of Transformants After Encapsulation in Ca Alginate Beads

1. For stringent antibiotic selection, the surviving cocultivated prescreened explants, i.e., callus pieces starting to give rise to hygromycin-resistant micro-shoots on agar-gelled selection media containing hygromycin of appropriate concentration (sublethal usually 40–50 mg/l; to be standardized earlier), are to be subsequently encapsulated in Ca alginate beads having similar concentration of hygromycin. 2. Explants, now individual micro-shoots (1.5–2.0 mm in length), are collected (50–60 for each concentration of hygromycin) in liquid MS medium (25 ml) without growth regulator and CaCl2·2H2O (see Note 5). 3. The liquid medium containing micro-shoots have to be mixed with an equal volume (25 ml) of the same medium supplemented with 2.5 % (w/v) sodium alginate (see Note 6). The alginate-containing medium (containing micro-shoots) is then

302

Gaurab Gangopadhyay and Kalyan K. Mukherjee

quickly and continuously dropped (100–150 μl) in 100 ml of sterile solution of CaCl2·2H2O (0.17 M) using a sterile pipette (or micropipette having cut tips for dispensing) of the appropriate diameter. The drops (beads) containing single microshoots are to be kept in concentrated CaCl2·2H2O solution for 30 min on a slow gyratory shaker (50 rpm) for proper setting of the beads. 4. The beads then have to be rinsed with sterile DDW for three times and placed in sterile Petri dishes (35 mm in diameter) for incubation in the culture room (see Note 7) under light (as stated in Subheadings 2.3 and 3.4) for 30 days (4–9 beads/ Petri plate). 5. The hygromycin-resistant micro-shoots will grow out by rupturing the beads. Others will turn brown and die within the beads. The chance of obtaining “false-positive antibiotics” is very remote since those have been selected within Ca alginate beads, which have provided a uniform selection gradient unlike in agar-gelled media. 3.7 Histochemical GUS Assay

1. Randomly selected hygromycin-resistant micro-shoots emerging from the beads are subjected to histochemical GUS (betaglucuronidase) assays according to the protocol of Jefferson et al. [10]. 2. The whitish to green basal zones of the micro-shoots are immersed in an X-Gluc (5-bromo-4-chloro-3-indolyl glucuronide) solution (see Note 8). 3. Tissues are incubated overnight in the dark at 37 °C for staining and subsequently cleared using an ethanol series (70, 85, 95, and 100 %, 1 h at each concentration). 4. GUS-positive shoots/tissues turn blue, while the white ones can be discarded as GUS-negative.

3.8 Multiplication of Selected Transformants

1. The hygromycin-resistant and GUS-positive micro-shoots [selected only from the ruptured beads containing high concentration (60 mg/l and beyond) of hygromycin] are to be transferred to Regeneration Medium 2 and cultured for 3 weeks under the cultural conditions as stated in Subheading 2.3, item 5. 2. The proliferated micro-shoots are then to be subcultured every 3 weeks on Maintenance Medium (MM). 3. After 2 months, the healthy shoots can be transferred individually to Liquid Rooting Medium (LRM) under the cultural conditions as stated in Subheading 2.3, item 5 for 90 days before hardening and subsequent transplanting to soil.

Pineapple [Ananas comosus (L.) Merr.]

3.9 Molecular Analysis of Transgenic Plants 3.9.1 PCR Analysis

303

1. Genomic DNA of randomly selected hardened putative transformed and control plants is isolated from 100 mg of leaves following the instruction of kit. 2. PCR analysis of genomic DNA is to be performed with forward (5′-CAACGTCTGCTATCAGCGCGAAGT-3′) and reverse (5′-TATCCGGTTCGTTGGCAATACTCC-3′) primers targeting the uidA gene (size of the PCR product: 1,051 bp). 3. Each PCR reaction is performed in 25 μl total volume consisting of 1× PCR buffer (including MgCl2), 200 μM of each dNTP, 0.4 μM of each primer, 25 ng of genomic DNA, and 1 unit of Taq DNA polymerase. 4. PCR amplifications are carried out in a thermal cycler with an initial denaturation step of 90 s at 94 °C followed by 30 s denaturation at 94 °C, 45 s annealing at 58 °C, and 1 min extension at 72 °C for 30 cycles and 7 min final extension at 72 °C [11]. 5. The PCR products are resolved in 1.6 % agarose gel (TAE, 7 V/cm) and detected by ethidium bromide staining (see Notes 9–10). 6. Specific PCR product of uidA gene (1,051 bp) indicates positive transformants.

3.9.2 Southern Hybridization Analysis

1. For genomic Southern hybridization analysis, approximately 10 μg of total DNA is isolated from both transgenic and nontransformed control shoots following the instruction of DNA isolation kit. 2. DNA of pCAMBIA1304 is to be taken as positive control. 3. All the DNA are digested with two restriction enzymes, EcoRI and BamHI, in order to generate left border and right border junction fragments both as single and double digests (see Note 11). 4. Genomic (10 μg) and pCAMBIA1304 (plasmid-positive control, 5 pg) DNA digests are separated on 0.8 % agarose gels (TAE) overnight at 2 V/cm. 5. The DNA fragments are transferred onto nylon membranes using standard protocols [12]. 6. A PCR-amplified uidA fragment (1,051 bp, primers described in Subheading 3.9.1, step 2) is to be used as a probe after radio labeling [α-(32P) dCTP] by random priming. 7. Hybridization and autoradiography are to be carried out according to standard protocols [12] and instructions of the manufacturers, wherever necessary. 8. Stable integration and copy number estimation of the uidA gene into the genome of transgenic pineapple are detected through positive hybridization signals in comparison to the positive control.

304

4

Gaurab Gangopadhyay and Kalyan K. Mukherjee

Notes 1. Antibiotics are not to be autoclaved along with culture media; rather they are to be added in media from stock solutions after filter sterilization through a 0.2 μ hydrophobic filter in laminar flow hood chamber. Stock solutions of antibiotics can be stored at −20 °C or can be prepared freshly as per need. 2. Concentration of mercuric chloride and the duration of the treatment can be increased considering the rate of contamination vis-à-vis infection-free established explants in culture. Since mercuric chloride is a hazardous chemical, caution is needed to handle the chemical and also to dispose the solution. 3. Acetosyringone dissolves in DMSO (dimethyl sulfoxide). Required amount to be added from prefilter-sterilized stock solution. 4. Porcelain components of Büchner funnel have to be presterilized by autoclaving. 5. The concentration of CaCl2·2H2O has to be pre-standardized (usually it is 0.17 M). 6. The concentration of sodium alginate for optimum gelling has to be pre-standardized. Usually, it is 2.5 % (w/v). Extreme care has to be taken during autoclaving media supplemented with sodium alginate since this chemical has a tendency of losing gelling capacity if over autoclaved. 7. Petri plates for culture/coculture/selection experiments are to be sealed properly with PARAFILM (American National Can) to avoid contamination and losing desirable transformants. 8. X-Gluc solution consists of 2 mM X-Gluc, 100 mM Tris–HCl, pH 7.0, 50 mM NaCl, 2 mM potassium ferricyanide, and 0.1 % v/v Triton X-100. 9. The composition of 50× TAE buffer (100 ml): Tris 24.2 g, glacial acetic acid 5.71 ml, 0.5 M EDTA 10 ml, pH adjusted to 8.0 with HCl. 10. Ethidium bromide is an extremely hazardous chemical; proper care should be taken during weighing and dispensing it. Stock solution: 10 mg dissolved in 1 ml of DDW; for 100 ml of agarose gel, 1–1.5 μl from stock. 11. Unique EcoRI and BamHI restriction sites occur within pCAMBIA1304 T-DNA, 3,650–3,700 bp upstream from the right T-border.

Pineapple [Ananas comosus (L.) Merr.]

305

Acknowledgment A critical reading of the manuscript by Ms. Ranjana Prasad is duly acknowledged. Authors are thankful to the director of Bose Institute. References 1. Botella JR, Cavallaro AS, Cazzonelli CI (2000) Towards the production of transgenic pineapple to control flowering and ripening. Proc 3rd Int Pineapple Symp. Acta Hortic 529:115–122, Subhadrabandhu S, Chairidchai P (eds.) 2. Cabot C, Lacoevilhe JC (1990) A genetic hybridization programme for improving pineapple quality. Acta Hortic 275:395–400 3. Sripaoraya S, Marchant R, Power JB, Davey MR (2001) Herbicide tolerant transgenic Pineapple (Ananas comosus) produced by micro projectile bombardment. Annal Bot (Lond) 88:597–603 4. Ko HL, Campbell PR, Jobin-Décor MP, Eccleston KL, Graham MW, Smith MK (2006) The introduction of transgenes to control Blackheart in Pineapple (Ananas comosus L.) cv. Smooth Cayenne by micro projectile bombardment. Euphytica 150:387–395 5. Espinosa P, Lorenzo JC, Iglesias A, Yabor L, Menendez E, Borroto J, Hernandez L, Arencibia AD (2002) Production of pineapple transgenic plants assisted by temporary immersion bioreactors. Plant Cell Rep 21:136–140 6. Firoozabady E, Hecker M, Gutterson N (2006) Transformation and regeneration of pineapple. Plant Cell Tiss Org Cult 84:1–16

7. Gangopadhyay G, Roy SK, Basu Gangopadhyay S, Mukherjee KK (2009) Agrobacteriummediated genetic transformation of pineapple var. Queen using a novel encapsulation-based antibiotic selection technique. Plant Cell Tiss Org Cult 97:295–302 8. Gangopadhyay G, Bandyopadhyay T, Poddar R, Basu Gangopadhyay S, Mukherjee KK (2005) Encapsulation of pineapple micro shoots in alginate beads for temporary storage. Curr Sci 88:972–977 9. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 10. Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: β-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901–3907 11. Gangopadhyay G, Bandyopadhyay T, Datta S, Basu D, Mukherjee KK (2003) Agrobacterium mediated genetic transformation in Indian Spinach (Beta palonga). Plant Cell Biotechnol Mol Biol 4:193–196 12. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Chapter 24 Sugarcane (Saccharum Spp. Hybrids) Hao Wu and Fredy Altpeter Abstract Genetic transformation of sugarcane has a tremendous potential to complement traditional breeding in crop improvement and will likely transform sugarcane into a bio-factory for value-added products. We describe here Agrobacterium tumefaciens-mediated transformation of sugarcane. Embryogenic callus induced from immature leaf whorls was used as target for transformation with the hypervirulent Agrobacterium strain AGL1 carrying a constitutive nptII expression cassette in vector pPZP200. Selection with 30 mg/L geneticin during the callus phase and 30 mg/L paromomycin during regeneration of shoots and roots effectively suppressed the development of non-transgenic plants. This protocol was successful with a commercially important sugarcane cultivar, CP-88-1762, at a transformation efficiency of two independent transgenic plants per g of callus. Key words Agrobacterium tumefaciens-mediated transformation, Embryogenesis, Genetic transformation, Saccharum spp. hybrids, Sugarcane

1

Introduction The current sugarcane cultivars are typically interspecific hybrids between Saccharum officinarum and Saccharum spontaneum. Some of the interspecific hybridizations also involve S. robustum, S. sinense, S. barberi, Miscanthus, or Erianthus [1]. Sugarcane is an economically important crop in the tropical and subtropical regions of the world. Over 75 % of the world’s sugar is derived from sugarcane. Sugarcane is also the most efficient feedstock for the production of the biofuel ethanol. The cost of sugarcane ethanol production in Brazil is lower than that of corn ethanol in the USA, and its production emits less greenhouse gases [2]. Genetic transformation allows targeted improvement of key traits in crop and biofuel production. The first transgenic sugarcane plants were described in 1992 following biolistic gene transfer [3]. Agrobacterium-mediated gene transfer for the production of transgenic sugarcane plants was first reported in 1998 [4]. In contrast to Agrobacterium-mediated

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_24, © Springer Science+Business Media New York 2015

307

308

Hao Wu and Fredy Altpeter

gene transfer, early particle bombardment protocols produced transgenic plants with complex transgene integration pattern and plasmid backbone integration [5, 6]. However, recently optimized biolistic gene transfer protocols using low quantities of minimal expression cassettes result in simple integration patterns without co-integration of plasmid backbone in sugarcane [7–9]. Both Agrobacterium-mediated and biolistic gene transfer protocols for sugarcane are able to deliver similar results in transformation efficiency, transgene integration complexity, and performance [9]. Herbicide, insect, and virus resistance as well as abiotic stress tolerance were introduced into transgenic sugarcane as reviewed by Altpeter and Oraby [10]. More recently transgenic sugarcane with expression of cell wall degrading enzymes [11] or altered cell wall composition [12, 13] was generated to improve its performance as biofuel feedstock. High yields of the value-added sugar isomaltulose were also recently reported through sugarcane metabolic engineering [14]. In this chapter, we provide a protocol for Agrobacteriummediated transformation of sugarcane using immature leaf whorlderived callus [8, 15] as target for inoculation with the super virulent Agrobacterium tumefaciens strain, AGL1 [16, 17], carrying the neomycin phosphotransferase (nptII) selectable marker gene [18] expression cassette in the pPZP200 binary vector [19, 20]. Overgrowth of Agrobacterium is minimized by using a very diluted inoculum and by careful removal of the liquid cocultivation medium from the calli after the cocultivation period. The average transformation efficiency with this protocol for the commercially important cultivar CP 88-1762 is two independent transgenic plants per 1 g of embryogenic callus.

2 2.1

Materials Plant Material

2.2 Agrobacterium Strain and Vector

Tops of sugarcane cultivar CP-88-1762 (see Note 1) are collected from stalks grown in an air-conditioned greenhouse at the University of Florida at 30 °C during the day and 24 °C during the night with natural lighting and photoperiod. Plants were grown in Fafard #2 potting mix (Sun Gro® Horticulture) in 25 L containers and fertilized weekly with Miracle-Gro®—Lawn Food (The Scotts Miracle-Gro Company). The tops were cut below the top visible node when 5–8 aboveground nodes were visible. The super virulent Agrobacterium tumefaciens strain AGL1 [16, 17] was used for the gene transfer carrying the maize ubiquitin (ubi) promoter and intron [21], neomycin phosphotransferase (nptII) gene [18], and nopaline synthase (nos) terminator in the pPZP200 binary vector [19, 20] with pVS1 replicon.

Sugarcane (Saccharum Spp. Hybrids)

2.3

Stock Solutions

309

1. 100 mM AS stock solution (1000×): dissolve 196.2 mg acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone) into 8 mL dimethyl sulfoxide (DMSO), bring the total volume to 10 mL with DMSO, and make it fresh each time (see Note 2). 2. CI3 macro stock solution (10×) [22]: 16.5 g/L NH4NO3, 19.0 g/L KNO3, 4.4 g/L CaCl2 · 2H2O, 3.7 g/L MgSO4 · 7H2O, and 1.7 g/L KH2PO4. Store at 4 °C. 3. Iron stock solution (50×): 1.86 g/L Na2EDTA, 1.39 g/L FeSO4 · 7H2O. Store at 4 °C. 4. CI3 micro stock solution (100×) [22]: 83 mg/L KI, 620 mg/L H3BO3, 1,280 mg/L MnSO4 . H2O, 860 mg/L ZnSO4 .7H2O, 25 mg/L Na2MoO4 . 2H2O, 2.5 mg/L CuSO4 . 5H2O and 2.5 mg/L CoCl2 . 6H2O. Store at 4 °C. 5. B5G vitamins (1,000×) [22]: 10 g/L thiamine-HCl, 1 g/L pyridoxine-HCl, 1 g/L nicotinic acid, 100 g/L myoinositol, 2 g/L glycine. Filter sterilize and aliquot 1 mL into sterile 1.5 mL tubes. Store at −20 °C. 6. 2,4-D stock solution (1,000×): dissolve 300 mg 2,4-dichlorophenoxyacetic acid (2,4-D) in 10 mL 1 M KOH. Add Milli-Q H2O (EMD Millipore) while stirring and bring the total volume to 100 mL. Store at 4 °C. 7. BAP stock solution (10,000×): dissolve 100 mg 6-benzylaminopurine (BAP) in 10 mL 1 M KOH. Add Milli-Q H2O while stirring and bring the total volume to 100 mL. Store at 4 °C. 8. NAA stock solution (1,000×): dissolve 186 mg 1-naphthaleneacetic acid (NAA) in 10 mL 1 M KOH. Add Milli-Q H2O while stirring and bring the total volume to 100 mL. Store at 4 °C. 9. Rifampicin stock solution (1,000×): dissolve 125 mg rifampicin (PhytoTechnology Laboratories # R501) powder into 8 mL DMSO and bring the total volume to 10 mL. Aliquot 1 mL into 1.5 mL sterile tubes and store at −20 °C. 10. Timentin stock solution (1,000×): dissolve 2 g Timentin (PhytoTechnology Laboratories # T869) powder into 8 mL Milli-Q H2O and bring the total volume to 10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes, and store at −20 °C. 11. Cefotaxime stock solution (1,000×): dissolve 2 g cefotaxime (PhytoTechnology Laboratories # C380) powder into 8 mL Milli-Q H2O and bring the total volume to 10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes, and store at −20 °C. 12. Geneticin stock solution (1,000×): dissolve 300 mg geneticin sulfate (G418) (PhytoTechnology Laboratories # G810) powder into 8 mL Milli-Q H2O and bring the total volume to

310

Hao Wu and Fredy Altpeter

10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes, and store at −20 °C. 13. Paromomycin stock solution (1,000×): dissolve 300 mg paromomycin sulfate (PhytoTechnology Laboratories # P710) powder into 8 mL Milli-Q H2O and bring the total volume to 10 mL. Filter sterilize, aliquot 1 mL into 1.5 mL sterile tubes, and store at −20 °C. 14. AB buffer (20×) [23]: 60 g/L K2HPO4, 20 g/L NaH2PO4, adjust pH to 7.0 using KOH or H3PO4. 15. AB salts (20×) [23]: 20 g/L NH4Cl, 6 g/L MgSO4 · 7H2O, 3 g/L KCl, 0.2 g/L CaCl2, 50 mg/L FeSO4 · 7H2O. 2.4

Media

2.4.1 Media for Agrobacterium

1. LB medium (pH 7.0): 10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl. Adjust pH to 7.0. Add 15 g/L agar for solidified media. Autoclave at 121 °C (100 kPa) for 20 min. Add 1/1,000 volume rifampicin stock solution and the appropriate antibiotics after the medium cools to 50 °C. 2. AB-sucrose minimal medium: combine 50 mL sterile 20× AB buffer and 50 mL sterile 20× AB salts with 900 mL sterile sucrose-water (final sucrose concentration is 0.5 %). Adjust pH to 7.0 [23]. Add 1/1,000 volume rifampicin stock solution and the appropriate antibiotics. 3. Vir gene induction medium (VGIM): 1× AB buffer, 1× AB salts, 50 mM 2-(4-morpholino)-ethane sulfonic acid (MES), 0.5 % glucose. Adjust pH to 5.6 [23]. Add 1/1,000 volume AS stock solution.

2.4.2 Media for Plants

1. CI3 medium [22]: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution, 1 mL 2,4-D stock solution, and 20 g sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume to 1,000 mL with Milli-Q H2O. Aliquot 500 mL into 1,000 mL bottles and add 1.5 g Phytagel per 500 mL. Autoclave at 121 °C (100 kPa) for 20 min. Add under aseptic conditions 0.5 mL B5G vitamins stock solution per 500 mL medium after the medium cools to 50 °C and dispense into petri dishes. 2. Cocultivation media: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution, 1 mL 2,4-D stock solution, 2 g inositol and 30 g maltose, 1 mL AS stock solution, and 1 mL B5G vitamins stock solution to 600 mL Milli-Q H2O. Adjust pH to 5.4. Bring the volume to 1000 mL with Milli-Q H2O. Filter sterilize and store at 4 °C. 3. Callus recovery medium: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution, 1 mL 2,4-D stock solution, and 20 g sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume

Sugarcane (Saccharum Spp. Hybrids)

311

to 1000 mL with Milli-Q H2O. Aliquot 500 mL into 1000 mL bottles and add 1.5 g Phytagel per 500 mL medium. Autoclave at 121 °C (100 kPa) for 20 min. Add under aseptic conditions 0.5 mL B5G vitamins stock solution, 0.5 mL Timentin stock solution, and 0.5 mL cefotaxime stock solution after the medium cools to 50 °C and dispense into petri dishes. 4. Callus selection medium: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution, 1 mL 2,4-D stock solution, and 20 g sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume to 1,000 mL with Milli-Q H2O. Aliquot 500 mL into 1,000 mL bottles and add 3 g agarose per 500 mL of medium. Autoclave at 121 °C (100 kPa) for 20 min. Add under aseptic conditions 0.5 mL B5G vitamins stock solution, 0.5 mL Timentin stock solution, 0.5 mL cefotaxime, and 0.5 mL geneticin stock solution after the medium cools to 50 °C and dispense into petri dishes (see Note 3). 5. Callus regeneration media: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution, 0.1 mL BAP stock solution, 1 mL NAA stock solution, and 20 g sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume to 1000 mL with Milli-Q H2O. Aliquot 500 mL into 1000 mL bottles and add 3 g agarose per 500 mL of medium. Autoclave at 121 °C (100 kPa) for 20 min. Add under aseptic conditions 0.5 mL B5G vitamins stock solution, 0.5 mL Timentin stock solution, 0.5 mL cefotaxime stock solution, and 0.5 mL paromomycin stock solution after the medium cools to 50 °C and dispense into petri dishes (see Note 3). 6. Rooting medium: add 100 mL CI3 macro stock solution, 20 mL iron stock solution, 10 mL CI3 micro stock solution, and 20 g sucrose to 600 mL Milli-Q H2O. Adjust pH to 5.8. Bring the volume to 1000 mL with Milli-Q H2O. Aliquot 500 mL into 1000 mL bottles and add 3 g agarose per 500 mL of medium. Autoclave at 121 °C (100 kPa) for 20 min. Add under aseptic conditions 0.5 mL B5G vitamins stock solution, 0.5 mL Timentin stock solution, 0.5 mL cefotaxime stock solution, and 0.5 mL paromomycin stock solution after the medium cools to 50 °C and dispense into petri dishes (see Note 3).

3 3.1

Methods Timeline

1. Callus induction: 6–8 weeks (see Note 4). 2. Growth of Agrobacterium: 3–4 days (2–3 days for growth of a single colony and 1 day for liquid culture). 3. Cocultivation: 2–3 days. 4. Recovery on non-selection medium: 5 days.

312

Hao Wu and Fredy Altpeter

5. Selection of resistant calli: 6 weeks. 6. Regeneration: 6–8 weeks. 7. Rooting: 2–3 weeks. 8. Transplanting and acclimation: 5 days. 9. A total of 6–7 months is needed to obtain transgenic plants established in soil followed by 9 months of growth in the greenhouse to obtain mature plants. 3.2

Callus Induction

1. Disease- and insect-free tops are cut below the top visible node when 5–8 aboveground nodes are visible. Expanded leaves are cut from tops, and the immature leaf whorl is surface sterilized by wiping with 70 % ethanol. 2. After removing the top layer of the leaf whorl, the tops are placed into a laminar hood and wiped again with 70 % ethanol. One to two layers of the leaf whorl are aseptically removed until the apical meristem becomes visible. 3. Ten to twenty leaf whorl cross sections of 1–2 mm thickness are aseptically cut from the leaf whorl section above the apical meristem using sharp razor blades and placed onto solidified CI3 medium (see Note 5) [22]. 4. Seven days after culture initiation, leaf whorl cross sections are separated into half circle segments and then subcultured to fresh CI3 medium every 7 days at 28 °C and in darkness (see Note 6). Callus growth was visible 2 weeks after culture initiation. Calli are used for inoculation with Agrobacterium 6–8 weeks after culture initiation and 3–5 days after the last subculture (see Note 4).

3.3 Preparation of Agrobacterium Culture

1. Transform the plasmid of choice into A. tumefaciens by electroporation [24]. 2. Inoculate 2 mL LB, containing the appropriate antibiotics, with a single colony of the transformed A. tumefaciens. Grow the culture overnight at 28 °C with shaking at 250 rpm (Innova® 42 shaker). 3. Add 1 mL of the abovementioned culture to a 250 mL sterile flask containing 50 mL of LB with the appropriate antibiotics. Grow the culture at 28 °C with shaking at 250 rpm (Innova® 42 shaker) until OD600 reaches 0.6. 4. Pipette 500 μL A. tumefaciens culture and 500 μL 25 % (V/V) glycerol into a 1.5 mL tube to make an A. tumefaciens stock solution. Store at −80 °C. Alternatively it may be used without storage and without the addition of 25 % glycerol. 5. If using a frozen A. tumefaciens stock solution, thaw it on ice and pipette 1 mL A. tumefaciens stock solution (or alternatively pipette 500 μL fresh culture) into a 250 mL sterile flask

Sugarcane (Saccharum Spp. Hybrids)

313

with 50 mL AB-sucrose minimal medium [23]. Grow the culture at 28 °C with shaking at 250 rpm (Innova® 42 shaker) until the OD600 is 0.6. 3.4 Inoculation and Cocultivation

1. Pellet the bacteria by centrifugation for 30 s in a microcentrifuge. Resuspend in 2 volume of VGIM medium. Shake gently at 20 °C with 50 rpm (Innova® 42 shaker) for 14–24 h. Pellet the bacteria by centrifugation 30 s in a microcentrifuge [23]. Resuspend in equal volume of liquid cocultivation medium. 2. Transfer calli to a sterile 150 mL flask. 3. Prepare the inoculum by diluting the resuspended bacteria in liquid cocultivation medium in a 1:49 ratio (see Note 7). 4. Pour the inoculation solution into the flask containing the calli. Ensure all the calli are submerged in the solution. Incubate the calli in the inoculation solution at room temperature for 20 min, with occasional and gentle shaking. 5. Transfer the calli onto sterile filter papers (Whatman #1004090) to remove excessive liquid. 6. Prepare the cocultivation plates by placing three layers of filter papers into a sterile 9 cm petri dish and pipette 4–5 mL cocultivation medium onto the filter papers. 7. With a pipette, remove the excess cocultivation medium from the petri dish and transfer the calli to the filter paper with cocultivation medium. Seal the petri dish with Parafilm, and incubate in the dark at 19 °C for 3 days. 8. Spread the cocultivated calli on three layers of sterile dry filter paper to remove excessive moisture. Repeat this process with fresh filter papers until the filter papers with calli remain dry. Expose the calli on dry filter paper to the air for 10–20 min in a laminar hood for further drying (see Note 8).

3.5 Recovery, Selection, and Regeneration

1. Transfer the calli to recovery medium and incubate at 28 °C for 5 days under a photoperiod with 16 h light and 8 h darkness and with a light intensity of 100 μmol/m2/s. 2. Subculture calli onto selection media every 7 days at 28 °C until geneticin-resistant calli develop. Geneticin-resistant calli normally emerge 5–6 weeks after the initiation of selection. 3. Transfer the resistant calli onto regeneration media when they grow to 0.5 cm in diameter. 4. Subculture the resistant calli onto fresh regeneration media every 7–10 days and incubate at 28 °C under 16 h light and 8 h dark photoperiod with a light intensity of 250 μmol/m2/s. 5. After 2–4 subcultures, transfer shoots taller than 2 cm to rooting medium. The root system establishes in transgenic lines 2–3 weeks after transfer to rooting medium (see Note 9).

314

Hao Wu and Fredy Altpeter

3.6 Transplanting and Greenhouse Care

1. Transfer the plantlets to Fafard #2 potting mix (Sun Gro® Horticulture) after gently washing off excessive agar from the roots with chlorine-free water. Place transparent containers (e.g., magenta jars) over the plantlets to protect them from dehydration and harden for 4 days at 28 °C under 16 h light and 8 h dark photoperiod with a light intensity of 200 μmol/ m2/s in a growth chamber. 2. Remove the covers and exposed the plantlets to 16 h light and 8 h dark photoperiod, at 28 °C light and 24 °C dark with a light intensity of 500 μE/m2/s. Fertilize every week using Miracle-Gro Lawn Food (The Scotts Miracle-Gro Company) following the manufacturer’s instruction. Using manufacturer’s spoon, add half a spoon per 3.6 L of water. Stir to dissolve and apply to pots until saturated. Apply fertilizer weekly. 3. When the plants are 10 cm in height, transfer to 1.3 L pots (Stuewe & Sons Inc. # MT45). Increase the amount of fertilizer to one spoon per 3.6 L of water. Apply fertilizer weekly. 4. Transfer the plants to greenhouse under natural photoperiod at 25–31 °C until the plants are 30 cm in height. Fertilize as described in step 3. 5. Transfer the plants to 5 L pots (Stuewe & Sons Inc. # CP512) and increase weekly fertilization rate to 2 spoons per 3.6 L of water when plants develop aboveground nodes.

4

Notes 1. When alternative genotypes are considered for this protocol, preselect suitable genotypes on the basis of their ability to generate highly embryogenic callus and their plant regeneration potential from embryogenic callus. 2. Do not freeze this stock solution; instead make it fresh before use to preserve its potency. 3. When media are supplemented with geneticin or paromomycin media, use agarose instead of Phytagel or agar to prevent the reagents from precipitating. 4. Callus growth rates vary with the developmental stage of the explant and the genotype. Use fast-growing, highly embryogenic callus as soon as it easily detaches from the explant (6–8 weeks after culture initiation). Longer callus induction periods increase both the transformation efficiency and the frequency of undesirable somaclonal variation. 5. The orientation of the leaf whorl cross sections on the medium influences the induction of embryogenic callus. The removed surface that is distal to the apical meristem should be in contact with the medium.

Sugarcane (Saccharum Spp. Hybrids)

315

6. Frequent subculture supports the formation of embryogenic callus and enhances the regeneration potential. Genotypic differences exist for the tendency to tissue browning with extended subcultures. Subcultures should occur before phenolics released from tissues change the color of the medium. 7. Dilution of A. tumefaciens 50× prior to cocultivation minimizes overgrowth of A. tumefaciens in subsequent steps. 8. It is important that the calli are blotted dry to minimize overgrowth of A. tumefaciens in the subsequent steps. Moderate drying of the calli will not compromise their viability and regeneration potential. 9. Transgenic plantlets expressing NPTII actively grow roots into rooting media supplemented with paromomycin. Nontransgenic escape plants or transgenic plants with very low or no expression of NPTII grow no roots or roots remain on the surface of the paromomycin containing rooting medium. References 1. Irvine JE (1999) Saccharum species as horticultural classes. Theor Appl Genet 98:186–194 2. Crago CL, Khanna M, Barton J, Giuliani E, Amaral W (2010) Competitiveness of Brazilian sugarcane ethanol compared to US corn ethanol. Energy Policy 38:7404–7415 3. Bower R, Birch RG (1992) Transgenic sugarcane plants via microprojectile bombardment. Plant J 2:409–416 4. Arencibia AD, Carmona ER, Tellez P, Chan MT, Yu SM, Trujillo LE, Oramas P (1998) An efficient protocol for sugarcane (Saccharum spp. L.) transformation mediated by Agrobacterium tumefaciens. Transgenic Res 7:1–10 5. Dai S, Zheng P, Marmey P, Zhang S, Tian W, Chen S, Beachy RN, Fauquet C (2001) Comparative analysis of transgenic rice plants obtained by Agrobacterium-mediated transformation and particle bombardment. Mol Breed 7:25–33 6. Travella S, Ross SM, Harden J, Everett C, Snape JW, Harwood WA (2005) A comparison of transgenic barley lines produced by particle bombardment and Agrobacterium-mediated techniques. Plant Cell Rep 23:780–789 7. Taparia Y, Fouad WM, Gallo M, Altpeter F (2012) Rapid production of transgenic sugarcane with the introduction of simple loci following biolistic transfer of a minimal expression cassette and direct embryogenesis. In Vitro Cell Dev Biol Plant 48:15–22 8. Taparia Y, Gallo M, Altpeter F (2012) Comparison of direct and indirect embryogenesis

9.

10.

11.

12.

13.

14.

protocols, biolistic gene transfer and selection parameters for rapid genetic transformation of sugarcane. J Plant Biotechnol 111:131–141 Jackson MA, Anderson DJ, Birch RG (2013) Comparison of Agrobacterium and particle bombardment using whole plasmid or minimal cassette for production of high-expressing, low-copy transgenic plants. Transgenic Res 22:143–151 Altpeter F, Oraby H (2010) Sugarcane. In: Kempken F, Jung C (eds) Biotechnology in agriculture and forestry: genetic modification of plants, vol 64. Springer, Heidelberg, pp 453–467 Harrison MD, Geijskes J, Coleman HD, Shand K, Kinkema M, Palupe A, Hassall R, Sainz M, Lloyd R, Miles S, Dale JL (2011) Accumulation of recombinant cellobiohydrolase and endoglucanase in the leaves of mature transgenic sugar cane. Plant Biotechnol J 9:884–896 Jung JH, Fouad WM, Vermerris W, Gallo M, Altpeter F (2012) RNAi suppression of lignin biosynthesis in sugarcane reduces recalcitrance for biofuel production from lignocellulosic biomass. Plant Biotech J 10:1067–1076 Jung JH, Vermerris W, Gallo M, Fedenko J, Erickson J, Altpeter F (2013) RNAi suppression of lignin biosynthesis increases fermentable sugar yields for biofuel production from field-grown sugarcane. Plant Biotechnol J 11:709–716 Mudge SR, Basnayake SW, Moyle RL, Osabe K, Graham MW, Morgan TE, Birch RG (2013)

316

15.

16.

17.

18.

19.

Hao Wu and Fredy Altpeter Mature-stem expression of a silencing-resistant sucrose isomerase gene drives isomaltulose accumulation to high levels in sugarcane. Plant Biotechnol J 11:502–509 Chengalrayan K, Gallo-Meagher M (2001) Effect of various growth regulators on shoot regeneration of sugarcane. In Vitro Cell Dev Biol Plant 37:434–439 Lazo GR, Stein PA, Ludwig RA (1991) A DNA transformation-competent Arabidopsis genomic library in Agrobacterium. Biotechnology 9: 963–967 Jones HD, Doherty A, Wu H (2005) Review of methodologies and a protocol for the Agrobacterium-mediated transformation of wheat. Plant Methods 1:5–14 Sarwar M, Akhtar M (1990) Cloning of aminoglycoside phosphotransferase (APH) gene from antibiotic-producing strain of Bacillus circulans into a high-expression vector, p KK223-3. Biochem J 268:671–677 Bevan M (1984) A new Agrobacterium vector for plant transformation. Heredity 53:577–578

20. Hajdukiewicz P, Svab Z, Maliga P (1994) The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation. Plant Mol Biol 25:989–994 21. Christensen AH, Quail PH (1996) Ubiquitin promoter-based vectors for high-level expression of selectable and/or screenable marker genes in monocotyledonous plants. Transgenic Res 5:213–218 22. Heinz DJ, Krishnamurthy M, Nickell LG, Maretski A (1977) Cell, tissue and organ culture in sugarcane improvement. In: Reinert J, Bajaj YPS (eds) Applied fundamental aspects of plant cell, tissue and organ culture. Springer, Berlin, pp 3–17 23. Gelvin SB (2006) Agrobacterium virulence gene induction. In: Wang K (ed) Methods in molecular biology, vol 343. Humana, Tatowa, NJ, pp 77–84 24. McCormac AC, Elliott MC, Chen DF (1998) A simple method for the production of highly competent cells of Agrobacterium for transformation via electroporation. Mol Biotechnol 9:155–159

Part V Other Important Plants

Chapter 25 Hemp (Cannabis sativa L.) Mistianne Feeney and Zamir K. Punja Abstract Hemp (Cannabis sativa L.) suspension culture cells were transformed with Agrobacterium tumefaciens strain EHA101 carrying the binary plasmid pNOV3635. The plasmid contains a phosphomannose isomerase (PMI) selectable marker gene. Cells transformed with PMI are capable of metabolizing the selective agent mannose, whereas cells not expressing the gene are incapable of using the carbon source and will stop growing. Callus masses proliferating on selection medium were screened for PMI expression using a chlorophenol red assay. Genomic DNA was extracted from putatively transformed callus lines, and the presence of the PMI gene was confirmed using PCR and Southern hybridization. Using this method, an average transformation frequency of 31.23 % ± 0.14 was obtained for all transformation experiments, with a range of 15.1–55.3 %. Key words Agrobacterium-mediated transformation, Callus, Cannabis sativa, Chlorophenol red assay, Hemp, Mannose selection, Phosphomannose isomerase, Plant tissue culture, Suspension culture, Transformation protocol

1

Introduction Hemp (Cannabis sativa L.) is regaining importance as a cultivated crop after decades of legal prohibitions. Hemp cultivation is now permitted in Canada under strict governmental control. The species, Cannabis sativa, has been selected for very different qualities; while hemp varieties are cultivated for seed, oil, and fiber and may contain only trace amounts of the psychoactive drug, Δ9-tetrahydrocannabinol (THC), related marijuana varieties are selected for high THC content [1–3]. Hemp and marijuana are very difficult to distinguish morphologically but are biochemically distinct. There is interest in developing improved varieties of hemp that are resistant to disease and pest pressures and possess enhanced qualities [1, 4]. Plant tissue culture and genetic transformation are biotechnological approaches that can be used to compliment conventional breeding toward hemp improvement [5]. Clonal multiplication of hemp plants can be achieved through micropropagation by shoot tip culture [6]. A method was also identified to encapsulate

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_25, © Springer Science+Business Media New York 2015

319

320

Mistianne Feeney and Zamir K. Punja

axillary bud explants using synthetic seed technology [7]. Hemp has long been considered recalcitrant to both regeneration and transformation; explants readily form callus and develop roots but have had a very poor ability for shoot formation [4, 8–10]. However, recent progress is now shifting this notion. Indirect shoot organogenesis was demonstrated in a variety of explant sources and cultivars, but the efficiency of plantlet regeneration was low [11]. A much higher frequency plant regeneration and acclimatization were achieved by direct shoot organogenesis from nodal segments containing axillary buds [12]. At present, there is no established protocol for regeneration of hemp by somatic embryogenesis. Hemp has been shown to be amenable to Agrobacteriummediated transformation [10]. Recently, Wahby et al. [13] successfully demonstrated the ability to establish stable transformed hemp tumor and hairy root lines using a wide variety of Agrobacterium tumefaciens and A. rhizogenes strains, respectively. However, to our knowledge, Agrobacterium-mediated transformation has only rarely been applied toward the improvement of hemp with desirable traits. In the only account that we are aware, MacKinnon et al. [4] reported to have developed Botrytis-resistant hemp plants using an Agrobacterium tumefaciens-mediated transformation procedure; however, details of their work were not described. Our objective was to demonstrate that gene transfer can occur in callus cultures, with the anticipation that a regeneration protocol will be established involving an intervening callus phase. With the recent advancements in hemp regeneration [11, 12], this goal is now becoming more attainable. This chapter describes the Agrobacterium-mediated transformation of hemp callus with the selectable marker gene phosphomannose isomerase (PMI). The PMI gene confers a metabolic advantage to the plant cell, allowing growth on a selective medium containing a sugar, mannose, as the selective agent [14]. Methods are outlined for the initiation and establishment of hemp callus and suspension cultures. Callus growing on selection is screened for PMI expression using a biochemical assay. DNA is extracted from putatively transformed callus lines and analyzed by PCR and Southern hybridization techniques to detect the gene of interest. An average transformation frequency of 31.23 % ± 0.14 was obtained for all transformation experiments, with a range of 15.1–55.3 %. This value represents an average of 31 mannose-metabolizing independent events in 100 explants targeted for transformation.

2

Materials

2.1 Hemp Tissue Culture

1. Hemp seeds cv. Anka are monoecious and cultivated for seed. 2. Potting mix soil: Sunshine Mix No. 1 (Sun Gro Horticulture, Bellevue, WA).

Hemp (Cannabis sativa L.)

321

3. Commercial bleach: Javex® containing 4.5 % NaOCl. For sterilization, dilute with double distilled water (ddH2O) to 10 % (v/v) Javex®. 4. Tween-20 (polyethylene sorbitan monolaurate) surfactant. 5. Filter paper: Whatman No. 1, 70 mm diameter filter paper (Whatman Int. Ltd., Cambridge, UK). 6. Plant growth regulator (PGR): 1,000 μM stock solutions. Dissolve PGRs in a small amount of 1 N NaOH (for kinetin) or 70 % ethanol (for 2,4-dichlorophenoxyacetic acid [2,4-D]) and bring to volume with ddH2O. Store at 4 °C. Kinetin and 2,4-D can be co-autoclaved with the media. 7. MB5D1K: Murashige and Skoog (MS) macro- and micronutrients [15] (1,900 mg/L KNO3, 1,650 mg/L NH4NO3, 180 mg/L MgSO4, 170 mg/L KH2PO4, 16.9 mg/L MnSO4·H2O, 6.2 mg/L H3BO3, 8.6 mg/L ZnSO4·7H2O, 0.83 mg/L KI, 0.025 mg/L CuSO4·5H2O, 0.25 mg/L Na2MoO4·2H2O, 0.025 mg/L CoCl2·6H2O, 440 mg/L CaCl2·2H2O, 27.8 mg/L FeSO4·7H2O, 37.3 mg/L Na2EDTA), Gamborg B5 vitamins [16] (1 mg/L nicotinic acid, 1 mg/L pyridoxine-HCl, and 10 mg/L thiamine-HCl), 0.1 g/L myo-inositol, 30 g/L sucrose, 8 g/L bacteriological agar (Anachemia Canada Inc., Montreal, PQ), 5 μM 2,4-D, 1 μM kinetin, pH 5.8. 8. MB2.5D: MS macro- and micronutrients, Gamborg B5 vitamins, 0.1 g/L myo-inositol, 30 g/L sucrose, 8 g/L bacteriological agar (for solid medium), 2.5 μM 2,4-D, pH 5.8. 9. Parafilm (Pechiney Plastic Packaging, Chicago, IL). 2.2 Agrobacterium Culture Conditions

1. Agrobacterium tumefaciens strain EHA101 [17] contains plasmid pNOV3635 as a binary vector [10]. The plasmid pNOV3635 carries a PMI gene under control of the Arabidopsis thaliana ubiquitin promoter (Ubq3) and the nopaline synthase terminator (NOS). Spectinomycin and kanamycin selectable markers are present on the pNOV3635 plasmid and the Ti plasmid carrying the virulence genes, respectively. 2. LB (Luria-Bertani medium): 10 g/L bacto-tryptone, 5 g/L bacto-yeast extract, 10 g/L NaCl, and 15 g/L bacteriological agar (for solid medium). 3. Spectinomycin dihydrochloride: dissolve in ddH2O at 0.25 M. Filter sterilize using a 0.2 μm filter and store in aliquots at −20 °C. 4. Kanamycin monosulfate: dissolve in ddH2O at 0.17 M. Filter sterilize using a 0.2 μm filter and store in aliquots at −20 °C. 5. Agrobacterium cultures are centrifuged using a Beckman GS-6R centrifuge (Beckman Coulter Inc., Fullerton, CA).

322

Mistianne Feeney and Zamir K. Punja

6. Acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone): dissolve in a small quantity of 100 % methanol. Dilute with ddH2O at 100 mM. Filter sterilize using a 0.2 μm filter and store in aliquots at −20 °C. 2.3

Transformation

2.3.1 Inoculation and Cocultivation

1. Filtration funnels: a Coors Porcelain Hirsch funnel with a fixed perforated plate or a Coors Porcelain Buchner funnel with a fixed perforated plate can be used (Fisher Scientific, Pittsburgh, PA). 2. Filter paper: Whatman No. 1, sized to fit the perforated funnel plate (Whatman Int. Ltd., Cambridge, UK).

2.3.2 Selection

1. Timentin: dissolve in ddH2O at 300 mg/mL. Filter sterilize using a 0.2 μm filter. Prepare fresh before each use. 2. Mannose (D-mannopyranose): dissolve in media with other components.

2.4

PMI Assay

1. Chlorophenol red: dissolve in a small amount of 70 % ethanol and add to assay medium. Chlorophenol red has a strong, unpleasant smell and should be dispensed while wearing gloves in a fume hood. 2. PMI assay media: MB2.5D supplemented with either 20 g/L mannose (selection) or 30 g/L sucrose (control), 0.1 g/L chlorophenol red, 8 g/L bacteriological agar, pH 6 (see Note 1). 3. Enzyme-linked immunosorbent assay (ELISA) plates.

2.5 Genomic DNA Extraction and Molecular Analysis

1. Grind callus samples using a plastic pellet pestle (Kontes Glass Company, Vineland, NJ) attached to a handheld drill.

2.5.1 Genomic DNA Extraction

3. Silica sand: approximately 50 g of sand in a glass jar autoclaved at 121 °C and 15–20 psi for 25 min (Sigma, St. Louis, MO).

2. Polyvinylpolypyrrolidone (PVPP).

4. DNeasy® AP1 buffer: a component of the Qiagen DNeasy® Plant Mini Kit (Qiagen, Valencia, CA). 5. 100 mg/mL RNase A: a component of the Qiagen DNeasy® Plant Mini Kit (Qiagen, Valencia, CA). 6. Qiagen DNeasy® Plant Mini Kit (Qiagen, Valencia, CA). 2.5.2 PCR

1. Primers: consist of two 18-nucleotide sequences (40 nM each) PMI-F 5′-ACAGCCACTCTCCATTCA-3′ and PMI-R 5′-GTTTGCCATCACTTCCAG-3′ [18]. Dilute to 1.5 μM with sterile ddH2O. Store at −20 °C. 2. 10× PCR buffer: 200 mM Tris–HCl and 500 mM KCl. Store at −20 °C (Invitrogen, Burlington, ON). 3. 50 mM MgCl2: store at −20 °C (Invitrogen, Burlington, ON).

Hemp (Cannabis sativa L.)

323

4. Ultrapure dNTP set: stock solutions are made at 10 mM each dATP, dTTP, dGTP, and dCTP. Store at −20 °C (Amersham Biosciences, Piscataway, NJ). 5. Taq polymerase: store at −20 °C (Invitrogen, Burlington, ON). 6. Amplification is carried out using a DNA Thermal Cycler 9700 (PE Applied Biosystems, Mississauga, ON). 2.5.3 Southern Hybridization

1. HindIII: store enzyme at −20 °C. 2. Nylon membrane: positively charged Hybond-XL membrane (Amersham Biosciences, Piscataway, NJ). 3. Radiolabeled probe: PCR amplification of the 550 bp PMI gene fragment, substituting a P32-labeled dCTP. The PCR product is purified using a QIAquick PCR Purification Kit (Qiagen, Mississauga, ON). 4. X-ray film: Kodak X-OMAT.

3

Methods

3.1 Hemp Tissue Culture

1. Sow hemp seeds in 5 cm2 plastic containers containing moistened potting mix soil at ambient room temperatures (21–24 °C). Place seedlings under cool-white fluorescent lights with an intensity of 18 μmol/m2/s and a 12 h photoperiod (see Note 2). 2. By 4 weeks, seedlings grow to a height of about 20 cm and have 2–4 pairs of true leaves. Cut seedlings at the base of the stem, approximately 1–1.5 cm from the soil. 3. Surface sterilize the seedlings by immersion in 70 % ethanol for 20 s, followed by 10 % commercial bleach containing two drops of 0.1 % Tween-20/100 mL for 1 min, while stirring gently. Rinse three times with sterile ddH2O. 4. Transfer seedlings to sterile Petri dishes lined with moistened filter paper. Excise stem (0.5 cm long) and leaf (0.5 cm2) sections and transfer explants to MB5D1K solid medium. Wrap dishes in Parafilm and place cultures in the dark at ambient room temperature for 1 month for callus development (see Note 3). 5. To initiate suspension cultures, callus developing on explants are cut into small pieces. Transfer 0.5–1 mg of callus to 20 mL of MB2.5D liquid medium in 150 mL Erlenmeyer flasks. Cap flasks with a double layer of aluminum foil and shake at 115 rpm at ambient room temperature with 12 h/day light at an intensity of 10 μmol/m2/s. 6. Subculture suspension cultures at 2 week intervals by discarding 3/4 of the spent medium and replacing with fresh medium.

324

Mistianne Feeney and Zamir K. Punja

7. At 4 weeks, transfer suspensions to 50 mL of MB2.5D liquid medium in 250 mL Erlenmeyer flasks by suctioning 1 mL packed cell volume through a 3 mm diameter pipette tip. Shake cultures at 150 rpm. 3.2 Agrobacterium Culture Conditions

1. Agrobacterium tumefaciens strain EHA101 containing the binary vector pNOV3635 (Syngenta, Switzerland) is used for hemp transformation. Inoculate 25 mL of LB liquid medium with one colony of Agrobacterium. To retain the Ti plasmid and pNOV3635 within the bacteria, LB is supplemented with 50 mg/L of kanamycin and 150 mg/L of spectinomycin, respectively. Shake culture at 250 rpm at 28 °C for 48 h (see Note 4). 2. Collect bacterial cells by centrifugation at 3,700 × g for 20 min. 3. Wash pellet with MB2.5D and resuspend in MB2.5D containing 100 μM of acetosyringone to a final OD600nm 1.6–1.8. Incubate culture for 10 min with occasional stirring in the laminar flow hood prior to inoculating plant cells.

3.3

Transformation

3.3.1 Inoculation and Cocultivation

1. Using a 3 mm wide-mouthed pipette, transfer 1 mL (packed cell volume) of hemp suspension cell clumps along with 4 mL of MB2.5D to a sterile Petri dish. 2. Inoculate suspension cells with 5 mL of Agrobacterium culture for 30 min with occasional stirring. 3. Meanwhile, a vacuum filtration apparatus is assembled in the flow hood. Place a clean support stand in the flow hood. Fasten a 2 L sterile glass filtering flask to the support using a flask clamp. Attach tubing from the glass filtering flask to a vacuum source. A clean rubber stopper with a hole is fitted over the mouth of the filtering flask into which a sterile funnel is placed. The filtering assembly requires a tight fit to make a seal and produce a vacuum. 4. Collect hemp suspension cells onto a filter paper by vacuum filtration. 5. Transfer the filter paper and suspension cells to MB2.5D solid medium. Wrap dishes with Parafilm and cocultivate for 3 days in the dark at ambient room temperature.

3.3.2 Selection

1. Gently scrape suspension cells onto a fresh moistened filter paper placed in a sterile filtering funnel which is fitted onto the vacuum filtration apparatus. Rinse three times with a total volume of 200 mL of MB2.5D to wash off bacteria. 2. To further eliminate Agrobacterium after washing, transfer the filter supporting suspension cells to MB2.5D solid medium containing 300 mg/L of Timentin. Wrap dishes with Parafilm and place in the dark for 7 days.

Hemp (Cannabis sativa L.)

325

Fig. 1 Selection of Anka callus transformed with pNOV3635 on MB2.5D with 300 mg/L Timentin and 1 % mannose after 4 weeks. (a) Non-transformed cell masses are arrested in growth. (b) Transformed cell masses are distinguished by their enlarged size compared to untransformed callus. (c) Transformed callus on mannose medium, forming large, pale yellow callus protruding from small, dark-yellow parental callus. Photos are of 9 cm diameter dishes. Scale bar: 5 mm for (c). (d, e) Chlorophenol red PMI assay after 3–4 days. Medium is composed of MB2.5D, 8 g/L agar, and 0.1 g/L chlorophenol red with either 3 % sucrose or 2 % mannose. Control wells do not contain callus. (T ) Transformed callus harboring the PMI gene grew on both sugar sources, turning the medium pale yellow. (AS ) Non-transformed callus metabolized sucrose and acidified the medium, turning it a pale yellow color. (AM ) Callus incubated with Agrobacterium lacking the PMI plasmid did not acidify the medium. Well diameter in each dish is 1.5 cm (Reproduced with permission from ref. 10)

3. Transfer small individual callus clumps to MB2.5D solid medium containing 1 % (w/v) mannose and 300 mg/L of Timentin (see Note 5). Wrap dishes with Parafilm and place in the dark for 4 weeks (see Note 6). The appearance of callus after 4 weeks of incubation is shown in Fig. 1a–c. 4. Transfer growing callus to MB2.5D containing 2 % (w/v) mannose and 150 mg/L of Timentin for 4 weeks in the dark. 3.4

PMI Assay

Most plant cell and tissue cultures are dependent on a carbon source, often sucrose, supplemented in the medium. Mannose is recognized as a carbon source that cannot support growth of most plant cells because of their inability to metabolize the sugar [19]. The PMI selection strategy makes use of mannose as a selection agent. Cells expressing the PMI gene are conferred a metabolic advantage over cells lacking the gene. Growth of transgenic tissue

326

Mistianne Feeney and Zamir K. Punja

is supported on mannose-containing media, while non-transformed tissue either stops growing or dies from starvation [14, 20]. The chlorophenol red assay [21] is a quick and easy method to screen for the expression of the PMI gene in putatively transformed cells. The assay is based on the observation that actively growing plant cells acidify their surroundings [21]. Chlorophenol red is an indicator dye that is sensitive to pH changes. It can be incorporated into the mannose selection medium and will produce a color change as the pH of the medium decreases [22, 23]. A color change from red to yellow in the assay medium reflects callus growth, indicating that the sample expresses the PMI gene. Callus unable to actively grow and metabolize in the presence of mannose does not acidify the medium, and the color remains red. All callus lines testing positive for PMI expression in the chlorophenol red assay were confirmed to carry the PMI gene in PCR assays (see Note 7). 1. PMI assay media are dispensed in 600 μL aliquots into each well of a sterile 24-well ELISA plate (see Note 8). 2. Transfer callus pieces (approx. 0.6 cm2) into each well of the ELISA plate. Wrap plate with Parafilm and incubate in the dark for 3 days. 3. Record color changes in each well and photograph the ELISA plate (see Note 9). Sample PMI assays are depicted in Fig. 1d, e. 3.5 Genomic DNA Extraction and Molecular Analysis 3.5.1 Genomic DNA Extraction

1. DNA is extracted from callus following a modified protocol [24]. Grind each 100 mg callus sample with 25 mg of PVPP, 100 mg of sterile silica sand, 200 μL of DNeasy® AP1 buffer, and 4 μL of RNase A in a 1.5 mL microfuge tube. 2. Add an additional 200 μL of AP1 buffer to each sample, vortex, and isolate DNA following the Qiagen DNeasy® kit procedure. 3. Genomic DNA is stored at 4 °C.

3.5.2 PCR

1. Assemble all reagents for the PCR reaction. Each 25 μL PCR reaction contains 1.5 mM of MgCl2, 20 mM of Tris–HCl, 50 mM of KCl, 200 μM of each dNTP, 0.2 μM of each primer, two units of Taq polymerase, 5 μL of template DNA (of appropriate dilution), and sterile ddH2O to volume. 2. Primers amplify a 550 bp region within the PMI gene [18]. PCR conditions: initial denaturation step of 3 min at 95 °C followed by 30 cycles of 30 s at 95 °C (template denaturation), 30 s at 55 °C (primer annealing), and 45 s at 72 °C (DNA synthesis), with a terminal elongation step of 5 min at 72 °C. 3. Once the reaction is complete, PCR products can be stored at 4 °C or −20 °C until further analysis, or samples can be run on a 0.9 % agarose gel and visualized by illumination with ultraviolet light.

Hemp (Cannabis sativa L.) 3.5.3 Southern Hybridization

327

1. Digest genomic DNA with HindIII at 37 °C overnight. 2. Electrophorese samples on a 0.8 % agarose gel. 3. Transfer DNA fragments from the gel to a nylon membrane by capillary transfer with 0.4 M NaOH using a downward blot assembly [25]. 4. Hybridization of the P32-labeled probe to the filter is performed according to the Amersham protocol for Hybond-XL membranes. 5. Expose membrane to X-ray film in the presence of an intensifying screen for 3–24 h at −80 °C.

4

Notes 1. Assaying other hemp varieties or tissue types may require adjusting the concentration of chlorophenol red within the assay medium. Higher concentrations of chlorophenol red (up to 2 mg/mL) incorporated into the PMI assay medium caused transgenic callus to absorb the dye and produced no color change within wells. The callus did not resume growth when transferred back to mannose- or sucrose-containing medium. An excess uptake of chlorophenol red from the assay medium may arrest tissue metabolism and cause cell death. 2. Hemp seedlings attract thrip insect pests. Thrip eggs are difficult to see and can survive the sterilization process and ruin experiments. A thrip predatory mite (Amblyseius cucumeris) can be successfully used as a biological control agent to significantly lower or eliminate the thrip population before a new batch of seeds are planted for experiments. The predatory mites have not interfered with experiments and can be purchased from local garden stores. 3. After sterilization, it is important to place seedling material onto sterile moistened filter paper while cutting explants. Seedling tissues quickly wilt under flow hood conditions, which may affect callus development. The moistened filters keep tissues turgid during processing. 4. Agrobacterium cultures should be frozen at −80 °C for longterm storage. To do this, transfer 750 μL bacteria and 250 μL 50 % (v/v) sterile glycerol to a labeled, sterile cryotube (Nunc, Thermo Fisher Scientific). Gently invert tube to mix, quickly freeze in liquid nitrogen, and store at −80 °C. To start a culture for experiments, scrape cells from the frozen culture with a sterile loop and streak an LB plate containing the appropriate selection.

328

Mistianne Feeney and Zamir K. Punja

5. Hemp suspension cells are moved to different treatments on a filter paper support for ease of transfer. Individual cell clumps (without filter paper support) are transferred to selection to maintain better contact with the medium. 6. Callus turns from pale yellow to a darker yellow color within 1 week of being placed on 1 % mannose selection medium. By 4 weeks, cells capable of metabolizing mannose are easily distinguished by their color and larger size. Pale yellow callus emerges from darker yellow cell clumps, growing larger than other callus masses. 7. We found two callus lines that were not positive for gene expression in the PMI assay but were confirmed to harbor the PMI gene by PCR analysis. It is possible that the PMI assay may not be sensitive enough to detect low-expressing transgenic tissue or that the PMI gene was silenced. 8. Over time, the color of the PMI assay medium can fade from red to a pale red/orange color, and the small quantity of assay medium within wells dries out quickly from water evaporation, so it is recommended to use freshly prepared assay medium. 9. Control callus not containing the PMI gene (incubated with EHA101 lacking pNOV3635) can give false-positive results when assayed for PMI activity. When transferred to mannosecontaining assay medium, control callus will produce a color change, suggesting that it can metabolize mannose. However, subculture to fresh assay medium produces no color change, indicating that callus cannot survive on mannose-containing media. Control callus may store sugar reserves when grown on sucrose-containing medium. Upon transfer to mannosecontaining medium, the sugar reserves are utilized for metabolism, acidifying the assay medium. To eliminate false-positive results, the control callus is incubated for 1 week on mannosecontaining medium prior to analysis by the PMI assay.

Acknowledgments We thank S. Clemens for providing technical assistance with Southern hybridizations. This research was funded by the Natural Sciences and Engineering Research Council of Canada to ZKP and the John Yorston Scholarship in Pest Management to MF. In accordance with Health Canada regulations, all hemp cultures used in this research were subjected to regular analyses for THC content over the duration of the study to ensure they did not exceed the legal allowable limit of 0.3 % THC. The cultures were grown under permit No. 00-F0041-R-01 and disposed of according to the requirements.

Hemp (Cannabis sativa L.)

329

References 1. Clarke RC (1999) Botany of the genus Cannabis. In: Ranalli P (ed) Advances in hemp research. Haworth, Binghamton, NY, pp 1–19 2. Lata H, Chandra S, Techen N, Khan IA, ElSohly MA (2011) Molecular analysis of genetic fidelity in Cannabis sativa L. plants grown from synthetic (encapsulated) seeds following in vitro storage. Biotechnol Lett 33:2503–2508 3. Stott CG, Guy GW (2004) Cannabinoids for the pharmaceutical industry. Euphytica 140:83–93 4. MacKinnon L, McDougall G, Aziz N, Millam S (2001) Progress towards transformation of fibre hemp. In: Macfarlane Smith WH, Heilbronn TD (eds) Annual Report of the Scottish Crop Research Institute, 2000/2001, SCRI, Invergowrie, Dundee, pp 84–86 5. Ranalli P (2004) Current status and future scenarios of hemp breeding. Euphytica 140: 121–131 6. Wang R, He L-S, Xia B, Tong J-F, Li N, Peng F (2009) A micropropagation system for cloning of hemp (Cannabis sativa L.) by shoot tip culture. Pak J Bot 41:603–608 7. Lata H, Chandra S, Khan IA, ElSohly MA (2009) Propagation through alginate encapsulation of axillary buds of Cannabis sativa L.: an important medicinal plant. Physiol Mol Biol Plants 15:79–86 8. Fisse J, Braut F, Cosson L, Paris M (1981) Étude in vitro des capacités organogénétiques de tissus de Cannabis sativa L.; effet de différentes substances de croissance. Pl Méd Phytopath 15:217–223 9. Mandolino G, Ranalli P (1999) Advances in biotechnological approaches for hemp breeding and industry. In: Ranalli P (ed) Advances in hemp research. Haworth Press, Binghamton, NY, pp 185–212 10. Feeney M, Punja ZK (2003) Tissue culture and Agrobacterium-mediated transformation of hemp (Cannabis sativa L.). In Vitro Cell Dev Biol Plant 39:578–585 11. Slusarkiewicz-Jarzina A, Ponitka A, Kaczmarek Z (2005) Influence of cultivar, explant source and plant growth regulator on callus induction and plant regeneration of Cannabis sativa L. Acta Biol Crac Ser Bot 47:145–151 12. Lata H, Chandra S, Khan I, ElSohly MA (2009) Thidiazuron-induced high-frequency direct shoot organogenesis of Cannabis sativa L. In Vitro Cell Dev Biol Plant 45:12–19 13. Wahby I, Caba JM, Ligero F (2013) Agrobacterium infection of hemp (Cannabis sativa L.): establishment of hairy root cultures. J. Plant Interact 8:312–320

14. Stoykova P, Stoeva-Popova P (2011) PMI (manA) as a nonantibiotic selectable marker gene in plant biotechnology. Plant Cell Tissue Org Cult 105:141–148 15. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15:473–497 16. Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50:151–158 17. Hood EE, Helmer GL, Fraley RT, Chilton M-D (1986) The hypervirulence of Agrobacterium tumefaciens A281 is encoded in a region of pTiBo542 outside of T-DNA. J Bacteriol 168:1291–1301 18. Negrotto D, Jolley M, Beer S, Wenck AR, Hansen G (2000) The use of phosphomannoseisomerase as a selectable marker to recover transgenic maize plants (Zea mays L.) via Agrobacterium transformation. Plant Cell Rep 19:798–803 19. Joersbo M (2001) Advances in the selection of transgenic plants using non-antibiotic marker genes. Physiol Plant 111:269–272 20. Wang H, Petri C, Burgos L, Alburquerque N (2013) Phosphomannose-isomerase as a selectable marker for transgenic plum (Prunus domestica L.). Plant Cell Tissue Org Cult 113:189–197 21. Kramer C, DiMaio J, Carswell GK, Shillito RD (1993) Selection of transformed protoplastderived Zea mays colonies with phosphinothricin and a novel assay using the pH indicator chlorophenol red. Planta 190:454–458 22. Wright M, Dawson J, Dunder E, Suttie J, Reed J, Kramer C, Chang Y, Novitzky R, Wang H, Artim-Moore L (2001) Efficient biolistic transformation of maize (Zea mays L.) and wheat (Triticum aestivum L.) using the phosphomannose isomerase gene, pmi, as the selectable marker. Plant Cell Rep 20:429–436 23. Bakshi S, Saha B, Roy NK, Mishra S, Panda SK, Sahoo L (2012) Successful recovery of transgenic cowpea (Vigna unguiculata) using the 6-phosphomannose isomerase gene as the selectable marker. Plant Cell Rep 31:1093–1103 24. Schluter C, Punja ZK (2002) Genetic diversity among natural and cultivated field populations and seed lots of American ginseng (Panax quinquefolius L.) in Canada. Int J Plant Sci 163:427–439 25. Koetsier PA, Schorr J, Doerfler W (1993) A rapid optimized protocol for downward alkaline Southern blotting of DNA. Biotechniques 15:260–262

Chapter 26 Orchids (Oncidium and Phalaenopsis) Chia-Wen Li, Chia-Hui Liao, Xia Huang, and Ming-Tsair Chan Abstract This chapter describes an efficient and reproducible method for large-scale propagation of Oncidium and Phalaenopsis protocorm-like bodies (PLBs) using floral stalk sections and seeds, respectively. The propagated PLBs can be used for Agrobacterium-mediated transformation. An advanced transformation system for Oncidium and Phalaenopsis orchids has been established. This protocol demonstrates that the time during which the PLBs are cocultivated with Agrobacterium is the key to promoting transformation efficiency. Modified DNA and RNA extraction methods are also provided to diminish polysaccharide contamination and to improve the quality for further molecular analysis. Key words Agrobacterium tumefaciens, Oncidium orchid, Phalaenopsis, Protocorm-like body (PLB)

1

Introduction The elegant shapes of orchids make them very popular flowers. The orchid Phalaenopsis is an important floriculture product in Taiwan. The export value of Phalaenopsis reached USD 114,175,000 in 2012 (Agricultural Trade Statistics Query System, Council of Agriculture, Executive Yuan, Taiwan). Oncidium spp. are also commercially important in Taiwan as cut flowers and as flowering potted orchid plants. During the 1980s, a commercial Oncidium Gower Ramsey was introduced into Taiwan and has become a most important cut orchid flower variety. By 2012, the planted area of Oncidium had increased to more than 200 ha, and cut flower exports had reached 1,618 t (valued at USD 18,462,000) to the Japan floral cutting market, which accounts for 94.3 % of all cut and potted Oncidium flower exports from Taiwan (Agricultural Trade Statistics Query System, Council of Agriculture, Executive Yuan, Taiwan). Oncidium Gower Ramsey has brought economic benefits, but the unitary flower colors and patterns of this variety limit market expansion. Oncidium orchids are self-incompatible, so it is difficult to obtain new traits by traditional breeding. Since the 1990s, gene

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_26, © Springer Science+Business Media New York 2015

331

332

Chia-Wen Li et al.

manipulation technologies have seen significant developments. Conventional transformation systems—Agrobacterium-mediated transformation and particle bombardment—have been used on various plant species. Therefore, application of gene-transfer techniques to orchids could provide an effective way to establish new characteristics such as flower pigmentation [1], flower shape, disease and pest resistance [2, 3], and altered flowering time. In the previous orchid transformation protocol [2, 4, 5], we added tobacco suspension cells and an acetosyringone (AS) supplement to the medium for cocultivating orchid PLBs and Agrobacterium. Recently, we tested and modified this transformation system and found that tobacco suspension cells, AS, and charcoal provided little enhancement of Oncidium transformation or of growth and development, though active charcoal affects growth and development in some varieties of Phalaenopsis. We also found that the cocultivation time and the concentration of Agrobacterium in the liquid cocultivation medium are keys to improving transformation efficiency. This protocol has simplified the Agrobacterium preculture procedure and established the optimal concentration of antibiotics for eliminating Agrobacterium. Here, we describe an effective orchid transformation system and modified molecular analysis protocols for orchids that have been fully tested by our group.

2

Materials

2.1 Plant Materials for Initiation of Protocorm-Like Bodies (PLBs)

1. Floral stalk of Oncidium Gower Ramsey orchid (see Fig. 1a, b).

2.2 Culture Medium for Orchids

1. New Dogashima medium (NDM) for PLB initiation (1 l) [6]: 0.48 g NH4NO3, 0.2 g KNO3, 0.47 g Ca(NO3)2 · 4H2O, 0.15 g KCl, 0.25 g MgSO4 · 7H2O, 0.55 g KH2PO4, 3 mg MnSO4 · 4H2O, 0.5 mg ZnSO4 · 7H2O, 0.5 mg H3BO4, 0.025 mg CuSO4 · 5H2O, 0.025 mg Na2MoO4 · 2H2O, 0.025 mg CoCl2 · 6H2O, 0.5 μl concentrated H2SO4, 0.1 g myoinositol, 1 mg nicotinic acid, 1 mg pyridoxine HCl, 1 mg thiamine HCl, 1 mg calcium pantothenate, 1 mg adenine, 1 mg cysteine, 0.1 mg biotin, 21 mg Fe-EDTA, 10 g maltose, 0.4 mg 6-benzylaminopurine (BA), and 0.1 mg naphthaleneacetic acid (NAA) (see Note 1); pH adjusted to 5.4 and then medium autoclaved. For solid medium, 3 g Phytagel is added before autoclaving.

2.2.1 For Oncidium

2. Silique of Phalaenopsis orchids (see Fig. 2a).

Orchids (Oncidium and Phalaenopsis)

333

Fig. 1 Development of Oncidium explants during transformation procedures. (a) Floral stalk of Oncidium Gower Ramsey. Arrows show the nodes. (b) Stalk sections for PLB initiation. (c) PLB formation on NDM medium. (d) PLB propagation on G10 medium. (e) Cultured Agrobacterium broth and PLBs. (f) PLBs cocultivated with Agrobacterium in NDM liquid medium. (g, h) PLBs selected on G10 medium with antibiotics. (i) GUS staining of PLBs after hygromycin selection. (j) Regeneration of transgenic Oncidium seedlings on G10 medium. (k) Transgenic plants in jars (G10 medium). (l) Transgenic plant in pot (Sphagnum moss medium). (m) Flowering Oncidium plant

334

Chia-Wen Li et al.

Fig. 2 Development of Phalaenopsis explants during transformation procedures. (a) Phalaenopsis equestris silique. (b) PLB propagation on NDM solid medium. (c) PLBs cocultivated with Agrobacterium in NDM liquid medium. (d, e) PLBs selected on T2 medium with antibiotics. (f) Regeneration of transgenic Oncidium seedlings on T2 medium. (g) Transgenic plants in jar (T2 medium). (h) Transgenic plant in pot (Sphagnum moss medium). (i) Flowering Phalaenopsis equestris plant. (j) Molecular analysis of transgenic plants. Upper panel: RT-PCR. Lower panel: Southern blot. GH, plants grown in greenhouse; CR, plants grown in culture room; W, wild-type plant, pflp, sweet pepper ferredoxin-like gene; HPT, hygromycin phosphotransferase gene; 18S, 18S ribosomal RNA

2. G10 medium for PLB propagation (1 l): 4.3 g Murashige and Skoog (MS) salts (without vitamins, Duchefa), 1 g tryptone, 20 g sucrose, 65 g potato tubers, pH adjusted to 5.4, 3 g Phytagel (Sigma) (see Note 2) and 1 g charcoal (optional, see Note 3) added, followed by autoclaving at 15 lb/in.2 pressure, 121 °C, for 20 min.

Orchids (Oncidium and Phalaenopsis)

335

3. PLB pretreatment medium: NDM liquid medium with 0.1 mM acetosyringone (AS; optional, see Note 4). 4. Coculture medium: NDM liquid medium. 5. Washing solution: 40 mg/l meropenem in sterilized deionized water (ddH2O). 6. Selective medium: G10 solid medium supplement with 40 mg/l meropenem and the optimal concentration of antibiotics or other selection agents. 2.2.2 For Phalaenopsis

1. PLB initiation medium (or MS medium, 1 l): 4.3 g MS salts, MS vitamins (1 mg thiamine HCl, 1 mg pyridoxine HCl, 10 mg nicotinic acid, 100 mg myoinositol), 20 g sucrose, pH adjusted to 5.6, 3 g Phytagel or 8 g agar added before autoclaving. 2. PLB propagation medium: NDM solid medium. 3. PLB pretreatment medium: NDM liquid medium with 0.1 mM AS (optional, see Note 4). 4. Coculture medium: NDM liquid medium. 5. Washing solution: 40 mg/l meropenem in sterilized ddH2O. 6. Selective medium (or T2 medium, 1 l): 3.5 g Hyponex No. 1 (N-P-K 7-6-19, Hyponex Co., USA), 1 g tryptone, 0.1 g citric acid, 20 g sucrose, 1 g active charcoal, 20 g sweet potato, and 25 g unripened banana (outer coat peeled and fine paste prepared using a kitchen mixer). The pH of the medium was adjusted to 5.4 with 0.1 N HCl or 0.1 N NaOH before autoclaving and gelling with 0.3 % Phytagel (Sigma). For selection, the medium was supplemented with 40 mg/l meropenem and the optimal concentration of antibiotics.

2.3 Bacterial Strain and DNA Construct

1. Agrobacterium strain EHA105 (see Note 5).

2.4 Culture Medium for Agrobacterium

1. YEP solid medium (1 l): 10 g yeast extract, 10 g peptone, 5 g NaCl, 15 g Bacto Agar; pH adjusted to 7.0 prior to autoclaving.

2. Binary vector pCAMBIA1304/35S::pflp [2]. This plasmid contains an antibiotic-selectable marker gene, a nonantibioticselectable marker gene, and a reporter gene. The antibioticselectable marker, hygromycin phosphotransferase (hpt), confers hygromycin resistance on the transformed plant cells. The nonantibiotic-selectable marker, sweet pepper ferredoxinlike protein (pflp), confers resistance to soft rot bacteria Pectobacterium carotovorum subsp. carotovorum (Pcc) [2, 7]. β-Glucuronidase (GUS) fusion with green fluorescent protein (GUS::GFP) driven by the cauliflower mosaic virus 35S promoter (in pCAMBIA1304) causes the transformed plant cells to appear blue in the presence of 5-bromo-4-chloro-3-indolylβ-D-glucuronide (X-Gluc).

336

Chia-Wen Li et al.

2. MGL broth medium (1 l): 2.5 g yeast extract, 5 g tryptone, 0.1 g NaCl, 5 g mannitol, 1 g L-glutamic acid, 0.25 g KH2PO4, 0.1 g MgSO4 · 7H2O, 1 μg biotin; pH adjusted to 7.0 prior to autoclaving. 2.5 Antibiotics and Other Stock Solutions

1. Stock of 50 mg/ml kanamycin dissolved in ddH2O, filter sterilized, diluted to 50 mg/l for working concentration. 2. Stock of 100 mg/ml hygromycin dissolved in ddH2O, filter sterilized, diluted to 25 mg/l for working concentration (see Note 6). 3. Stock of 40 mg/ml meropenem (Myron, China Chemical & Pharmaceutical Co., Taiwan) dissolved in ddH2O, filter sterilized, diluted to 40 mg/l for working concentration. 4. Stock of 25 mg/ml rifampicin dissolved in dimethyl sulfoxide (DMSO) diluted to 25 mg/l for working concentration. 5. Stock of 1 mg/ml α-naphthaleneacetic acid (NAA): 50 mg NAA dissolved in few drops of 1 N NaOH and brought to 50 ml with ddH2O. 6. Stock of 1 mg/ml 6-benzylaminopurine (BA): 50 mg BA dissolved in few drops of 1 N NaOH and brought to 50 ml with ddH2O. 7. Sodium hypochlorite solution (1 l): 1 % NaOCl (167 ml Clorox bleach per liter), 0.05 % Tween 20.

2.6 Transgenic Plant Verification

1. CTAB DNA extraction buffer: 100 mM Tris, 1.4 M NaCl, 20 mM EDTA, 2 % (w/v) hexadecyltrimethylammonium bromide (CTAB), 0.3 % 2-mercaptoethanol. For 100 ml: 1.21 g Tris base; 8.18 g NaCl; 4 ml 0.5 M EDTA, pH 8.0; 2 g CTAB; water added to final volume of 100 ml, autoclaved and stored at room temperature (RT). Add 0.3 ml 2-mercaptoethanol and 1 g polyvinylpyrrolidone (PVP-40) and warm buffer to 60 °C before use. 2. NaCl: 5 M. 3. Na-acetate: 3 M, pH 5.2. 4. TE buffer: 10 mM Tris–Cl, pH 8.0, 1 mM EDTA, autoclaved. 5. RNase A: 10 mg/ml. 6. Proteinase K: 1 mg/ml. 7. Liquid nitrogen. 8. Phenol/chloroform/isoamyl alcohol (25:24:1). 9. Chloroform/isoamyl alcohol (24:1). 10. RNAmate (BioChain Institute, Hayward, CA). 11. 100 % isopropanol.

Orchids (Oncidium and Phalaenopsis)

337

12. Ethanol (EtOH): 70 and 100 %. 13. X-Gluc staining solution: 1 mM 5-bromo-4-chloro-3-indolyl beta-D-glucuronic acid cyclohexylammonium salt (X-gluc, X-glucuronide), 100 mM sodium phosphate buffer, pH 7.0, 10 mM ethylenediaminetetraacetic acid (EDTA), 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 0.1 % Triton X-100. 14. TRIzol (Invitrogen). 15. TEN buffer (100 ml): 1.21 g Tris, 0.75 g EDTA disodium salt (EDTA · Na2), 1.17 g NaCl, pH adjusted to 9.0. 16. RNA extraction buffer (100 ml): 78 ml TEN buffer, 20 ml 20 % sodium dodecyl sulfate (SDS), 2 ml 0.8 M DL-dithiothreitol (DTT). 17. LiCl: 4 M, diethylpyrocarbonate (DEPC)-treated and autoclaved. 18. DEPC-treated ddH2O. 19. Acid phenol.

3

Methods Different transformation stages of Oncidium and Phalaenopsis are illustrated in Figs. 1 and 2, respectively. The transformation flow charts of Oncidium and Phalaenopsis are presented in Figs. 3 and 4, respectively.

3.1 Initiation of Protocorm-Like Bodies (PLBs) 3.1.1 Initiation of Oncidium PLBs from Stalk Buds (4 Months)

1. Surface sterilization of Oncidium floral stalk: Stalks were rinsed for 5 min in 70 % EtOH and for 25 min in sodium hypochlorite solution (under vacuum for 10 min and with shaking at 50 rpm for 15 min), followed by five washes with sterilized water. 2. The sterilized stalk nodes were cut with axillary buds into approximately 5–10 mm slices (see Fig. 1b) and cultured on NDM solid medium with the appropriate phytohormone (0.4 mg/l NAA and 0.1 mg/l BA) (see Note 1) (see Fig. 1c). 3. They were subcultured per 3–4 weeks. Four months later, the newly differentiated PLBs could be transferred to G10 solid medium for propagation (see Fig. 1d) and Agrobacteriummediated transformation.

3.1.2 Initiation of Phalaenopsis PLBs from Seeds (5 Months)

1. The siliques were sterilized for 5 min in 70 % EtOH and for 25 min in sodium hypochlorite solution (under vacuum for 10 min and with shaking at 50 rpm for 15 min), followed by five washes with sterilized water. 2. The seeds were sown on MS medium.

338

Chia-Wen Li et al.

Initiate PLBs from Oncidium floral stalks on NDM medium with appropriate phytohormones (BA/NAA)

4M Propagate PLBs on G10 medium

21 D Pretreatment of PLBs in NDM/AS liquid medium

3D Co-cultivate the PLBs with Agrobacterium in NDM liquid medium (A60046 h).

Populus trichocarpa

363

3. Do not overgrow the Agrobacterium culture. 4. If plants are not healthy, reduce the concentration of acetosyringone or do not add acetosyringone in the Agrobacterium culture. 5. In order to be able to pick up the razor blades from the petri dish, place razor blades on a microscope slide. Three razor blades can be put separately on a microscope slide that has been autoclaved in a petri dish. 6. Move the explants from the Agrobacterium solution onto the CIM1 plate as quickly as possible. 7. If Agrobacterium C58 is used, the cocultivation time should be exactly 46 h. If GV3101 is used, cocultivate for 48 h. 8. If you notice that the Agrobacterium is difficult to wash out and sticks to your explants, it means over-cocultivation. Overcocultivated explants will turn black and die on CIM2 plates, or alternatively, Agrobacterium will grow on the explants. If this happens, reduce the Agrobacterium concentration or cocultivation time. A red band is always seen on the top of the cut side of the segments, where the stem has not been in contact with the medium. Keep the red band facing up. 9. Limit the exposure time of explants under the wind of the hood to keep the explants from drying out. 10. If the CIM2 medium is too soft, Agrobacterium may grow on it. Usually the medium pH is 5.7. Adjusting the CIM2 pH to 5.8 may help to prevent Agrobacterium growth. 11. A few small calli can be observed after 1 month. If more than 20 % of the explants turn black, it means over-infection. The reasons may be that the plant was unhealthy, cocultivation time was too long, or Agrobacterium was overgrown. 12. The callus will turn green and grow larger. 13. If Agrobacterium grows, add Timentin at a final concentration of 0.2 mg/mL to the medium. References 1. Song J, Lu S, Chen Z, Lourenco R, Chiang VL (2006) Genetic transformation of Populus trichocarpa genotype Nisqually-1: a functional genomic tool for woody plants. Plant Cell Physiol 47:1582–1589 2. Ragauskas AJ, Williams CK, Davison BH et al (2006) The path forward for biofuels and biomaterials. Science 311:484–489 3. Tuskan GA, DiFazio S, Jansson S et al (2006) The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 313:1596–1604 4. Goodner B, Hinkle G, Gattung S et al (2001) Genome sequence of the plant pathogen and

biotechnology agent Agrobacterium tumefaciens C58. Science 294:2323–2328 5. Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet 204:383–396 6. Chen PY, Wang CK, Soong SC, To KY (2003) Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. Mol Breed 11:287–293

Chapter 29 Tall Fescue (Festuca arundinacea Schreb.) Yaxin Ge and Zeng-Yu Wang Abstract Tall fescue (Festuca arundinacea Schreb.) is the predominant cool-season perennial grass in the United States. It is widely used for both forage and turf purposes. This chapter describes a protocol that allows for the generation of a large number of transgenic tall fescue plants by Agrobacterium tumefaciens-mediated transformation. Embryogenic calli induced from caryopsis are used as explants for inoculation with A. tumefaciens. The Agrobacterium strain used is EHA105. Hygromycin phosphotransferase gene (hph) is used as the selectable marker, and hygromycin is used as the selection agent. Calli resistant to hygromycin are obtained after 4–6 weeks of selection. Soil-grown tall fescue plants can be regenerated 4–5 months after Agrobacterium tumefaciens-mediated transformation. Key words Agrobacterium, Festuca arundinacea, Forage and turf grass, Tall fescue, Genetic transformation, Transgenic plant

1

Introduction Tall fescue (Festuca arundinacea Schreb.) is the most important forage species worldwide of the Festuca genus. It forms the basis for beef cow-calf production in the east-central and southeast United States, supporting more than 8.5 million beef cows, and is used for sheep and horse production [1]. It is also widely used for general purpose turf and low-maintenance grass cover and plays an important role in environmental protection [2]. The widespread use of tall fescue is due to its adaptation to a wide range of soil conditions, tolerance of continuous grazing, high yields of forage and seed, persistence, long grazing season, compatibility with varied management practices, and low incidence of pest problems [1]. Tall fescue is a polyploid (2n = 6× = 42), wind-pollinated monocot species with a high degree of self-incompatibility. This makes breeding management difficult and selection schemes complex, resulting in slow breeding progress, especially for traits with low heritability [3]. There has been considerable interest in manipulating tall fescue by genetic transformation in the past decade with

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0_29, © Springer Science+Business Media New York 2015

365

366

Yaxin Ge and Zeng-Yu Wang

the aim of improving its agronomic traits [4, 5]. Transgenic tall fescue plants have been obtained by direct gene transfer to protoplasts, microprojectile bombardment, and Agrobacterium tumefaciens-mediated transformation [4, 6, 7]. The protocol outlined in this chapter is based on our work [6] in tall fescue transformation. We used embryogenic calli as explant and hygromycin as selection agent. Transformation frequency is about 8.7 % based on the number of transgenic plants recovered and the number of original intact calli used. The use of highly embryogenic calli is one of the key factors affecting transformation frequency.

2 2.1

Materials Plant Material

2.2 Agrobacterium tumefaciens Strain and Selectable Marker

2.3 Culture Media for Agrobacterium tumefaciens

Seeds of tall fescue cultivar Jesup [8] (see Note 1). The Agrobacterium tumefaciens strain EHA105 (see Note 2) was used in combination with the binary vector pCAMBIA 1305.1, which carries a hygromycin phosphotransferase gene (hph) and a β-glucuronidase gene (GUSPlus from Staphylococcus sp.), both under the control of CaMV 35S promoter (www.cambia.org). Hygromycin was used as selection agent. 1. LB medium: Add 25 capsules (MP Biomedical LLC, Solon, OH) to 1,000 mL distilled water. Autoclave at 121 °C for 15 min. 2. LB agar medium: Add 40 capsules (MP Biomedical LLC, Solon, OH) to 1,000 mL distilled water. Autoclave at 121 °C for 15 min. Cool to 50 °C, add appropriate antibiotics according to the type of plasmid(s) in the strain, and pour 25 mL aliquots into Petri dishes (100 × 15 mm).

2.4

Tissue Culture

1. Calcium hypochlorite: Prepare fresh 3 % (w/v) calcium hypochlorite solution in a glass bottle; add a few drops of Tween-80. 2. 2,4-Dichlorophenoxy-acetic acid (2,4-D) solution: 1 mg/mL (PhytoTechnology Laboratories, Shawnee Mission, KS). 3. M5 medium: Dissolve 4.43 g Murashige & Skoog basal medium with vitamins (PhytoTechnology Laboratories) in 800 mL distilled water, add 30 g sucrose and 5 mL 2,4-D (1 mg/mL), make up the volume to 1,000 mL with distilled water. Adjust pH to 5.8 and add 7.5 g agar. Autoclave at 121 °C for 15 min. Cool to 50 °C and pour 25 mL aliquots into Petri dishes (100 × 15 mm). Store at 24 °C. 4. M1 liquid medium: Dissolve 4.43 g Murashige & Skoog basal medium with vitamins (PhytoTechnology Laboratories) in 800 mL distilled water, add 30 g sucrose and 1.5 mL 2,4-D

Tall Fescue (Festuca arundinacea Schreb.)

367

(1 mg/mL), make up the volume to 1,000 mL with distilled water. Adjust pH to 5.8 and sterilize with a 0.22 μm disposable filter. 5. Acetosyringone (AS, 100 mM): Dissolve 0.196 g acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, FW 196.2, C10H12O4) in 10 mL dimethyl sulfoxide (DMSO). Aliquot 500 μL to each 1.5 mL Eppendorf microtube and store in the dark at 4 °C. 6. Hygromycin B (Hm): 50 mg/mL in phosphate buffered saline (PBS) buffer with average activity 1,000 units/mg (PhytoTechnology Laboratories). Store in the dark at 4 °C. 7. Cefotaxime (250 mg/mL): Dissolve 5 g cefotaxime in 10 mL distilled water and make up the volume to 20 mL. Sterilize with a 0.22 μm disposable filter and store at −20 °C. 8. M1 selection medium: Dissolve 4.43 g Murashige & Skoog basal medium with vitamins (PhytoTechnology Laboratories) in 800 mL distilled water, add 30 g sucrose and 1.5 mL 2,4-D (1 mg/mL), make up the volume to 1,000 mL with distilled water. Adjust pH to 5.8 and add 7.5 g agar. Autoclave at 121 °C for 15 min. Cool to 50 °C and then add 1.0 mL or 1.5 mL hygromycin and 1 mL cefotaxime. Mix well and pour 25 mL aliquots into Petri dishes (100 × 15 mm) and store at 24 °C. 9. Kinetin: 1 mg/mL stock (PhytoTechnology Laboratories). 10. MSK medium: Dissolve 4.43 g Murashige & Skoog basal medium with vitamins (PhytoTechnology Laboratories) in 800 mL distilled water, add 30 g sucrose and 0.2 mL kinetin (1 mg/mL), make up the volume to 1,000 mL with distilled water. Adjust pH to 5.8 and add 7.5 g agar. Autoclave at 121 °C for 15 min. Cool to 50 °C and add 1 mL cefotaxime. Mix well and pour 25 mL aliquots into Petri dishes (100 × 15 mm) and store at 24 °C. 11. MSO medium: Dissolve 2.22 g Murashige & Skoog basal medium with vitamins (PhytoTechnology Laboratories) in 800 mL distilled water, add 8 g sucrose, make up the volume to 1,000 mL with distilled water. Adjust pH to 5.8 and add 7.0 g agar. Autoclave at 121 °C for 15 min. Cool to 50 °C and pour 25 mL aliquots into Petri dishes (100 × 15 mm). Store at 24 °C. 12. Sterile distilled water. 13. Sterile filter paper (7 cm diameter). 14. Sterile 6.6 cm diameter (190 mL) plastic culture vessels (Greiner Bio-One, Longwood, FL). 15. Sterile 5.0 cm diameter (175 mL) plastic culture vessels (Greiner Bio-One, Longwood, FL).

368

Yaxin Ge and Zeng-Yu Wang

16. Sterile plastic Petri dishes (100 × 15 mm). 17. Forceps, scalpel, and blades. 18. Autoclaved glass flask (125 mL). 19. Drummond Pipet-Aid and sterile disposable pipettes. 20. Magnetic stirrer and stir bars. 21. Shaker/incubator. 22. A rotary shaker. 23. Nalgene transparent polycarbonate desiccator. 24. A swing rotor centrifuge. 25. Spectrophotometer. 26. Metro Mix 350 soil (Sun Gro Horticulture, Terrell, TX).

3

Methods

3.1 Sterilization and Callus Induction

1. Immerse seeds in 3 % calcium hypochlorite solution in a glass bottle. Put a magnetic stir bar in the bottle and place the bottle on a magnetic stirrer. Agitate for 2 h (see Note 3). 2. Rinse the seeds three times with sterile distilled water and leave the seeds overnight at 4 °C. 3. Sterilize the seeds again for 30 min in 3 % calcium hypochlorite solution the next day; rinse the seeds three times in sterile distilled water (see Note 4). 4. Place about 20 caryopses/seeds per 9 cm culture dish containing M5 medium. Keep dishes, sealed with Parafilm, in the dark at 24 °C. 5. Calli (Fig. 1a–c) formed within 5–7 weeks are used for Agrobacterium tumefaciens-mediated transformation.

3.2 Agrobacterium Preparation

1. Streak A. tumefaciens from a glycerol stock onto LB agar plate with antibiotic selection appropriate for the vector used. Incubate at 28 °C for 2 days. 2. Transfer a single colony from the plate into a flask containing 50 mL LB medium with antibiotic selection appropriate for the vector used. 3. Incubate the cultures on a shaker/incubator at 200 rpm at 28 °C for about 2 days, until the culture has reached an OD600 of 0.8. Add 50 μL 100 mM AS to the bacteria culture; incubate one more hour on a shaker.

3.3 Inoculation of Explants and Cocultivation

1. Centrifuge the Agrobacterium cultures at 2,400 × g for 15 min. 2. Pour off supernatant, resuspend the pellet with M1 liquid medium, adjust OD600 to 0.5–0.8, and add 50 μL 100 mM AS. The Agrobacterium is now ready for transformation.

Tall Fescue (Festuca arundinacea Schreb.)

369

Fig. 1 Transgenic tall fescue (Festuca arundinacea) plants obtained after Agrobacterium tumefaciens-mediated transformation of embryogenic calli. (a) Embryogenic callus induced from caryopses. (b, c) Detailed view of the embryogenic calli. (d) Hygromycin-resistant calli obtained 5 weeks after Agrobacterium tumefaciensmediated transformation and selection of infected callus pieces on M1 medium. (e) Shoot differentiation of hygromycin-resistant calli 4 weeks after transfer onto regeneration medium MSK. (f) Rooted transgenic plants 4 weeks after transfer of the differentiated shoots to rooting medium. (g) Greenhouse-grown transgenic plants 5 months after Agrobacterium tumefaciens-mediated transformation. (h) Fertile transgenic tall fescue after vernalization

3. Transfer tall fescue calli into 6.6 cm culture vessels and break up the calli into small pieces. 4. Add Agrobacterium suspensions to the culture vessels and immerse the callus pieces. 5. Place the culture vessels in a polycarbonate desiccator and draw vacuum (62 cm Hg) for 5–10 min. 6. Release vacuum, incubate the callus pieces and Agrobacteria for 20 min with gentle shaking on a rotary shaker.

370

Yaxin Ge and Zeng-Yu Wang

7. Remove the bacteria after the incubation, transfer the infected callus pieces onto M1 wetted filter papers, and place them in empty culture dishes in the dark at 24 °C for cocultivation (see Note 5). 3.4 Selection and Plant Regeneration

1. After 2 days of cocultivation, transfer the infected callus pieces onto M1 selection (50 mg/L Hm) medium. 2. After 2 weeks, transfer the infected callus pieces to new M1 selection (75 mg/L Hm) medium. Resistant calli normally become visible after 3–4 weeks of selection (Fig. 1d). 3. When the resistant calli are large enough (normally after 4–6 weeks on M1), transfer the resistant calli onto regeneration medium MSK. 4. Keep the regenerating cultures at 24 °C in fluorescent light (40 μmol/m2/s) at a photoperiod of 16 h in the growth chamber for 4–6 weeks (Fig. 1e). 5. Transfer the regenerated shoots/plantlets (Fig. 1e) to 5.0 cm culture vessels containing MSO medium (Fig. 1f).

3.5 Greenhouse Care, Vernalization, and Seed Harvest

1. Transfer well-rooted plantlets (Fig. 1g) to 3 × 3 in. wells in an 18-well flat (6 × 3 wells) filled with Metro Mix 350 soil (see Note 6) and grow them under greenhouse conditions (390 μmol/m2/s, 16 h day/8 h night at 24/20 °C). Plants can be grown on Ebb-Flo® benches and watered once a day with fertilized water containing 50 ppm N (Peters Professional 20-10-20 General Purpose is used as the water soluble fertilizer). 2. Transfer the established plants to 6 in. (1 gal) pots filled with Metro Mix 350 soil and grow them under greenhouse conditions (390 μmol/m2/s, 16 h day/8 h night at 24/20 °C). 3. For seed production, the plants need to be vernalized. Vernalization can be carried out by transferring the plants to the field in the autumn. However, growing transgenic plants in the field needs to be approved by regulatory agencies (e.g., USDA permit). 4. Alternatively, transgenic plants can be vernalized in a cold room or growth chamber [9]. The vernalization scheme involves gradual changes of temperature and day length: (1) after transferring greenhouse-grown plants to a cold room (31 μmol/m2/s), reduce temperature to 18 °C and day length to 12 h light and let the plants adapt for 3 days; (2) reduce temperature to 12 °C and day length to 10 h and let the plants adapt for 3 days; (3) reduce temperature to 6 °C and day length to 8 h and vernalize the plants for 12 weeks; (4) increase temperature to 12 °C and day length to 10 h and grow the plants for 3 days; (5) increase temperature to 18 °C and day

Tall Fescue (Festuca arundinacea Schreb.)

371

length to 12 h and grow the plants for 3 days; and (6) transfer the vernalized plants back to the greenhouse (390 μmol/m2/s, 16 h day/8 h night at 24/20 °C). 5. After vernalization, plants normally flower in about 2 months (Fig. 1h). Because tall fescue is an outcrossing species, crosses need to be made between independent plants (e.g., transgenic and non-transgenic plants) in order to obtain seeds. For crosspollination, emasculate recipient inflorescence and then bag them together with two panicles from the pollen donor plant; supply water to the donor panicles from a 50 mL conical tube fixed to a bamboo stake [10]. Seeds can be harvested 1 month after cross-pollination.

4

Notes 1. Transformation efficiency varies with the cultivar used. By using this protocol, we have been able to produce transgenic plants from another widely used cultivar, Kentucky-31. Endophyte-free seeds should be used. 2. We have been able to produce transgenic tall fescue with either EHA105 or LBA4404 strain. 3. If the seeds are dirty, the first sterilization time can be extended to 2.5 h or even 3 h. Make sure all seeds have good contact with the solution. 4. The majority of seed bracts (lemma and palea) surrounding caryopsis become detached after the second sterilization. The surface sterilization procedure will not remove the endophyte in the seeds. If the seeds contain an endophyte, then the endophyte should be removed by treatment with high humidity and relatively high temperature. Older seeds contain less viable endophyte. 5. The amount of callus pieces on each filter paper was equivalent to approximately 20 original intact calli. 6. Before transfer to soil, rinse the roots with water or remove excessive medium with a damp paper towel.

References 1. Sleper DA, West CP (1996) Tall fescue. In: Moser LE, Buxton DR, Casler MD (eds) Cool-season forage grasses. Madison, WI: American Society of Agronomy; Crop Science Society of America; Soil Science Society of America, pp 471–502 2. Sleper DA, Buckner RC (1995) The fescues. In: Barnes RF, Miller DA, Nelson CJ, Heath

ME (eds) Forages. Iowa State University Press, Ames, IA, pp 345–356 3. Stadelmann FJ, Kolliker R, Boller B, Spangenberg G, Nosberger J (1999) Field performance of cell suspension-derived tall fescue regenerants and their half-sib families. Crop Sci 39:375–381

372

Yaxin Ge and Zeng-Yu Wang

4. Wang Z-Y, Ge Y (2006) Recent advances in genetic transformation of forage and turf grasses. In Vitro Cell Dev Biol Plant 42:1–18 5. Spangenberg G, Wang Z-Y, Potrykus I (1998) Biotechnology in forage and turf grass improvement. Springer, Berlin 6. Wang Z-Y, Ge Y (2005) Agrobacteriummediated high efficiency transformation of tall fescue (Festuca arundinacea Schreb.). J Plant Physiol 162:103–113 7. Bettany AJE, Dalton SJ, Timms E, Manderyck B, Dhanoa MS, Morris P (2003) Agrobacterium tumefaciens-mediated transformation of Festuca arundinacea (Schreb.) and Lolium

multiflorum (Lam.). Plant Cell Rep 21: 437–444 8. Bouton JH, Duncan RR, Gates RN, Hoveland CS, Wood DT (1997) Registration of ‘Jesup’ tall fescue. Crop Sci 37:1011–1012 9. Wang Z-Y, Bell J, Scott M (2003) A vernalization protocol for obtaining progenies from regenerated and transgenic tall fescue (Festuca arundinacea Schreb.) plants. Plant Breed 122:536–538 10. Wang Z-Y, Ge Y, Scott M, Spangenberg G (2004) Viability and longevity of pollen from transgenic and non-transgenic tall fescue (Festuca arundinacea) (Poaceae) plants. Am J Bot 91:523–530

INDEX overview......................................................................3–4 seed source ......................................................................5 seed sterilization and germination ..................................6 selection ......................................................................7–9 shoot isolation ................................................................9

A Ananas comosus (L.) Merr. See Pineapple Apricot Agrobacterium preparation............................................................ 115 strains and vectors ................................................. 112 coculture and washing ................................................116 donor plants ........................................................114–115 efficiencies ..................................................................112 kanamycin........................................................... 113, 116 materials .............................................................112–114 overview..............................................................111–112 pBIN19 ...................................................................... 112 transgenic plants acclimatization ......................................................117 elongation and multiplication ...............................116 regeneration .......................................................... 116 rooting ..................................................................116

B Blueberry bacterial strains and binary vector...............................123 bialaphos .....................................................................123 culture media and stock solutions .......................123–124 greenhouse care...........................................................128 infection and cocultivation.................................. 125–126 kanamycin................................................... 122, 124, 127 leaf explant preparation ..............................................125 overview..............................................................121–123 regrowth .....................................................................127 rooting ................................................................127–128 selection and regeneration ..........................................127 stock culture establishment .........................................125 Brassica rapa Agrobacterium culture ...................................................................5, 6 preparation............................................................6–7 culture media ..............................................................4, 5 efficiency.........................................................................4 explant isolation, inoculation, and cocultivation ...........................................7 gentamicin selection ...................................................7–9 greenhouse care...............................................................9 materials .....................................................................4–6

C Cannabis sativa L. See Hemp Carrot Agrobacterium cultures ....................................................... 60, 62–63 strains and binary vectors ........................................60 herbicide resistant .........................................................60 materials .................................................................60–62 overview..................................................................59–60 pCAMBIA1300 ..................................................... 60, 63 seed sterilization and tissue preparation........................62 transformation procedure .......................................63–64 transformation rate ........................................... 59, 63, 65 Cassava Agrobacterium inoculum preparation .............................................. 75 strains and culture media ........................................73 antibiotics selection......................................69, 72, 76-77 axillary buds enlargement and somatic embryos development..........................................73–75 cassava tissue culture media ..........................................71 efficiency....................................................................... 69 friable, embryogenic callus (FEC) ................... 68, 69, 71, 72, 74, 76, 77, 79 generation of ...........................................................75 materials .................................................................69–73 overview..................................................................67–69 transformation procedure cocultivation............................................................76 recovery and maturation .........................................76 regeneration ......................................................76–77 rooting and screening..............................................77 transfer to soil and glasshouse care ...................77–78 Castanea dentata (Marsh) Borkh. See Chestnut, American Castanea sativa. See Chestnut, European Cherry bacterial strains and binary vector...............................134 culture medium and stock solutions....................134–136 greenhouse care...........................................................140

Kan Wang (ed.), Agrobacterium Protocols: Volume 2, Methods in Molecular Biology, vol. 1224, DOI 10.1007/978-1-4939-1658-0, © Springer Science+Business Media New York 2015

373

AGROBACTERIUM PROTOCOLS 374 Index Cherry (cont.) infection and co-cultivation ........................................138 kanamycin selection .................................... 134, 139, 140 leaf explant preparation ......................................137–138 overview..............................................................133–134 plant materials ............................................................134 regrowth .....................................................................139 rooting ........................................................................ 139 selection and regeneration ..........................................139 stock culture establishment using bud woods with dormant leaf buds ..................................................136–137 using newly formed softwood branches ................136 Chestnut, American Agrobacterium preparation....................................................152–153 strains and vectors .................................................151 bar gene selection........................................................156 bioreactor ............................................ 146, 148, 150, 153 desiccation .................................................. 146, 148, 153 efficiency............................................................. 143, 157 materials .............................................................148–151 overview..............................................................143–148 paromomycin selection ....................... 150, 153–154, 156 rooting and acclimatization ................................154–155 shoot culture ...............................................................154 somatic embryos establishment ................................................151–152 transformation ..............................................153–154 Chestnut, European Agrobacterium-mediated transformation efficiency ............................................... 165, 172, 175 infection and cocultivation............................171–172 kanamycin selection ...................... 166, 168, 172, 175 materials .......................................................165–169 overview ........................................................163–165 plantlet regeneration .............................................173 preparation for infection .......................................171 somatic embryogenesis induction .................169–171 somatic embryos proliferation and maintenance .......................................171 strain and vector ...........................................165–166 forest biotechnology ........................................... 163–165 thaumatin-like protein ................................ 164–166, 174 Citrus juvenile tissue transformation Agrobacterium culture preparation .........................250 Agrobacterium strain and plasmid ..........................247 co-incubation ........................................................ 251 efficiency ...............................................................254 green fluorescent protein detection ....................... 251 materials .......................................................246–248 micro-grafting ..............................................252–254

overview ........................................................245–246 pBI121 ..................................................................247 plant materials preparation ...........................248–250 transgene detection by PCR .........................251–252 mature tissue transformation Agrobacterium culture preparation .........................269 Agrobacterium strain and plasmid ..........................262 co-cultivation ........................................ 261, 269–270 efficiency ...............................................................262 explant materials preparation ........................269–270 fertilizer application ..............................................266 Green fluorescent protein (GFP) detection ..................................................271 histochemical GUS assay ..........................................270 kanamycin resistance gene ....................................262 materials .......................................................262–265 overview ........................................................259–262 pesticide application .............................................266 primary micro-grafting ................................. 267, 268 rootstock production for bud grafting...................265 secondary grafting.........................................267–269 selection of transgenic shoots........................270–271 transplanting .................................................265–266 transgenic shoots harvest ......................................270 Coffea arabica L. See Coffee Coffee Agrobacterium rhizogenes-mediated transformation A. rhizogenes strains and transformation vectors .......................................................281 culture media ........................................................281 molecular analysis ......................................... 287–288 overview ........................................................ 275–279 plant materials ......................................................281 seed sterilization and zygotic embryo germination...............................................285 transformation and hairy root induction ...........................................285–287 Agrobacterium tumefaciens-mediated transformation A. tumefaciens culture preparation .................282–283 callus culture preparation ......................................282 culture media and stock solutions .................279–280 infection and cocultivation....................................283 leaf explant sterilization ........................................282 materials .......................................................279–281 molecular analysis .................................................285 overview ........................................................277–278 selection and regeneration ............................283–284 strains and transformation vectors ........................ 279 breeding ..............................................................276–278 economic importance.......................................... 275, 276 genertic engineering applications ....................... 276, 278 pBIN19 and pMDC32............................... 279, 283, 288 species .................................................................276–279

AGROBACTERIUM PROTOCOLS 375 Index Colocasia esculenta (L.) Schott. See Taro Cotton Agrobacterium-mediated transformation aseptic seed germination .........................................17 cotton tissue culture ................................................16 bacterial inoculant preparation................................ 17 efficiency ..................................................... 14, 19, 21 explant inoculation and cocultivation .....................17 kanamycin resistance test ........................................ 18 materials ...........................................................15–16 media ................................................................15–16 overview ............................................................11–15 regeneration, embryo germination, and plantlet development................................................18 selection and proliferation.......................................18 soil transfer .............................................................18 transformation ........................................................17 genetic engineering application ....................................12 green fluorescent protein reporter .................................13 Cucumis melo L. See Melon

D Daucus carota L. See Carrot

E Euphorbia pulcherrima Willd. ex Klotzsch. See Poinsettia

F Festuca arundinacea Schreb. See Tall fescue Fragaria x ananassa. See Strawberry

G Gossypium hirsutum L. See Cotton Grapevine Agrobacterium rhizogenes-mediated hairy root transformation Agrobacterium preparation and inoculation ........................................188–189 calli and hairy root recovery ..................................189 in vitro plantlets production and inoculation ................................................188 Agrobacterium tumefaciens-mediated plant transformation Agrobacterium culture preparation .........................186 cocultivation.......................................................... 186 embryogenic culture initiation and maintenance ......................................185–186 kanamycin selection ...................................... 186-187 selection and regeneration ............................186–187 transplanting and greenhouse care....................................................187–188 materials .............................................................181–185 overview..............................................................177–181

H Helianthus annuus. See Sunflower Hemp Agrobacterium culture conditions ................ 321–322, 324 Agrobacterium strains and binary vectors. .................... 321 inoculation and cocultivation .............................. 322, 324 mannose selection ............................... 320, 322, 326, 328 materials .............................................................320–323 overview..............................................................319–320 phosphomannose isomerase assay ....................... 325–326 phosphomannose isomerase selection .................................... 320, 324–325 pNOV3635 ......................................... 321, 324, 325, 328 polymerase chain reaction ................................... 326–327 Southern hybridization ....................................... 323, 327 tissue culture ....................................... 320–321, 323–324 transformation frequency ............................................320

J Jatropha Agrobacterium culture for infection ...............................30 culture media and stock solutions for Agrobacterium ..................................................... 30 for plant ..................................................................29 efficiency........................................................... 26, 33, 34 infection, cocultivation and regeneration ......................31 kanamycin resistance ..............................................31, 33 materials .................................................................26–30 overview..................................................................25–26 plant materials ..............................................................26 root induction and acclimatization ...............................31 seed sterilization and explant preparation ..................... 30 transgenic plants genomic DNA isolation and PCR analysis ...........32–33 GUS histochemical assay ........................................32 Jatropha curcas L. See Jatropha Juglans. See Walnut

M Manihot esculenta Crantz. See Cassava Melon Agrobacterium preparation............................................................201 strain and vector ...................................................196 donor plants preparation .....................................198–199 efficiency............................................................. 196, 201 explant preparation ..................................................... 200 kanamycin selection ............................................ 196, 201 materials .............................................................196–198 overview..............................................................195–196 pIG121-Hm ....................................................... 196, 201

AGROBACTERIUM PROTOCOLS 376 Index Melon (cont.) transformation procedures Agrobacterium inoculation ..................................... 201 regeneration .................................................. 201–202 selection ........................................................ 201–202 transplanting and acclimation ...............................202

O Oncidium. See Orchid Orchid Agrobacterium preparation ...........................................340 bacterial strain and DNA construct ............................335 culture media ......................................................332–335 hygromycin selection .......................................... 333, 344 materials .............................................................332–337 overview..............................................................331–332 pCAMBIA1304 ................................................. 335, 340 plant materials ............................................................ 332 protocorm-like bodies (PLBs) initiation for Oncidium ........................................337 initiation for Phalaenopsis ............................337–338 propagation ...........................................................339 transformation process Agro-infiltration and co-cultivation .....................340 regeneration and conversion .........................340–341 selection ................................................................340 transgenic plant analysis genomic DNA isolation ................................341–342 histochemical GUS staining .................................344 PCR amplification ................................................342 reverse transcription-PCR ............................343–344 RNA extraction ....................................................343 Southern blotting..................................................342

P Peach Agrobacterium preparation............................................................211 strain and binary vector ........................................207 efficiency............................................................. 206, 213 GF677 rootstock ................................................ 206, 207 kanamycin selection ............................ 206, 207, 211–212 materials .............................................................207–209 meristematic bulks initiation and regeneration ......................................209–210 overview..............................................................205–207 pBIN19 .............................................................. 207, 211 plant acclimatization...........................................211–212 plant tissue infection ...................................................211 regeneration and selection .................................. 211–212 Phalaenopsis. See Orchid Pineapple Agrobacterium culture maintenance .............................................. 300 vectors and strains .................................................298

explants establishment and maintenance ............................300 regeneration ..........................................................300 frequency ....................................................................294 histochemical GUS assay ............................................302 hygromycin selection .................................. 298, 301–302 inoculation and co-cultivation ....................................300 materials .............................................................298–299 molecular analysis by PCR .................................................................303 by Southern hybridization ....................................303 overview..............................................................293–297 pCAMBIA1304 ......................................... 294, 298, 303 selected transformants multiplication .........................302 transformants selection after encapsulation in Ca-alginate beads .........301–302 prior to encapsulation ...........................................301 Poinsettia Agrobacterium culture preparation ........................................351–352 DNA introduction by electroporation ..................351 strain and vector ...........................................348–349 explant preparation .....................................................352 frequency .................................................................... 348 infection and co-cultivation ................................352–353 materials .............................................................348–351 neomycin phosphotransferase (npt II) ........................ 349 overview..............................................................347–348 transgenic plants propagation/greenhouse cultivation ..............353–354 regeneration ..................................................352–353 Populus trichocarpa Agrobacterium culture preparation ................................................361 strains and vectors .........................................358–359 callus induction and shoot regeneration .....................362 frequency ....................................................................358 inoculation and co-cultivation ............................361–362 kanamycin selection ............................................ 358, 360 materials ............................................................. 358–361 overview..............................................................357–358 pBI121........................................................................358 plant materials ............................................................358 rooting and propagation ............................................. 362 Potato Agrobacterium preparation..............................................................92 strain and binary vector ..........................................87 culture media and stock solutions ...........................87–89 explant preparation, inoculation and cocultivation.......92–93 frequency ......................................................................86 in vitro plant propagation .......................................91–92 materials .................................................................87–91 overview..................................................................85–86 pBI121.............................................................. 86, 87, 95 plant material ................................................................87

AGROBACTERIUM PROTOCOLS 377 Index transgenic plants callus selection and shoot induction........................93 DNA extraction and PCR analysis .........................94 greenhouse care.................................................93–94 GUS histochemical analysis....................................94 shoot elongation and root induction .......................93 transplanting and acclimation .................................93 Prunus armeniaca L. See Apricot Prunus persica L. See Peach Prunus spp. See Cherry

S Saccharum spp. Hybrids. See Sugarcane Sesame Agrobacterium inoculum preparation ........................................40–41 strains and selectable markers .................................39 cocultivation ...........................................................40, 41 culture media ..........................................................39–40 efficiency.................................................................38, 44 explant preparation .......................................................40 materials .................................................................38–40 overview..................................................................37–38 pCAMBIA2301 ...........................................................39 transgenic plants hardening and acclimatization ................................42 rooting ....................................................................42 screening using histochemical GUS analysis ..................................................42–43 shoot regeneration and selection .......................41–42 Sesamum indicum L. See Sesame Solanum tuberosum L. See Potato Strawberry Agrobacterium preparation ...................................222–223 efficiency............................................................. 219, 225 infection.............................................................. 222–223 kanamycin selection ............................................ 219, 224 leaf tissue preparation .................................................222 materials .............................................................219–222 overview..............................................................217–219 pBI121........................................................................ 219 regeneration and selection ..................................223–224 rooting and soil transplantation ..........................224–225 Sugarcane Agrobacterium culture preparation ........................................312–313 strain and vector ...................................................308 callus induction ...........................................................312 efficiency............................................................. 308, 314 geneticin/paromomycin selection ...................... 309–310, 313, 314 inoculation and co-cultivation ....................................313 materials .............................................................308–311 neomycin phosphotransferase (npt II) ........................308 overview..............................................................307–308

recovery, selection and regeneration ............................313 timeline...............................................................311–312 transplanting and greenhouse care ..............................314 Sunflower Agrobacterium culture .....................................................................50 strain and plasmid ...................................................48 cocultivation .................................................................51 efficiency.......................................................................48 explant culture media ..............................................49–50 explant preparation .......................................................50 kanamycin selection ................................................ 48, 52 materials .................................................................48–50 overview..................................................................47–48 seed disinfection ...........................................................50 transgenic plants flowering and T1 seed harvesting .....................53–54 grafting .............................................................52–53 greenhouse acclimaization and transfer to soil ....................................................52–53 molecular analysis ...................................................54 selection and regeneration ......................................52

T Tall fescue Agrobacterium culture media ........................................................366 preparation............................................................368 strain and selectable marker ..................................366 greenhouse care, vernalization and seed harvest...............................................370–371 hygromycin selection .......................................... 366, 370 inoculation and cocultivation ..............................368–370 materials .............................................................366–368 overview..............................................................365–366 pCAMBIA 1305.1 .....................................................366 selection and regeneration ..........................................370 sterilization and callus induction ................................368 tissue culture .......................................................366–368 transformation frequency ............................................366 Taro Agrobacterium culture preparation ................................................103 strains and vector ..................................................101 culture media and stock solutions ......................... 99–100 efficiency................................................................. 98, 99 infection and cocultivation..........................................103 in vitro plantlets establishment ...........................101–103 neomycin phosphotransferase II (npt II) .................... 101 overview..................................................................97–99 pBI121........................................................................ 101 plant material ................................................................99 transgenic plants selection and regeneration ....................................104 transplanting .........................................................105

AGROBACTERIUM PROTOCOLS 378 Index V Vaccinium corymbosum L. See Blueberry Vigna unguiculata (L.) Walp. See Cowpea Vitis vinifera L. See Grapevine

W Walnut Agrobacterium preparation....................................................234–235 transformation vectors and strains ........................231

cocultivation .......................................................235–236 efficiency..................................................................... 231 germination and plant production ......................237–238 histochemical GUS analysis .......................................236 kanamycin/hygromycin selection ................................236 materials .............................................................231–233 media and stock solutions ...................................231–233 overview..............................................................229–231 PCR confirmation ......................................................237 selection ......................................................................236 somatic embryo culture ....................................... 230, 234